Effect of Heat Stress and Stocking Density on Growth Performance, Breast Meat Quality, and Intestinal Barrier Function in Broiler Chickens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Birds, Experimental Design, and Management
2.2. Sample Collection and Chemical Analysis
2.3. Statistical Analysis
3. Results
3.1. Growth Performance and Breast Meat Quality
3.2. Intestinal Barrier Function
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Zhang, C.; Zhao, X.H.; Yang, L.; Chen, X.Y.; Jiang, R.S.; Jin, S.H.; Geng, Z.Y. Resveratrol alleviates heat stress-induced impairment of intestinal morphology, microflora, and barrier integrity in broilers. Poult. Sci. 2017, 96, 4325–4332. [Google Scholar] [CrossRef] [PubMed]
- Teeter, R.G.; Smith, M.O.; Owens, F.N.; Arp, S.C.; Sangiah, S.; Breazile, J.E. Chronic heat stress and respiratory alkalosis: Occurrence and treatment in broiler chicks. Poult. Sci. 1985, 64, 1060–1064. [Google Scholar] [CrossRef] [PubMed]
- Sohail, M.U.; Ijaz, A.; Yousaf, M.S.; Ashraf, K.; Zaneb, H.; Aleem, M.; Rehman, H. Alleviation of cyclic heat stress in broilers by dietary supplementation of mannan-oligosaccharide and Lactobacillus-based probiotic: Dynamics of cortisol, thyroid hormones, cholesterol, C-reactive protein, and humoral immunity. Poult. Sci. 2010, 89, 1934–1938. [Google Scholar] [CrossRef] [PubMed]
- Lara, L.J.; Rostagno, M.H. Impact of Heat Stress on Poultry Production. Animals 2013, 3, 356–369. [Google Scholar] [CrossRef] [PubMed]
- Lambert, G.P. Stress-induced gastrointestinal barrier dysfunction and its inflammatory effects. J. Anim. Sci. 2009, 87, E101–E108. [Google Scholar] [CrossRef]
- Shin, J.E.; Kim, J.H.; Goo, D.; Han, G.P.; Pitargue, F.M.; Kang, H.K.; Kil, D.Y. Effect of dietary supplementation of betaine on productive performance, egg quality and jejunal tight junction-related gene expression in laying hens raised under hot environmental conditions. Livest. Sci. 2018, 214, 79–82. [Google Scholar] [CrossRef]
- Puron, D.; Santamaria, R.; Segura, J.C.; Alamilla, J.L. Broiler performance at different stocking densities. J. Appl. Poult. Res. 1995, 4, 55–60. [Google Scholar] [CrossRef]
- Estevez, I. Density allowances for broilers: Where to set the limits? Poult. Sci. 2007, 86, 1265–1272. [Google Scholar] [CrossRef] [PubMed]
- Bessei, W. Welfare of broilers: A review. World’s Poult. Sci. J. 2006, 62, 455–466. [Google Scholar] [CrossRef]
- Cengiz, O.; Koksal, B.H.; Tatli, O.; Sevim, O.; Ahsan, U.; Uner, A.G.; Ulutas, P.A.; Beyaz, D.; Buyukyoruk, S.; Yakan, A.; et al. Effect of dietary probiotic and high stocking density on the performance, carcass yield, gut microflora, and stress indicators of broilers. Poult. Sci. 2015, 94, 2395–2403. [Google Scholar] [CrossRef]
- Goo, D.; Park, G.H.; Han, G.P.; Choi, H.S.; Kim, J.H.; Kil, D.Y. Effect of stocking density and sex on growth performance, meat quality, and intestinal barrier function in broiler chickens. Poult. Sci. 2019, 98, 1153–1160. [Google Scholar] [CrossRef]
- Najafi, P.; Zulkifli, I.; Jajuli, N.A.; Farjam, A.S.; Ramiah, S.K.; Amir, A.A.; O’Reily, E.; Eckersall, D. Environmental temperature and stocking density effects on acute phase proteins, heat shock protein 70, circulating corticosterone and performance in broiler chickens. Int. J. Biometeorol. 2015, 59, 1577–1583. [Google Scholar] [CrossRef] [PubMed]
- Cobb Broiler Management Guide. Available online: https://cobbstorage.blob.core.windows.net/guides/9109a8e0-1815-11e9-9c88-c51e407c53ab (accessed on 10 February 2019).
- Kim, J.H.; Jung, H.; Pitargue, F.M.; Han, G.P.; Choi, H.S.; Kil, D.Y. Effect of dietary calcium concentrations in low non-phytate phosphorus diets containing phytase on growth performance, bone mineralization, litter quality, and footpad dermatitis incidence in growing broiler chickens. Asian-Australas. J. Anim. Sci. 2017, 30, 979–983. [Google Scholar] [CrossRef]
- Kim, C.H.; Kim, G.B.; Chang, M.B.; Bae, G.S.; Paik, I.K.; Kil, D.Y. Effect of dietary supplementation of Lactobacillus-fermented Artemisia princeps on growth performance, meat lipid peroxidation, and intestinal microflora in Hy-line Brown male chickens. Poult. Sci. 2012, 91, 2845–2851. [Google Scholar] [CrossRef] [PubMed]
- Aznar, R.; Alarcon, B. On the specificity of PCR detection of Listeria monocytogenes in food: A comparison of published primers. Syst. Appl. Microbiol. 2002, 25, 109–119. [Google Scholar] [CrossRef]
- Thomsen, R.; Sølvsten, C.A.E.; Linnet, T.E.; Blechingberg, J.; Nielsen, A.L. Analysis of qPCR data by converting exponentially related Ct values into linearly related x0 values. J. Bioinform. Comput. Biol. 2010, 8, 885–900. [Google Scholar] [CrossRef] [PubMed]
- Ruhnke, I.; Rohe, I.; Meyer, W.; Kroger, S.; Neumann, K.; Zentek, J. Method for the preparation of mucosal flaps from the jejunum of laying hens for transporter studies in Ussing chambers. Arch. Anim. Nutr. 2013, 67, 161–168. [Google Scholar] [CrossRef]
- Gabler, N.K.; Spencer, J.D.; Webel, D.M.; Spurlock, M.E. In utero and postnatal exposure to long chain (n-3) PUFA enhances intestinal glucose absorption and energy stores in weanling pigs. J. Nutr. 2007, 137, 2351–2358. [Google Scholar] [CrossRef]
- Imaeda, N. Influence of the stocking density and rearing season on incidence of sudden death syndrome in broiler chickens. Poult. Sci. 2000, 79, 201–204. [Google Scholar] [CrossRef]
- Zuowei, S.; Yan, L.; Yuan, L.; Jiao, H.; Song, Z.; Guo, Y.; Lin, H. Stocking density affects the growth performance of broilers in a sex-dependent fashion. Poult. Sci. 2011, 90, 1406–1415. [Google Scholar] [CrossRef]
- Houshmand, M.; Azhar, K.; Zulkifli, I.; Bejo, M.H.; Kamyab, A. Effects of prebiotic, protein level, and stocking density on performance, immunity, and stress indicators of broilers. Poult. Sci. 2012, 91, 393–401. [Google Scholar] [CrossRef] [PubMed]
- Buijs, S.; Keeling, L.; Rettenbacher, S.; Van Poucke, E.; Tuyttens, F.A.M. Stocking density effects on broiler welfare: Identifying sensitive ranges for different indicators. Poult. Sci. 2009, 88, 1536–1543. [Google Scholar] [CrossRef]
- Sandercock, D.A.; Hunter, R.R.; Nute, G.R.; Mitchell, M.A.; Hocking, P.M. Acute heat stress-induced alterations in blood acid-base status and skeletal muscle membrane integrity in broiler chickens at two ages: Implications for meat quality. Poult. Sci. 2001, 80, 418–425. [Google Scholar] [CrossRef]
- Zhang, Z.Y.; Jia, G.Q.; Zuo, J.J.; Zhang, Y.; Lei, J.; Ren, L.; Feng, D.Y. Effects of constant and cyclic heat stress on muscle metabolism and meat quality of broiler breast fillet and thigh meat. Poult. Sci. 2012, 91, 2931–2937. [Google Scholar] [CrossRef]
- Song, J.; Xiao, K.; Ke, Y.L.; Jiao, L.F.; Hu, C.H.; Diao, Q.Y.; Shi, B.; Zou, X.T. Effect of a probiotic mixture on intestinal microflora, morphology, and barrier integrity of broilers subjected to heat stress. Poult. Sci. 2014, 93, 581–588. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Jiao, L.F.; Xiao, K.; Luan, Z.S.; Hu, C.H.; Shi, B.; Zhan, X.A. Cello-oligosaccharide ameliorates heat stress-induced impairment of intestinal microflora, morphology and barrier integrity in broilers. Anim. Feed Sci. Technol. 2013, 185, 175–181. [Google Scholar] [CrossRef]
- Kim, J.H.; Kim, J.W.; Lee, B.B.; Lee, G.I.; Lee, J.H.; Kim, G.B.; Kil, D.Y. Effect of dietary supplementation of bacteriophage on growth performance and cecal bacterial populations in broiler chickens raised in different housing systems. Livest. Sci. 2014, 170, 137–141. [Google Scholar] [CrossRef]
- Ulluwishewa, D.; Anderson, R.C.; McNabb, W.C.; Moughan, P.J.; Wells, J.M.; Roy, N.C. Regulation of tight junction permeability by intestinal bacteria and dietary components. J. Nutr. 2011, 141, 769–776. [Google Scholar] [CrossRef]
Primer Name 1 | Primer Sequence 2 (5′-3′) | Tm 3, °C | Product Size, bp | Accession Number |
---|---|---|---|---|
GAPDH | F: TGCTGCCCAGAACATCATCC | 50.0–65.0 | 142 | NM_204305 |
R: ACGGCAGGTCAGGTCAACAA | ||||
ZO-1 | F: AATACCTGACTGTCTTGCAG | 58.3 | 145 | XM_015278975.1 |
R: TAAAGAAGGCTTTCCCTGAC | ||||
OCLN | F: TCGTGCTGTGCATCGCCATC | 60.0 | 178 | NM_205128.1 |
R: CGCTGGTTCACCCCTCCGTA | ||||
CLDN-1 | F: CAGACTCTAGGTTTTGCCTT | 58.3 | 149 | NM_001013611.2 |
R: AATCTTTCCAGTGGCGATAC | ||||
JAM-2 | F: GTGAATTTACAGTTCCTCCC | 53.9 | 158 | NM_001006257.1 |
R: TCCTGTCTTTTCCAGTAAGG |
Item | Initial Body Weight (g) | Final Body Weight (g) | Body Weight Gain (g) | Feed Intake (g) | Feed Efficiency (g/kg) | |
---|---|---|---|---|---|---|
Temperature 1 | SD 2 | |||||
Thermoneutral | 9 | 891 | 1918 | 1028 | 1902 | 540 |
18 | 886 | 1776 | 890 | 1799 | 494 | |
Heat stress | 9 | 895 | 1701 | 806 | 1666 | 483 |
18 | 883 | 1651 | 768 | 1583 | 486 | |
SEM (n = 5) | 6.1 | 32.7 | 35.3 | 27.9 | 14.0 | |
Main effect | ||||||
Temperature | ||||||
Thermoneutral | 888 | 1847 | 959 | 1851 | 517 | |
Heat stress | 889 | 1676 | 787 | 1624 | 484 | |
SEM (n = 10) | 4.3 | 23.1 | 25.0 | 19.7 | 9.9 | |
SD | ||||||
9 | 893 | 1810 | 917 | 1784 | 511 | |
18 | 884 | 1713 | 829 | 1691 | 490 | |
SEM (n = 10) | 4.3 | 23.1 | 25.0 | 19.7 | 9.9 | |
p-Value | df | |||||
Temperature | 1 | 0.861 | <0.001 | <0.001 | <0.001 | 0.034 |
SD | 1 | 0.172 | 0.009 | 0.025 | 0.004 | 0.139 |
Temperature × SD | 1 | 0.556 | 0.177 | 0.178 | 0.720 | 0.103 |
Item | Yield, % | pH, 1h | pH, 24h | WHC, % | L* | a* | b* | TBARS | |
---|---|---|---|---|---|---|---|---|---|
Temperature 2 | SD 3 | ||||||||
Thermoneutral | 9 | 16.4 | 6.1 | 5.8 | 75.6 | 54.4 | 3.0 | 7.1 | 0.171 |
18 | 15.0 | 6.1 | 5.8 | 78.4 | 51.4 | 2.5 | 6.3 | 0.201 | |
Heat stress | 9 | 14.7 | 6.3 | 6.0 | 77.5 | 56.2 | 3.4 | 8.4 | 0.195 |
18 | 13.6 | 6.3 | 6.0 | 80.2 | 52.8 | 3.0 | 6.5 | 0.204 | |
SEM (n = 5) | 0.82 | 0.09 | 0.05 | 1.29 | 1.41 | 0.48 | 0.78 | 0.017 | |
Main effect | |||||||||
Temperature | |||||||||
Thermoneutral | 15.7 | 6.1 | 5.8 | 77.0 | 52.9 | 2.8 | 6.7 | 0.186 | |
Heat stress | 14.1 | 6.3 | 6.0 | 78.9 | 54.5 | 3.2 | 7.5 | 0.200 | |
SEM (n = 10) | 0.58 | 0.06 | 0.04 | 0.91 | 1.00 | 0.34 | 0.55 | 0.012 | |
SD | |||||||||
9 | 15.6 | 6.2 | 5.9 | 76.6 | 55.3 | 3.2 | 7.7 | 0.183 | |
18 | 14.3 | 6.2 | 5.9 | 79.3 | 52.1 | 2.7 | 6.4 | 0.203 | |
SEM (n = 10) | 0.58 | 0.06 | 0.04 | 0.91 | 1.00 | 0.34 | 0.55 | 0.012 | |
p-Value | df | ||||||||
Temperature | 1 | 0.071 | 0.082 | 0.012 | 0.168 | 0.282 | 0.373 | 0.339 | 0.445 |
SD | 1 | 0.138 | 0.679 | 0.740 | 0.046 | 0.038 | 0.332 | 0.113 | 0.261 |
Temperature × SD | 1 | 0.843 | 0.679 | 0.626 | 0.954 | 0.895 | 0.902 | 0.491 | 0.551 |
Item | PD, mV | Isc, μa/cm2 | TER, Ω/cm2 | LPS, EU/mL | |
---|---|---|---|---|---|
Temperature 2 | SD 3 | ||||
Thermoneutral | 9 | 187 | 0.7 | 283 | 16.8 |
18 | 179 | 0.6 | 303 | 21.8 | |
Heat stress | 9 | 112 | 0.8 | 145 | 20.2 |
18 | 129 | 0.7 | 196 | 22.0 | |
SEM (n = 5) | 29.9 | 0.11 | 29.9 | 5.36 | |
Main effect | |||||
Temperature | |||||
Thermoneutral | 183 | 0.6 | 293 | 19.3 | |
Heat | 120 | 0.7 | 170 | 21.1 | |
SEM (n = 10) | 21.2 | 0.08 | 21.1 | 3.59 | |
SD | |||||
9 | 149 | 0.7 | 214 | 18.5 | |
18 | 154 | 0.6 | 250 | 21.9 | |
SEM (n = 10) | 21.2 | 0.08 | 21.1 | 3.59 | |
p-Value | df | ||||
Temperature | 1 | 0.052 | 0.482 | <0.001 | 0.721 |
SD | 1 | 0.880 | 0.538 | 0.247 | 0.502 |
Temperature × SD | 1 | 0.677 | 0.627 | 0.613 | 0.751 |
Item | ZO-1 | OCLN | CLDN-1 | JAM-2 | |
---|---|---|---|---|---|
Temperature 2 | SD 3 | ||||
Thermoneutral | 9 | 0.84 | 1.82 | 1.48 | 1.59 |
18 | 0.95 | 1.14 | 1.30 | 0.98 | |
Heat stress | 9 | 1.52 | 1.32 | 1.49 | 1.29 |
18 | 0.57 | 0.47 | 0.44 | 0.46 | |
SEM (n = 5) | 0.452 | 0.384 | 0.489 | 0.415 | |
Main effect | |||||
Temperature | |||||
Thermoneutral | 0.90 | 1.48 | 1.39 | 1.29 | |
Heat | 1.05 | 0.89 | 0.97 | 0.87 | |
SEM (n = 10) | 0.304 | 0.258 | 0.328 | 0.278 | |
SD | |||||
9 | 1.18 | 1.57 | 1.48 | 1.44 | |
18 | 0.76 | 0.81 | 0.87 | 0.72 | |
SEM (n = 10) | 0.304 | 0.258 | 0.328 | 0.278 | |
p-Value | df | ||||
Temperature | 1 | 0.728 | 0.120 | 0.364 | 0.297 |
SD | 1 | 0.327 | 0.048 | 0.196 | 0.079 |
Temperature × SD | 1 | 0.221 | 0.817 | 0.350 | 0.775 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Goo, D.; Kim, J.H.; Park, G.H.; Delos Reyes, J.B.; Kil, D.Y. Effect of Heat Stress and Stocking Density on Growth Performance, Breast Meat Quality, and Intestinal Barrier Function in Broiler Chickens. Animals 2019, 9, 107. https://doi.org/10.3390/ani9030107
Goo D, Kim JH, Park GH, Delos Reyes JB, Kil DY. Effect of Heat Stress and Stocking Density on Growth Performance, Breast Meat Quality, and Intestinal Barrier Function in Broiler Chickens. Animals. 2019; 9(3):107. https://doi.org/10.3390/ani9030107
Chicago/Turabian StyleGoo, Doyun, Jong Hyuk Kim, Geun Hyeon Park, Jomari Badillo Delos Reyes, and Dong Yong Kil. 2019. "Effect of Heat Stress and Stocking Density on Growth Performance, Breast Meat Quality, and Intestinal Barrier Function in Broiler Chickens" Animals 9, no. 3: 107. https://doi.org/10.3390/ani9030107