Effects of Aloe vera on the Regulation of Thyroxine Release in FRTL-5 Thyroid Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Material Purchase and Extraction
2.2. Cell Culture and Treatment
2.3. Thyroxine Levels
2.4. Cell Proliferation
2.5. Real-Time PCR
2.6. Western Blotting
2.7. Statistical Analysis
3. Results
3.1. Aloe vera Affects Thyroxine Levels Released form FRTL-5 Cells
3.2. Aloe vera Does Not Affect Cell Proliferation
3.3. Aloe vera Regulates TPO Expression at the Transcription and Protein Levels
3.4. Aloe vera Affects the Protein Expression of Phosphorylated ERK and Phosphorylated CREB
3.5. Aloe vera Affects ERK Phosphorylation via PKA Not PKC
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Molehin, D.; Dekker Nitert, M.; Richard, K. Prenatal Exposures to Multiple Thyroid Hormone Disruptors: Effects on Glucose and Lipid Metabolism. J. Thyroid Res. 2016, 2016, 8765049. [Google Scholar] [CrossRef]
- Zhang, Y.; Yu, J.; Zhang, W.; Wang, Y.; He, Y.; Zhou, S.; Fan, G.; Yang, H.; Zhu, Y.; Li, P. An integrated evidence-based targeting strategy for determining combinatorial bioactive ingredients of a compound herbal medicine Qishen Yiqi dripping pills. J. Ethnopharmacol. 2018, 219, 288–298. [Google Scholar] [CrossRef]
- Daryabeygi-Khotbehsara, R.; Golzarand, M.; Ghaffari, M.P.; Djafarian, K. Nigella sativa improves glucose homeostasis and serum lipids in type 2 diabetes: A systematic review and meta-analysis. Complement. Ther. Med. 2017, 35, 6–13. [Google Scholar] [CrossRef]
- Liu, L.; Wang, L.P.; He, S.; Ma, Y. Immune Homeostasis: Effects of Chinese Herbal Formulae and Herb-Derived Compounds on Allergic Asthma in Different Experimental Models. Chin. J. Integr. Med. 2018, 24, 390–398. [Google Scholar] [CrossRef]
- Zhao, X.; Yang, S.; Zhang, W.; Zu, C.; Tang, B.; Zhang, B.; Li, G.; Su, L.; Cai, D. Fuzi-Lizhong pill compensates hypothyroid-hypothermia via ghrelin release. J. Ethnopharmacol. 2013, 149, 707–712. [Google Scholar] [CrossRef]
- Ju, Y.S. Ungok’s Illustrated Guide to Medicinal Materials; Woosuk Press: Jeonju, Republic of Korea, 2017; p. 81. [Google Scholar]
- Heo, J. Donguibogam; Ahn, S.-W., Ed.; Ministry of Health & Welfare: Sejong, Republic of Korea, 2013; Volume 7, p. 3643. ISBN 978-89-5970-141-4. [Google Scholar]
- Foster, M.; Dunter, H.; Samman, S. Evaluation of the Nutritional and Metabolic Effects of Aloe vera. In Herbal Medicine: Biomolecular and Clinical Aspects; Benzie, I.F.F., Wachtel-Galor, S., Eds.; CRC Press/Taylor & Francis, LLC.: Boca Raton, FL, USA, 2011. [Google Scholar]
- Maphosa, V.; Masika, P.J. In vivo validation of Aloe ferox (Mill). Elephantorrhiza elephantina Bruch. Skeels. and Leonotis leonurus (L.) R. BR as potential anthelminthics and antiprotozoals against mixed infections of gastrointestinal nematodes in goats. Parasitol. Res. 2012, 110, 103–108. [Google Scholar] [CrossRef]
- Wintola, O.A.; Sunmonu, T.O.; Afolayan, A.J. The effect of Aloe ferox Mill. in the treatment of loperamide-induced constipation in Wistar rats. BMC Gastroenterol. 2010, 10, 95. [Google Scholar] [CrossRef]
- Solek, P.; Majchrowicz, L.; Koziorowski, M. Aloe arborescens juice prevents EMF-induced oxidative stress and thus protects from pathophysiology in the male reproductive system in vitro. Environ. Res. 2018, 166, 141–149. [Google Scholar] [CrossRef]
- Li, C.Y.; Suzuki, K.; Hung, Y.L.; Yang, M.S.; Yu, C.P.; Lin, S.P.; Hou, Y.C.; Fang, S.H. Aloe Metabolites Prevent LPS-Induced Sepsis and Inflammatory Response by Inhibiting Mitogen-Activated Protein Kinase Activation. Am. J. Chin. Med. 2017, 45, 847–861. [Google Scholar] [CrossRef]
- Noor, A.; Gunasekaran, S.; Vijayalakshmi, M.A. Improvement of Insulin Secretion and Pancreatic β-cell Function in Streptozotocin-induced Diabetic Rats Treated with Aloe vera Extract. Pharmacogn. Res. 2017, 9, s99–s104. [Google Scholar] [CrossRef]
- Rossich, L.E.; Thomasz, L.; Nicola, J.P.; Nazar, M.; Salvarredi, L.A.; Pisarev, M.; Masini-Repiso, A.M.; Christophe-Hobertus, C.; Christophe, D.; Juvenal, G.J. Effects of 2-iodohexadecanal in the physiology of thyroid cells. Mol. Cell Endocrinol. 2016, 437, 292–301. [Google Scholar] [CrossRef] [PubMed]
- Morshed, S.A.; Latif, R.; Davies, T.F. Characterization of thyrotropin receptor antibody-induced signaling cascades. Endocrinology 2009, 150, 519–529. [Google Scholar] [CrossRef] [PubMed]
- Rousset, B.; Dupuy, C.; Miot, F.; Dumont, J. Chapter 2 Thyroid Hormone Synthesis And Secretion. In Endotext; Feingold, K.R., Anawalt, B., Boyce, A., Chrousos, G., de Herder, W.W., Dhatariya, K., Dungan, K., Hershman, J.M., Hofland, J., Kalra, S., et al., Eds.; MDText.com, Inc.: South Dartmouth, MA, USA, 2000. [Google Scholar]
- Koibuchi, N. Molecular Mechanisms of Thyroid Hormone Synthesis and Secretion. Princ. Endocrinol. Horm. Action 2018, 73–81. [Google Scholar]
- Nguyen, L.Q.; Kopp, P.; Martinson, F.; Stanfield, K.; Roth, S.I.; Jameson, J.L. A dominant negative CREB (cAMP response element-binding protein) isoform inhibits thyrocyte growth, thyroid-specific gene expression, differentiation, and function. Mol. Endocrinol. 2000, 14, 1448–1461. [Google Scholar] [CrossRef] [PubMed]
- Park, E.-Y.; Kim, D.-C. Effects of Insamyangyoung-tang Aqueous Extracts on the Hypothyroidism Induced by Propylthiouracil in Rats. J. Korean Obstet. Gynecol. 2015, 28, 55–75. [Google Scholar] [CrossRef]
- Kang, J.-S.; Park, S.-H.; Han, S.-R.; Ahn, Y.-M.; Ahn, S.-Y.; Lee, B.-C. The Effects of Cuscuta Semen on a Hypothyroidism Rat Model induced by Propylthiouracil (PTU). J. Intern. Korean Med. 2010, 31, 425–436. [Google Scholar]
- Choi, H.-S.; Kim, C.-J.; Cho, C.-S. The Effects of YUKWOOLTANG on the Hyperthyroidism of Rats. Korea J. Herbol. 2006, 21, 11–17. [Google Scholar]
- Kim, S.-T.; Choi, A.-R. Comparison of Effects of Yangkyuksanhwa-tang, Palmulgunja-tang and Cheongpyesagan-tang on the Rat Hyperthyroidism Induced by Levothyroxine. J. Sasang Const. Med. 2016, 28, 132–146. [Google Scholar]
- Giuliani, C.; Noguchi, Y.; Harii, N.; Napolitano, G.; Tatone, D.; Bucci, I.; Piantelli, M.; Monaco, F.; Kohn, L.D. The flavonoid quercetin regulates growth and gene expression in rat FRTL-5 thyroid cells. Endocrinology 2008, 149, 84–92. [Google Scholar] [CrossRef]
- Metro, D.; Cernaro, V.; Papa, M.; Benvenga, S. Marked improvement of thyroid function and autoimmunity by Aloe barbadensis miller juice in patients with subclinical hypothyroidism. J. Clin. Transl. Endocrinol. 2018, 11, 18–25. [Google Scholar] [CrossRef]
- Kar, A.; Panda, S.; Bharti, S. Relative efficacy of three medicinal plant extracts in the alteration of thyroid hormone concentrations in male mice. J. Ethnopharmacol. 2002, 81, 281–285. [Google Scholar] [CrossRef] [PubMed]
- Roy, G.; Mugesh, G. Bioinorganic chemistry in thyroid gland: Effect of antithyroid drugs on peroxidase-catalyzed oxidation and iodination reactions. Bioinorg. Chem. Appl. 2006, 2006, 23214. [Google Scholar] [CrossRef] [PubMed]
- Doerge, D.R.; Chang, H.C. Inactivation of thyroid peroxidase by soy isoflavones, in vitro and in vivo. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 2002, 777, 269–279. [Google Scholar] [CrossRef]
- Cappa, M.; Bizzarri, C.; Crea, F. Autoimmune thyroid diseases in children. J. Thyroid Res. 2011, 2011, 675703. [Google Scholar] [CrossRef] [PubMed]
- Vuchak, L.A.; Tsygankova, O.M.; Prendergast, G.V.; Meinkoth, J.L. Protein kinase A and B-Raf mediate extracellular signal-regulated kinase activation by thyrotropin. Mol. Pharmacol. 2009, 76, 1123–1129. [Google Scholar] [CrossRef]
- Woloshin, P.I.; Walton, K.M.; Rehfuss, R.P.; Goodman, R.H.; Cone, R.D. 3′,5′-cyclic adenosine monophosphate-regulated enhancer binding (CREB) activity is required for normal growth and differentiated phenotype in the FRTL5 thyroid follicular cell line. Mol. Endocrinol. 1992, 6, 1725–1733. [Google Scholar] [CrossRef]






| Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| NIS | GCTGTGGCATTGTCATGTTC | TGAGGTCTTCCACAGTCACA |
| TG | GAATTGCTGGCAGATGTTCAG | GGGCACTGAGCTCCTTGTAG |
| TPO | TCTGGCATCACTGAACTTGC | CGGTGTTGTCACAGATGACC |
| GAPDH | ACAGCAACAGGGTGGTGGAC | TTTGAGGGTGCAGCGAACTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ryuk, J.-A.; Go, H.; Ko, B.-S. Effects of Aloe vera on the Regulation of Thyroxine Release in FRTL-5 Thyroid Cells. Appl. Sci. 2022, 12, 11919. https://doi.org/10.3390/app122311919
Ryuk J-A, Go H, Ko B-S. Effects of Aloe vera on the Regulation of Thyroxine Release in FRTL-5 Thyroid Cells. Applied Sciences. 2022; 12(23):11919. https://doi.org/10.3390/app122311919
Chicago/Turabian StyleRyuk, Jin-Ah, Hiroe Go, and Byoung-Seob Ko. 2022. "Effects of Aloe vera on the Regulation of Thyroxine Release in FRTL-5 Thyroid Cells" Applied Sciences 12, no. 23: 11919. https://doi.org/10.3390/app122311919
APA StyleRyuk, J.-A., Go, H., & Ko, B.-S. (2022). Effects of Aloe vera on the Regulation of Thyroxine Release in FRTL-5 Thyroid Cells. Applied Sciences, 12(23), 11919. https://doi.org/10.3390/app122311919

