In Vivo Evaluation of Decellularized Human Tooth Scaffold for Dental Tissue Regeneration
Abstract
:1. Introduction
2. Materials and Methods
2.1. Tooth Sample Preparation and Cell Culture
2.2. Decellularization and Recellularization
2.3. In Vivo Transplantation
2.4. Histology and Immunohistochemistry
2.5. Gene Expression Analysis by Quantitative Real Time Polymerase Chain Reaction
2.6. Statistical Analyses
3. Results
3.1. Histological and Immunohistochemical Analysis of PDLSC Recellularization after In Vivo Transplantation
3.2. Gene Expression in Recellularized PDLSCs
3.3. Histological and Immunohistochemical Analysis of DPSC Recellularization after In Vivo Transplantation
3.4. Gene Expression in Recellularized DPSCs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lambrichts, I.; Driesen, R.B.; Dillen, Y.; Gervois, P.; Ratajczak, J.; Vangansewinkel, T.; Wolfs, E.; Bronckaers, A.; Hilkens, P. Dental pulp stem cells: Their potential in reinnervation and angiogenesis by using scaffolds. J. Endod. 2017, 43, S12–S16. [Google Scholar] [CrossRef]
- Cordeiro, M.M.; Dong, Z.; Kaneko, T.; Zhang, Z.; Miyazawa, M.; Shi, S.; Smith, A.J.; Nor, J.E. Dental pulp tissue engineering with stem cells from exfoliated deciduous teeth. J. Endod. 2008, 34, 962–969. [Google Scholar] [CrossRef]
- Qu, T.; Jing, J.; Jiang, Y.; Taylor, R.J.; Feng, J.Q.; Geiger, B.; Liu, X. Magnesium-containing nanostructured hybrid scaffolds for enhanced dentin regeneration. Tissue Eng. Part A 2014, 20, 2422–2433. [Google Scholar] [CrossRef] [Green Version]
- Isaka, J.; Ohazama, A.; Kobayashi, M.; Nagashima, C.; Takiguchi, T.; Kawasaki, H.; Tachikawa, T.; Hasegawa, K. Participation of periodontal ligament cells with regeneration of alveolar bone. J. Periodontol. 2001, 72, 314–323. [Google Scholar] [CrossRef] [PubMed]
- Yen, A.H.; Sharpe, P.T. Regeneration of teeth using stem cell-based tissue engineering. Expert Opin. Biol. Ther. 2006, 6, 9–16. [Google Scholar] [CrossRef] [PubMed]
- Hu, L.; Liu, Y.; Wang, S. Stem cell-based tooth and periodontal regeneration. Oral Dis. 2018, 24, 696–705. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eramo, S.; Natali, A.; Pinna, R.; Milia, E. Dental pulp regeneration via cell homing. Int. Endod. J. 2018, 51, 405–419. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nakashima, M.; Iohara, K.; Murakami, M.; Nakamura, H.; Sato, Y.; Ariji, Y.; Matsushita, K. Pulp regeneration by transplantation of dental pulp stem cells in pulpitis: A pilot clinical study. Stem Cell Res. Ther. 2017, 8, 61. [Google Scholar] [CrossRef] [Green Version]
- Hubbell, J.A. Biomaterials in tissue engineering. Bio/Technology 1995, 13, 565–576. [Google Scholar] [CrossRef]
- Bianco, P.; Robey, P.G. Stem cells in tissue engineering. Nature 2001, 414, 118–121. [Google Scholar] [CrossRef] [PubMed]
- Weissman, I.L.; Anderson, D.J.; Gage, F. Stem and progenitor cells: Origins, phenotypes, lineage commitments, and transdifferentiations. Annu. Rev. Cell Dev. Biol. 2001, 17, 387–403. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chalisserry, E.P.; Nam, S.Y.; Park, S.H.; Anil, S. Therapeutic potential of dental stem cells. J. Tissue Eng. 2017, 8, 2041731417702531. [Google Scholar] [CrossRef]
- Egusa, H.; Sonoyama, W.; Nishimura, M.; Atsuta, I.; Akiyama, K. Stem cells in dentistry–part i: Stem cell sources. J. Prosthodont. Res. 2012, 56, 151–165. [Google Scholar] [CrossRef] [Green Version]
- Sharpe, P.T. Dental mesenchymal stem cells. Development 2016, 143, 2273–2280. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nii, T.; Katayama, Y. Biomaterial-assisted regenerative medicine. Int. J. Mol. Sci. 2021, 22, 8657. [Google Scholar] [CrossRef] [PubMed]
- Bohl, K.S.; Shon, J.; Rutherford, B.; Mooney, D.J. Role of synthetic extracellular matrix in development of engineered dental pulp. J. Biomater. Sci. Polym. Ed. 1998, 9, 749–764. [Google Scholar] [CrossRef]
- Eltom, A.; Zhong, G.; Muhammad, A. Scaffold techniques and designs in tissue engineering functions and purposes: A review. Adv. Mater. Sci. Eng. 2019, 2019, 3429527. [Google Scholar] [CrossRef] [Green Version]
- Celikkin, N.; Rinoldi, C.; Costantini, M.; Trombetta, M.; Rainer, A.; Święszkowski, W. Naturally derived proteins and glycosaminoglycan scaffolds for tissue engineering applications. Mater. Sci. Eng. C 2017, 78, 1277–1299. [Google Scholar] [CrossRef]
- Bružauskaitė, I.; Bironaitė, D.; Bagdonas, E.; Bernotienė, E. Scaffolds and cells for tissue regeneration: Different scaffold pore sizes—Different cell effects. Cytotechnology 2016, 68, 355–369. [Google Scholar] [CrossRef] [Green Version]
- Srinivasan, S.; Jayasree, R.; Chennazhi, K.; Nair, S.; Jayakumar, R. Biocompatible alginate/nano bioactive glass ceramic composite scaffolds for periodontal tissue regeneration. Carbohydr. Polym. 2012, 87, 274–283. [Google Scholar] [CrossRef]
- Galler, K.M.; Hartgerink, J.D.; Cavender, A.C.; Schmalz, G.; D’Souza, R.N. A customized self-assembling peptide hydrogel for dental pulp tissue engineering. Tissue Eng. Part A 2012, 18, 176–184. [Google Scholar] [CrossRef]
- Zhang, W.; Vazquez, B.; Oreadi, D.; Yelick, P. Decellularized tooth bud scaffolds for tooth regeneration. J. Dent. Res. 2017, 96, 516–523. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Son, H.; Jeon, M.; Choi, H.J.; Lee, H.S.; Kim, I.H.; Kang, C.M.; Song, J.S. Decellularized human periodontal ligament for periodontium regeneration. PLoS ONE 2019, 14, e0221236. [Google Scholar] [CrossRef] [PubMed]
- Song, J.S.; Takimoto, K.; Jeon, M.; Vadakekalam, J.; Ruparel, N.B.; Diogenes, A. Decellularized human dental pulp as a scaffold for regenerative endodontics. J. Dent. Res. 2017, 96, 640–646. [Google Scholar] [CrossRef]
- Huang, G.T.-J.; Yamaza, T.; Shea, L.D.; Djouad, F.; Kuhn, N.Z.; Tuan, R.S.; Shi, S. Stem/progenitor cell–mediated de novo regeneration of dental pulp with newly deposited continuous layer of dentin in an in vivo model. Tissue Eng. Part A 2010, 16, 605–615. [Google Scholar] [CrossRef] [Green Version]
- Ishizaka, R.; Iohara, K.; Murakami, M.; Fukuta, O.; Nakashima, M. Regeneration of dental pulp following pulpectomy by fractionated stem/progenitor cells from bone marrow and adipose tissue. Biomaterials 2012, 33, 2109–2118. [Google Scholar] [CrossRef]
- Rutherford, R.; TrailSmith, M.; Ryan, M.; Charette, M. Synergistic effects of dexamethasone on platelet-derived growth factor mitogenesis in vitro. Arch. Oral Biol. 1992, 37, 139–145. [Google Scholar] [CrossRef]
- Nakashima, M. The effects of growth factors on DNA synthesis, proteoglycan synthesis and alkaline phosphatase activity in bovine dental pulp cells. Arch. Oral Biol. 1992, 37, 231–236. [Google Scholar] [CrossRef]
- Yokose, S.; Kadokura, H.; Tajima, N.; Hasegawa, A.; Sakagami, H.; Fujieda, K.; Katayama, T. Platelet-derived growth factor exerts disparate effects on odontoblast differentiation depending on the dimers in rat dental pulp cells. Cell Tissue Res. 2004, 315, 375–384. [Google Scholar] [CrossRef]
- Tziafas, D.; Papadimitriou, S. Role of exogenous tgf-β in induction of reparative dentinogenesis in vivo. Eur. J. Oral Sci. 1998, 106, 192–196. [Google Scholar] [CrossRef] [PubMed]
- Howard, C.; Murray, P.E.; Namerow, K.N. Dental pulp stem cell migration. J. Endod. 2010, 36, 1963–1966. [Google Scholar] [CrossRef] [PubMed]
- Narayanan, A.S. Connective tissues of the periodontium: A summary of current work. Collagen Relat. Res. 1983, 3, 25–31. [Google Scholar] [CrossRef]
- Song, I.S.; Han, Y.S.; Lee, J.-H.; Um, S.; Kim, H.Y.; Seo, B.M. Periodontal ligament stem cells for periodontal regeneration. Curr. Oral Health Rep. 2015, 2, 236–244. [Google Scholar] [CrossRef] [Green Version]
- Zhu, W.; Liang, M. Periodontal ligament stem cells: Current status, concerns, and future prospects. Stem Cells Int. 2015, 2015. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Albuquerque, M.; Valera, M.; Nakashima, M.; Nör, J.; Bottino, M. Tissue-engineering-based strategies for regenerative endodontics. J. Dent. Res. 2014, 93, 1222–1231. [Google Scholar] [CrossRef] [PubMed]
- Diogenes, A.; Ruparel, N.B.; Shiloah, Y.; Hargreaves, K.M. Regenerative endodontics: A way forward. J. Am. Dent. Assoc. 2016, 147, 372–380. [Google Scholar] [CrossRef]
- Iohara, K.; Imabayashi, K.; Ishizaka, R.; Watanabe, A.; Nabekura, J.; Ito, M.; Matsushita, K.; Nakamura, H.; Nakashima, M. Complete pulp regeneration after pulpectomy by transplantation of cd105+ stem cells with stromal cell-derived factor-1. Tissue Eng. Part A 2011, 17, 1911–1920. [Google Scholar] [CrossRef]
- Iohara, K.; Murakami, M.; Takeuchi, N.; Osako, Y.; Ito, M.; Ishizaka, R.; Utunomiya, S.; Nakamura, H.; Matsushita, K.; Nakashima, M. A novel combinatorial therapy with pulp stem cells and granulocyte colony-stimulating factor for total pulp regeneration. Stem Cells Transl. Med. 2013, 2, 521–533. [Google Scholar] [CrossRef]
- Takeuchi, N.; Hayashi, Y.; Murakami, M.; Alvarez, F.; Horibe, H.; Iohara, K.; Nakata, K.; Nakamura, H.; Nakashima, M. Similar in vitro effects and pulp regeneration in ectopic tooth transplantation by basic fibroblast growth factor and granulocyte-colony stimulating factor. Oral Dis. 2015, 21, 113–122. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2(-delta delta c(t)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Hutmacher, D.W. Scaffold design and fabrication technologies for engineering tissues—State of the art and future perspectives. J. Biomater. Sci. Polym. Ed. 2001, 12, 107–124. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Ushida, T.; Tateishi, T. Scaffold design for tissue engineering. Macromol. Biosci. 2002, 2, 67–77. [Google Scholar] [CrossRef]
- Gilbert, T.W.; Sellaro, T.L.; Badylak, S.F. Decellularization of tissues and organs. Biomaterials 2006, 27, 3675–3683. [Google Scholar] [CrossRef] [PubMed]
- Porzionato, A.; Stocco, E.; Barbon, S.; Grandi, F.; Macchi, V.; De Caro, R. Tissue-engineered grafts from human decellularized extracellular matrices: A systematic review and future perspectives. Int. J. Mol. Sci. 2018, 19, 4117. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Badylak, S.F.; Weiss, D.J.; Caplan, A.; Macchiarini, P. Retracted: Engineered Whole Organs and Complex Tissues; Elsevier: Amsterdam, The Netherlands, 2012. [Google Scholar]
- Keane, T.J.; Londono, R.; Turner, N.J.; Badylak, S.F. Consequences of ineffective decellularization of biologic scaffolds on the host response. Biomaterials 2012, 33, 1771–1781. [Google Scholar] [CrossRef]
- Lu, H.; Hoshiba, T.; Kawazoe, N.; Chen, G. Comparison of decellularization techniques for preparation of extracellular matrix scaffolds derived from three-dimensional cell culture. J. Biomed. Mater. Res. Part A 2012, 100, 2507–2516. [Google Scholar] [CrossRef] [PubMed]
- Alvarez-Pérez, M.A.; Narayanan, S.; Zeichner-David, M.; Rodríguez Carmona, B.; Arzate, H. Molecular cloning, expression and immunolocalization of a novel human cementum-derived protein (cp-23). Bone 2006, 38, 409–419. [Google Scholar] [CrossRef]
- Villarreal-Ramírez, E.; Moreno, A.; Mas-Oliva, J.; Chávez-Pacheco, J.L.; Narayanan, A.S.; Gil-Chavarría, I.; Zeichner-David, M.; Arzate, H. Characterization of recombinant human cementum protein 1 (hrcemp1): Primary role in biomineralization. Biochem. Biophys. Res. Commun. 2009, 384, 49–54. [Google Scholar] [CrossRef]
- Bolton, K.; Segal, D.; McMillan, J.; Sanigorski, A.; Collier, G.; Walder, K. Identification of secreted proteins associated with obesity and type 2 diabetes in psammomys obesus. Int. J. Obes. 2009, 33, 1153–1165. [Google Scholar] [CrossRef] [Green Version]
- Romanos, G.E.; Asnani, K.P.; Hingorani, D.; Deshmukh, V.L. Periostin: Role in formation and maintenance of dental tissues. J. Cell. Physiol. 2014, 229. [Google Scholar] [CrossRef]
- Karimbux, N.Y.; Nishimura, I. Temporal and spatial expressions of type xii collagen in the remodeling periodontal ligament during experimental tooth movement. J. Dent. Res. 1995, 74, 313–318. [Google Scholar] [CrossRef]
- McKee, M.D.; Zalzal, S.; Nanci, A. Extracellular matrix in tooth cementum and mantle dentin: Localization of osteopontin and other noncollagenous proteins, plasma proteins, and glycoconjugates by electron microscopy. Anat. Rec. 1996, 245, 293–312. [Google Scholar] [CrossRef]
- Stucki, U.; Schmid, J.; Hämmerle, C.F.; Lang, N.P. Temporal and local appearance of alkaline phosphatase activity in early stages of guided bone regeneration. A descriptive histochemical study in humans. Clin. Oral Implant. Res. 2001, 12, 121–127. [Google Scholar] [CrossRef]
- Batouli, S.; Miura, M.; Brahim, J.; Tsutsui, T.W.; Fisher, L.W.; Gronthos, S.; Robey, P.G.; Shi, S. Comparison of stem-cell-mediated osteogenesis and dentinogenesis. J. Dent. Res. 2003, 82, 976–981. [Google Scholar] [CrossRef]
- Conde, C.M.; Demarco, F.F.; Casagrande, L.; Alcazar, J.C.; Nör, J.E.; Tarquinio, S.B. Influence of poly-l-lactic acid scaffold’s pore size on the proliferation and differentiation of dental pulp stem cells. Braz. Dent. J. 2015, 26, 93–98. [Google Scholar] [CrossRef]
- Su, W.T.; Wu, P.S.; Ko, C.S.; Huang, T.Y. Osteogenic differentiation and mineralization of human exfoliated deciduous teeth stem cells on modified chitosan scaffold. Mater. Sci. Eng. C Mater. Biol. Appl. 2014, 41, 152–160. [Google Scholar] [CrossRef]
- Thomson, T.S.; Berry, J.E.; Somerman, M.J.; Kirkwood, K.L. Cementoblasts maintain expression of osteocalcin in the presence of mineral trioxide aggregate. J. Endod. 2003, 29, 407–412. [Google Scholar] [CrossRef] [PubMed]
- Hu, K.; Olsen, B.R. The roles of vascular endothelial growth factor in bone repair and regeneration. Bone 2016, 91, 30–38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matsubara, H.; Hogan, D.E.; Morgan, E.F.; Mortlock, D.P.; Einhorn, T.A.; Gerstenfeld, L.C. Vascular tissues are a primary source of bmp2 expression during bone formation induced by distraction osteogenesis. Bone 2012, 51, 168–180. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, X.; Chen, W.; Zhang, C.; Thein-Han, W.; Hu, K.; Reynolds, M.A.; Bao, C.; Wang, P.; Zhao, L.; Xu, H.H. Co-seeding human endothelial cells with human-induced pluripotent stem cell-derived mesenchymal stem cells on calcium phosphate scaffold enhances osteogenesis and vascularization in rats. Tissue Eng. Part A 2017, 23, 546–555. [Google Scholar] [CrossRef]
- Beertsen, W.; McCulloch, C.A.; Sodek, J. The periodontal ligament: A unique, multifunctional connective tissue. Periodontology 2000 1997, 13, 20–40. [Google Scholar] [CrossRef] [PubMed]
- Van Hassel, H.J. Physiology of the human dental pulp. Oral Surg. Oral Med. Oral Pathol. 1971, 32, 126–134. [Google Scholar] [CrossRef]
- Yen, A.-H.; Yelick, P. Dental tissue regeneration–a mini-review. Gerontology 2011, 57, 85–94. [Google Scholar] [CrossRef] [PubMed]
- Andreasen, J.O. Pulp and periodontal tissue repair-regeneration or tissue metaplasia after dental trauma. A review. Dent. Traumatol. 2012, 28, 19–24. [Google Scholar] [CrossRef] [Green Version]
- Diogenes, A.; Henry, M.A.; Teixeira, F.B.; Hargreaves, K.M. An update on clinical regenerative endodontics. Endod. Top. 2013, 28, 2–23. [Google Scholar] [CrossRef]
- Kim, J.Y.; Xin, X.; Moioli, E.K.; Chung, J.; Lee, C.H.; Chen, M.; Fu, S.Y.; Koch, P.D.; Mao, J.J. Regeneration of dental-pulp-like tissue by chemotaxis-induced cell homing. Tissue Eng. Part A 2010, 16, 3023–3031. [Google Scholar] [CrossRef] [Green Version]
- Abraham, C. A brief historical perspective on dental implants, their surface coatings and treatments. Open Dent. J. 2014, 8, 50–55. [Google Scholar] [CrossRef]
- Schmalz, G.; Smith, A.J. Pulp development, repair, and regeneration: Challenges of the transition from traditional dentistry to biologically based therapies. J. Endod. 2014, 40, S2–S5. [Google Scholar] [CrossRef]
- Volponi, A.A.; Zaugg, L.K.; Neves, V.; Liu, Y.; Sharpe, P.T. Tooth repair and regeneration. Curr. Oral Health Rep. 2018, 5, 295–303. [Google Scholar] [CrossRef] [Green Version]
- Ikeda, E.; Morita, R.; Nakao, K.; Ishida, K.; Nakamura, T.; Takano-Yamamoto, T.; Ogawa, M.; Mizuno, M.; Kasugai, S.; Tsuji, T. Fully functional bioengineered tooth replacement as an organ replacement therapy. Proc. Natl. Acad. Sci. USA 2009, 106, 13475–13480. [Google Scholar] [CrossRef] [Green Version]
- Nakao, K.; Morita, R.; Saji, Y.; Ishida, K.; Tomita, Y.; Ogawa, M.; Saitoh, M.; Tomooka, Y.; Tsuji, T. The development of a bioengineered organ germ method. Nat. Methods 2007, 4, 227–230. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.; Ren, J.; Li, R.; Guan, C.; Feng, Z.; Bao, B.; Wang, W.; Zhou, C. Tooth regeneration: Insights from tooth development and spatial-temporal control of bioactive drug release. Stem Cell Rev. Rep. 2020, 16, 41–55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Antibodies | Catalog Number | Host Species | Dilution Factor |
---|---|---|---|
CD34 | Ab110643 | Rabbit | 1:100 |
Col XII | Sc-68862 | Rabbit | 1:2000 |
CP23 | Sc-164031 | Goat | 1:500 |
DSP | Sc-33586 | Rabbit | 1:500 |
HN | MAB1281 | Mouse | 1:100 |
OC | AB10911 | Rabbit | 1:8000 |
VEGF | Ab183100 | Goat | 1:100 |
Gene | Forward Primer Sequence (5′–3′) | Reverse Primer Sequence (5′–3′) |
---|---|---|
ALP | GGACCATTCCCACGTCTTCAC | CCTTGTAGCCAGGCCCATTG |
CD31 | CCCATTGTTCCCGGTTTCCA | AGTTAGTTCTGCCTTCGGGC |
CD34 | CGCTGCCTTGCCAAGACTAA | CCTAGAGAGACGCACCGAGT |
Col I | CGATGGCTGCACGAGTCACAC | CAGGTTGGGATGGAGGGAGTTTAC |
Col XII | CGGACAGAGCCTTACGTGCC | CTGCCCGGGTCCGTGG |
CP23 | AACACATCGGCTGAGAACCTCAC | GGATACCCACCTCTGCCTTGAC |
DMP1 | GATCAGCATCCTGCTCATGTT | AGCCAAATGACCCTTCCATTC |
DSPP | GGGATGTTGGCGATGCA | CCAGCTACTTGAGGTCCATCTTC |
NES | GCCCTGACCACTCCAGTTTA | GGAGTCCTGGATTTCCTTCC |
OC | CAAAGGTGCAGCCTTTGTGTC | TCACAGTCCGGATTGAGCTCA |
POSTN | CACAACCTGGAGACTGGAC | TGTCTGCTGGATAGAGGAG |
GAPDH | TCCTGCACCACCAACTGCTT | TGGCAGTGATGGCATGGAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, I.-H.; Jeon, M.; Cheon, K.; Kim, S.H.; Jung, H.-S.; Shin, Y.; Kang, C.M.; Kim, S.-O.; Choi, H.-J.; Lee, H.-S.; et al. In Vivo Evaluation of Decellularized Human Tooth Scaffold for Dental Tissue Regeneration. Appl. Sci. 2021, 11, 8472. https://doi.org/10.3390/app11188472
Kim I-H, Jeon M, Cheon K, Kim SH, Jung H-S, Shin Y, Kang CM, Kim S-O, Choi H-J, Lee H-S, et al. In Vivo Evaluation of Decellularized Human Tooth Scaffold for Dental Tissue Regeneration. Applied Sciences. 2021; 11(18):8472. https://doi.org/10.3390/app11188472
Chicago/Turabian StyleKim, Ik-Hwan, Mijeong Jeon, Kyounga Cheon, Sun Ha Kim, Han-Sung Jung, Yooseok Shin, Chung Min Kang, Seong-Oh Kim, Hyung-Jun Choi, Hyo-Seol Lee, and et al. 2021. "In Vivo Evaluation of Decellularized Human Tooth Scaffold for Dental Tissue Regeneration" Applied Sciences 11, no. 18: 8472. https://doi.org/10.3390/app11188472