Next Article in Journal
Real-Time Monitoring of Self-Fed Supplement Intake, Feeding Behaviour, and Growth Rate as Affected by Forage Quantity and Quality of Rotationally Grazed Beef Cattle
Next Article in Special Issue
Could Dietary Black Soldier Fly Meal Inclusion Affect the Liver and Intestinal Histological Traits and the Oxidative Stress Biomarkers of Siberian Sturgeon (Acipenser baerii) Juveniles?
Previous Article in Journal
The Demography and Practice of Australians Caring for Native Wildlife and the Psychological, Physical and Financial Effects of Rescue, Rehabilitation and Release of Wildlife on the Welfare of Carers
Previous Article in Special Issue
Effect of Dietary Replacement of Fishmeal by Insect Meal on Growth Performance, Blood Profiles and Economics of Growing Pigs in Kenya
Open AccessArticle

Tenebrio molitor and Zophobas morio Full-Fat Meals in Broiler Chicken Diets: Effects on Nutrients Digestibility, Digestive Enzyme Activities, and Cecal Microbiome

Department of Animal Nutrition, Poznań University of Life Sciences, Wołyńska 33, 60-637 Poznań, Poland
HiProMine S.A., Poznańska 8, 62-023 Robakowo, Poland
Division of Inland Fisheries and Aquaculture, Institute of Zoology, Poznań University of Life Sciences, Wojska Polskiego 71c, 60-625 Poznań, Poland
Department of Preclinical Sciences and Infectious Diseases, Poznań University of Life Sciences, Wołyńska 35, 60-637 Poznań, Poland
Department of Poultry Science, Faculty of Animal Bioengineering, University of Warmia and Mazury in Olsztyn, Oczapowskiego 5, 10-719 Olsztyn, Poland
Author to whom correspondence should be addressed.
Animals 2019, 9(12), 1128;
Received: 7 November 2019 / Revised: 5 December 2019 / Accepted: 7 December 2019 / Published: 12 December 2019
(This article belongs to the Collection Insects as Animal Feed: a New Promising Sector)
In animal nutrition, the links among health status, alimentary tract factors and gastrointestinal tract (GIT) integrity are increasing in importance. It has been documented that insects are useful as novel ingredients in poultry diets because they contain bioactive compounds such as chitin, melanin, and antimicrobial peptides, in addition to protein and dietary fat, and these bioactive compounds have been reported to modulate the GIT microbiome. From this perspective, insects could be promising functional feed additives to stimulate GIT health through inhibition of potentially pathogenic bacteria. Therefore, we evaluated the effect of the addition of a small amount of insects to the broiler chicken diet on the GIT microbiota composition and activity. Six experimental groups were used in the current study, i.e., two different levels (0.2% and 0.3%) of yellow mealworm and super mealworm full-fat meals, a positive control with salinomycin addition, and a negative control without any additives. Insect full-fat meals were capable of improving the health status of the birds by a positive reduction in potentially pathogenic bacteria in the cecal digesta and stimulation of the GIT microbiome to produce enzymes, especially glycolytic enzymes.


This study was conducted to investigate the effect of insect full-fat meals added in relatively small amounts to a complete diet on the coefficients of apparent ileal digestibility, short-chain fatty acid (SCFA) concentrations, bacterial enzymes, and the microbiota community in the cecal digesta of broiler chickens. In total, 600 one-day-old female Ross 308 broiler chicks were randomly assigned to six dietary treatments with 10 replicate pens/treatment and 10 birds/pen. The groups consisted of a negative control (NC) with no additives; a positive control (PC; salinomycin 60 ppm), and supplementation with 0.2% or 0.3% Tenebrio molitor or Zophobas morio full-fat meals. Z. morio (0.2%) addition increased the activities of α- and β-glucosidase and α-galactosidase. Dietary insects significantly decreased the cecal counts of the Bacteroides–Prevotella cluster in comparison to those in the NC and PC. Whereas, Clostridium perfringens counts were increased in the broiler chickens subjected to the 0.3% Z. morio treatment. In conclusion, small amounts of full-fat insect meals added to broiler diets were capable of reducing the abundance of potentially pathogenic bacteria, such as the Bacteroides–Prevotella cluster and Clostridium perfringens. In addition, this supplementation was able to stimulate the GIT microbiome to produce enzymes, especially glycolytic enzymes.
Keywords: insect meals; poultry; feed formulation; gut microbiota; pancreatic enzymes insect meals; poultry; feed formulation; gut microbiota; pancreatic enzymes

1. Introduction

Gastrointestinal tract (GIT) microbiota modulation is one of the key factors in achieving high growth performance and healthy broiler chickens. Improvement of intestinal integrity can exert a crucial role in regulating physiological homeostasis as well as supporting host resistance to infectious agents [1]. There appears to be an interaction among diet, GIT microbiota, and the immune system with a direct impact on growth performance [2]. Diet composition and its physical structure were found to be one of the factors influencing intestinal bacterial composition and activity in broilers [3,4,5]. In addition, the GIT microbiota plays an important role in improving and maintaining the innate immune system of broiler chickens, which has a positive effect on growth performance [5,6]. The cecum contains the highest microbial cell densities and plays an important role through the fermentation of nutrients to produce short-chain fatty acids (SCFAs). These fatty acids are transferred to the blood and thus can contribute energy to the body [7,8,9]. Recently, insects have been proposed as an alternative source of protein and fat for broilers, turkeys and laying hens [10,11,12,13,14]. In addition, insects were found to be one of the nutrient factors that can modulate the GIT microbiota populations during full or partial replacement of protein sources [15,16,17,18,19] and as feed additives in the diet of broiler chickens [20]. This microbiota modulation can be achieved through bioactive compounds that are present in insects, i.e., chitin, and antimicrobial peptides (AMPs) [16,20]. Yellow mealworm (Tenebrio molitor) and super mealworm larvae (Zophobas morio) presented an interesting nutrient profile, with 451 to 603 g/kg of dry matter (DM) of protein and 250 to 431 g/kg of DM of fat content [11]. Insect exoskeletons contain a large amount of chitin. Moreover, chitin was reported to have a beneficial effect on the innate immune system, and its antibacterial activity has been intensively studied [21,22,23]. However, De Marco et al. [24] and Schiavone et al. [25] reported that insects’ chitin might have negative effects on the coefficients of apparent ileal digestibility of crude protein in broiler chicken. The current study is a continuation of a previous trial described in Benzertiha et al. [26], in which insect full-fat meals that were added in small amounts to a complete diet of broiler chickens had positive effects on growth. In brief, the body weight gain and feed intake were increased in dietary groups supplemented with insect full-fat meals while comparing to positive control (with salinomycin addition, 60 ppm) and negative control (without any additions). The feed conversion ratio was not affected by any of the dietary treatments. In the previous study, insect full-fat meals positively affected the level of plasma immunoglobulins, i.e., IgY and IgM. However, despite the growing research interests in insect application in poultry nutrition, information about supplementation is still sparse for broiler chickens. Thus, the present study aimed to evaluate the effect of T. molitor and Z. morio full-fat meals added in small amounts (0.2% and 0.3%) to a complete diet on the coefficients of apparent ileal digestibility, pancreatic enzyme activity, short-chain fatty acid concentrations, bacterial enzymes, and microbiota community in the cecal digesta of broiler chickens.

2. Materials and Methods

According to Polish law and the EU directive (no. 2010/63/EU), the experiment carried out does not require the approval of the Local Ethics Committee for Experiments on Animals in Poznań. However, all animals were treated humanely according to the guidelines, and all efforts were made to minimize animal suffering.

2.1. Birds and Housing

The current trial was conducted at the experimental station unit (Piast, Olszowa Experimental Unit, no. 0161, Poland). A total of 600 one-day-old female Ross 308 broiler chicks were reared till 35 days of age. The birds were randomly distributed to six dietary treatments with 10 replicate pens per treatment, each consisting of 10 birds. Each replicate was placed in a floor pen (1.00 × 1.00 m). Further, the birds were reared in a chicken house according to AVIAGEN guidelines. The temperature and lighting regime met commercial recommendations. Vaccination against Gumboro disease was done for all birds at day 21 (AviPro PRECISE, Lohmann Animal GmbH, Cuxhaven, Germany).

2.2. Diets and Feeding Program

The ingredients and calculated nutritive value of the basal diet are presented in Table 1. The birds were offered mash form diet ad libitum for the whole period of the trial. All the raw materials were ground by a disc mill (Skiold A/S, Saby, Denmark) at a 2.5-mm disc distance and mixed without the application of any heat treatment. The diets were produced in accordance with ISO 9001:2008 procedures in a feed mill (Piast Pasze, Lewkowiec, Poland). The diets were prepared on a laboratory-scale line equipped with a horizontal double band mixer (Zuptor, Gostyń, Poland) with roller mills (Skiold, Saby, Denmark). The birds were offered a starter diet from 1 to 14 days of age and grower from 15 to 35 days of age. The nutritive values of the basal diets (starter and grower) were calculated to meet or exceed nutrients requirements of broilers as required by Nutrient Requirements of Poultry (NRC) [27]. Exogenous enzymes were not added to the diets. From 30 to 35 days of age, 0.2% of wheat in the diets was replaced by titanium dioxide (TiO2), which was used as an internal marker for calculation of nutrients digestibility. The insect full-fat meals were applied “on top” of the complete diet, and the experimental groups were as follows: PC (positive control)—NC + salinomycin addition (60 ppm); NC (negative control)—no additives; TM02—NC + 0.2% T. molitor full-fat meal; ZM02—NC + 0.2% Z. morio full-fat meal; TM03—NC + 0.3% T. molitor full-fat meal; and ZM03—NC + 0.3% Z. morio full-fat meal.

2.3. Preparation of Insect Full-Fat Meals

T. molitor and Z. morio used in the current trial were purchased from a commercial source (HiProMine S.A., Robakowo, Poland), air-dried in an oven (SLN 240, POL–EKO Aparatura, Wodzisław Śląski, Poland) for 24 h at 50 °C, and to obtain full-fat meals the dried form of insects were ground (Zelmer Motor Blocked Power 1900 W, Rzeszów, Poland). The analyzed compositions of both insect full-fat meals used in the current study are presented in Table 2.

2.4. Data and Sample Collection

At the end of the experiment (35 days), one bird from each replication (10 birds per group) were randomly selected and killed by cervical dislocation. The crop, jejunum, and ceca were gently emptied, and digesta was collected for measurements of pH, bacterial enzymes, and organic acid concentrations. The ileum was identified between the Meckel’s diverticulum and the ileocecal-colonic junction, and its contents were collected to perform the analysis of coefficients of apparent ileal digestibility of crude protein (CP), ether extract (EE), and apparent metabolizable energy (AMEN). Furthermore, the duodenal content was collected for pancreatic enzyme activity analysis. Immediately after collection, all samples were stored at −80 °C for further analysis.

2.5. Chemical Analysis and Digestibility Determination

The nutrient composition of the diets, digesta, as well as insect meals, were analyzed, as described by the Association of Official Analytical Chemists (AOAC) [28] using the methods 934.01, 976.05, 920.39, 942.05, and 985.29 for dry matter (DM), CP, EE, crude ash, and crude fiber (CF), respectively. Calcium and phosphorus in insect meals were determined according to the procedures described by Ptak et al. [29]. Further, the chitin content of the insect meals was analyzed, as presented by Soon et al. [30]. TiO2 analysis was performed according to Myers et al. [31], and the concentration was estimated, as described by Short et al. [32]. Gross energy (GE) was analyzed using an adiabatic bomb calorimeter (KL 12 Mn, Precyzja-Bit PPHU Sp. z o.o., Bydgoszcz, Poland) standardized with benzoic acid.
The coefficients of apparent ileal digestibility of CP and EE were calculated relative to the ratio of titanium dioxide (TiO2) to the nutrient content in the feed or digesta. The relative N retention coefficient was determined, as shown by Kaczmarek et al. [33]. The following equation was used (CP digestibility calculation is used as an example):
Digestibility     crude   protein = ( 1 [ ( TiO 2 g   kg   diet TiO 2   g kg   digesta ) × ( Crude   protein   g kg   digesta Crude   protein g kg   diet ) ] )

2.6. Analysis of pH and Pancreatic Enzyme Activity

The pH value of the crop, jejunal, and cecal content was measured using a combined glass and reference electrode (pH 100 L; VWR International, Leuven, Belgium). The activity of pancreatic enzymes was analyzed, as presented in detail by Pruszyńska-Oszmałek et al. [34].

2.7. Analysis of Fermentation Products and Bacterial Enzyme Activities in the Ceca

Short-chain fatty acids in the cecal digesta samples were analyzed, as described in detail by Fotschki et al. [35]. The activity of extracellular bacterial enzymes in the cecal digesta was measured, as presented in detail by Juśkiewicz et al. [36]

2.8. Microbial Community Analysis by Fluorescent In Situ Hybridization (FISH)

The microbial community of the cecal content of chickens was analyzed, as described in detail by Józefiak et al. [37] and Rawski et al. [38]. The oligonucleotide probes used for this study are shown in Table 3.

2.9. Calculations and Statistical Analysis

The designs of the experiments were completely randomized, and data were tested using the General Linear Models procedure of SAS software (SAS Institute Inc., Cary, NC, USA). In the experiments, means were separated using Duncan’s tests following one-way ANOVA based on the following equation:
y i j =   μ +   a i + δ i j
where yij is the observed dependent variable; μ is the overall mean; αi is the effect of treatment; and δij is the random error. In cases in which the overall effect was significant, p ≤ 0.05.

3. Results

3.1. Coefficients of Apparent Ileal Digestibility and Pancreatic Enzyme Activity

The effect of insect full-fat meals on the coefficients of apparent ileal digestibility of CP, EE, and AMEN is shown in Table 4. The apparent ileal digestibility of CP, EE, and AMEN was not affected (p > 0.05) by any of the dietary treatments. Moreover, the activity of pancreatic enzyme activity (lipase, amylase, and trypsin) did not differ significantly (p > 0.05) (Table 4).

3.2. Gastrointestinal Tract Content pH

The pH values of the crop, jejunal, and cecal content were not affected (p > 0.05) by any of the dietary treatments (Table 5).

3.3. Microbial Fermentation Patterns and Enzyme Activities

The activity of extracellular enzymes in the cecal digesta is shown in Table 6. In general, dietary treatments affected specific enzymes. The highest α-glucosidase activity was observed in TM03 and ZM02; however, the lowest activity was noted in NC (p = 0.004). β-glucosidase was also affected (p = 0.001); PC decreased its activity compared to TM02 and ZM02, while the highest activity was observed in ZM02 compared to PC, NC, TM03, and ZM03. Compared to other treatments, the addition of ZM02 resulted in the highest α-galactosidase and β-glucuronidase activities in the cecal content (p < 0.001). No effect (p > 0.05) on β-galactosidase was observed. Furthermore, α-arabinopyranosidase was also affected (p < 0.001), and its activity was highest in the NC group. β-xylosidase showed the highest activity in the ZM02 group.
The short-chain fatty acid concentrations in the cecal digesta were not affected (p > 0.05) by any of the dietary supplements (Table 7).

3.4. Microbial Community Analysis

Dietary treatment did not show any effect (p > 0.05) on the total number of bacteria (Table 8). Compared to NC and PC, dietary insect full-fat meals significantly (p = 0.001) decreased the cecal population of the Bacteroides-Prevotella cluster, among which ZM02 showed the lowest value. Moreover, in the ZM03 treatment, Clostridium perfringens showed the highest values (p = 0.033) compared to those in the other treatments, and the lowest value was observed in TM02. In addition, dietary treatments did not show any significant effect (p > 0.05) on the Clostridium leptum subgroup, Clostridium coccoides–Eubacterium rectale cluster, Lactobacillus spp./Enterococcus spp., and Enterobacteriaceae counts.

4. Discussion

Several studies have reported the interaction between the immune system and the GIT microbiota [1,8,45,46]. Therefore, the present study represents an evaluation of cecal microbial community modulation and SCFA production, as well as of the activity of extracellular bacterial enzymes in the cecal digesta after 0.2% and 0.3% administration of insect full-fat meals in the diet of broiler chickens.
In the current findings, insect full-fat meals did not show any negative effects on the ileal digestibility coefficients of CP, EE, or AMEN. Schiavone et al. [25] reported that the ileal digestibility coefficient of CP was lowered in a group fed 25% T. molitor larvae meal compared to that in a group fed soybean meal. The same effect was shown by Bovera et al. [47]. The authors related this effect to the high chitin content of the insect exoskeleton, which might have a negative impact on the ileal digestibility coefficients. In the present study, the chitin content of T. molitor and Z. morio was determined at 8.91% of DM and 4.59% of DM, respectively. This finding of the chitin content of both insect species is in agreement with the results of Bovera et al. [47] and Finke [48]. It is possible that due to the low inclusion level of both insect species in the diet, no negative effect on the ileal digestibility coefficient of nutrients was observed. Furthermore, analysis of the selected pancreatic enzymes confirmed the abovementioned results, and no effect on their activity was demonstrated. According to Józefiak et al. [20,49,50], the pH values of the digesta can be affected by dietary factors in different parts of the gastrointestinal tract (crop, jejunum, and cecum). Józefiak et al. [20] recorded that the pH value of the crop content was significantly reduced after supplementation of a low amount of insect full-fat meals (0.1% and 0.2%) in broiler chickens’ diet. However, in the present experiment, opposite results were observed. This discrepancy could be explained by the small (0.2% and 0.3%) insect full-fat meal addition amount used in this study.
Insect meal was reported to affect the SCFA content in the cecal digesta of laying hens, as well as in that of broiler chickens. Borrelli et al. [17] showed that a full replacement of soybean meal by Hermetia illucens larvae meal in the hen diet led to an increased production of butyric acid in the ceca, and the authors related the changes to modification of the microbiota. Furthermore, Loponte et al. [18] reported that broilers fed T. molitor meal as a full replacement of soybean meal showed increased SCFA levels in the cecal digesta, in which butyrate showed an increase of 185% compared to the level in the soybean meal group. The authors related this effect to the chitin content in the insect full-fat meals. In our study, the addition of a small amount of insect full-fat meal did not show any effect on the concentration of SCFAs in the ceca.
The replacement of soybean meal with insect meal as a source of protein has been reported to modulate the GIT microbiota population in broiler chickens and laying hens [15,16,17,18,19,20]. Our findings using insects as feed additives did not show any effects on the total number of bacteria. However, insect meal addition decreased the level of the Bacteroides–Prevotella cluster compared to that in the NC and PC. These results are in agreement with a study conducted by Józefiak et al. [20], in which the Bacteroides–Prevotella cluster level was lowered with the inclusion of 0.2% T. molitor full-fat meal. Furthermore, Biasato et al. [15] found that Bacteroides abundance was lowered in the ceca of broilers fed diets in which soybean meal was replaced by T. molitor meal. The reduction in Bacteroides abundance in the cecal content of the broiler chickens fed insect full-fat meal in the current study may be considered a potential positive effect. Bacteroides is one of the most commonly isolated pathogenic genera from clinical specimens [51]. Furthermore, C. perfringens is one of the most pathogenic bacteria in poultry production, causing necrotic enteritis [50,52,53,54]. T. molitor (0.2% and 0.3%) and Z. morio at 0.2% inclusion decreased the level of C. perfringens. Despite the overall effect, T. molitor showed a positive effect against C. perfringens.
The activity of the glycolytic enzymes α- and β-glucosidase and α-galactosidase was affected by the dietary treatments. ZM02 showed an increase in their activity. High activity of α-galactosidase and α-glucosidase may enhance the fermentation of lactose, raffinose, and resistant starch, which may lead to the production of SCFAs and lactic acids, which are sources of energy for GIT tissues [55]. On the other hand, the β-glucuronidase and β-glucosidase activity levels are often used to determine the pathogenic microbiota activity causing undesirable metabolic changes [56]. β-glucuronidase activity was low in treatments with salinomycin and T. molitor addition at both levels (0.2% and 0.3%), which may be considered positive findings because the high activity of this enzyme is potentially harmful to the host due to its involvement in the regeneration of toxic and carcinogenic metabolites in the hindgut [57]. Djouzi and Andiueux [58] reported that neither the decrease in the pH nor the changes in bacterial composition were sufficient to explain the glycolytic activity variations. We suggest that the small addition of insect full-fat meal to the diet of broiler chickens was enough to stimulate the GIT microbiome to produce enzymes, especially glycolytic enzymes.

5. Conclusions

Insect full-fat meals derived from T. molitor and Z. morio added in a small amount to the complete diet of broiler chickens did not have any negative effects on the nutrient ileal digestibility coefficients or the activity of pancreatic enzymes. Furthermore, dietary insect full-fat meals were capable of improving the health status of the birds by reducing pathogenic bacterial concentrations, such as those of the Bacteroides–Prevotella cluster and C. perfringens. In addition, this small amount of supplementation stimulated the GIT microbiota to produce enzymes, especially glycolytic enzymes.

Author Contributions

Conceptualization, A.B., B.K. and D.J.; methodology, A.B., B.K., M.R., A.J., and D.J.; software, A.B., and B.K.; validation, D.J.; formal analysis, A.B., B.K., M.R., K.K., J.J., and A.J.; investigation, A.B., B.K., A.J., and D.J.; resources, D.J.; data curation, A.B., B.K. and D.J.; writing—original draft, A.B.; writing—review and editing, B.K., M.R., A.J., K.K., J.J., and D.J.; visualization, A.B., B.K. and D.J.; supervision, A.B., B.K., and D.J.; project administration, D.J.; funding acquisition, D.J.


This work was funded by several sources, i.e., the funds of Poznań University of Life Sciences; the project TEAM TECH no. POIR.04.04.00-00-204E/16-00 entitled Insects as novel protein sources for fish and poultry, as financed by the Foundation of Polish Science (POIR 4.4); funds of the National Centre for Research and Development, no POIR.01.01.01-00-0828/15 entitled InnSecta: innovative technology of feedstuffs production based on insect biomass; and 2019 grant of the Young Researcher Program (Bartosz Kierończyk) of the Faculty of Veterinary Medicine and Animal Science Poznań University of Life Sciences, financed by the Polish Ministry of Science and Higher Education.

Conflicts of Interest

The authors declare no conflicts of interest.


  1. Kogut, M.H. The effect of microbiome modulation on the intestinal health of poultry. Anim. Feed Sci. Technol. 2019, 250, 32–40. [Google Scholar] [CrossRef]
  2. Kogut, M.H.; Arsenault, R.J. Gut health: The new paradigm in food animal production. Front. Vet. Sci. 2016, 3, 71. [Google Scholar] [CrossRef] [PubMed]
  3. Engberg, R.M.; Hedemann, M.S.; Jensen, B.B. The influence of grinding and pelleting of feed on the microbial composition and activity in the digestive tract of broiler chickens. Br. Poult. Sci. 2002, 43, 569–579. [Google Scholar] [CrossRef] [PubMed]
  4. Engberg, R.M.; Hedemann, M.S.; Steenfeldt, S.; Jensen, B.B. Influence of whole wheat and xylanase on broiler performance and microbial composition and activity in the digestive tract. Poult. Sci. 2004, 83, 925–938. [Google Scholar] [CrossRef]
  5. Józefiak, D.; Rutkowski, A.; Martin, S. Carbohydrate fermentation in the avian ceca: A review. Anim. Feed Sci. Technol. 2004, 113, 1–15. [Google Scholar] [CrossRef]
  6. Van der Hoeven-Hangoor, E.; Van der Vossen, J.; Schuren, F.; Verstegen, M.; De Oliveira, J.; Montijn, R.; Hendriks, W. Ileal microbiota composition of broilers fed various commercial diet compositions. Poult. Sci. 2013, 92, 2713–2723. [Google Scholar] [CrossRef]
  7. Józefiak, D.; Sip, A.; Rawski, M.; Rutkowski, A.; Kaczmarek, S.; Højberg, O.; Jensen, B.B.; Engberg, R.M. Dietary divercin modifies gastrointestinal microbiota and improves growth performance in broiler chickens. Br. Poult. Sci. 2011, 52, 492–499. [Google Scholar] [CrossRef]
  8. Oakley, B.B.; Lillehoj, H.S.; Kogut, M.H.; Kim, W.K.; Maurer, J.J.; Pedroso, A.; Lee, M.D.; Collett, S.R.; Johnson, T.J.; Cox, N.A. The chicken gastrointestinal microbiome. FEMS Microbiol. Lett. 2014, 360, 100–112. [Google Scholar] [CrossRef]
  9. Svihus, B.; Choct, M.; Classen, H. Function and nutritional roles of the avian caeca: A review. World’s Poult. Sci. J. 2013, 69, 249–264. [Google Scholar] [CrossRef]
  10. Benzertiha, A.; Kierończyk, B.; Rawski, M.; Kołodziejski, P.; Bryszak, M.; Józefiak, D. Insect oil as an alternative to palm oil and poultry fat in broiler chicken nutrition. Animals 2019, 9, 116. [Google Scholar] [CrossRef]
  11. Józefiak, D.; Józefiak, A.; Kierończyk, B.; Rawski, M.; Świątkiewicz, S.; Długosz, J.; Engberg, R.M. Insects—A natural nutrient source for poultry—A review. Ann. Anim. Sci. 2016, 16, 297–313. [Google Scholar] [CrossRef]
  12. Kierończyk, B.; Rawski, M.; Józefiak, A.; Mazurkiewicz, J.; Świątkiewicz, S.; Siwek, M.; Bednarczyk, M.; Szumacher-Strabel, M.; Cieślak, A.; Benzertiha, A. Effects of replacing soybean oil with selected insect fats on broilers. Anim. Feed Sci. Technol. 2018, 240, 170–183. [Google Scholar] [CrossRef]
  13. Premalatha, M.; Abbasi, T.; Abasi, T.; Abbasi, S. Energy-efficient food production to reduce global warming and ecodegradation: The use of edible insects. Renew. Sustain. Energy Rev. 2011, 15, 4357–4360. [Google Scholar] [CrossRef]
  14. Sánchez-Muros, M.-J.; Barroso, F.G.; Manzano-Agugliaro, F. Insect meal as renewable source of food for animal feeding: A review. J. Clean. Prod. 2014, 65, 16–27. [Google Scholar] [CrossRef]
  15. Biasato, I.; Ferrocino, I.; Biasibetti, E.; Grego, E.; Dabbou, S.; Sereno, A.; Gai, F.; Gasco, L.; Schiavone, A.; Cocolin, L. Modulation of intestinal microbiota, morphology and mucin composition by dietary insect meal inclusion in free-range chickens. BMC Vet. Res. 2018, 14, 383. [Google Scholar] [CrossRef]
  16. Biasato, I.; Ferrocino, I.; Grego, E.; Dabbou, S.; Gai, F.; Gasco, L.; Cocolin, L.; Capucchio, M.T.; Schiavone, A. Gut microbiota and mucin composition in female broiler chickens fed diets including yellow mealworm (Tenebrio molitor, L.). Animals 2019, 9, 213. [Google Scholar] [CrossRef]
  17. Borrelli, L.; Coretti, L.; Dipineto, L.; Bovera, F.; Menna, F.; Chiariotti, L.; Nizza, A.; Lembo, F.; Fioretti, A. Insect-based diet, a promising nutritional source, modulates gut microbiota composition and SCFAs production in laying hens. Sci. Rep. 2017, 7, 16269. [Google Scholar] [CrossRef]
  18. Loponte, R.; Bovera, F.; Piccolo, G.; Gasco, L.; Secci, G.; Iaconisi, V.; Parisi, G. Fatty acid profile of lipids and caeca volatile fatty acid production of broilers fed a full fat meal from Tenebrio molitor larvae. Ital. J. Anim. Sci. 2019, 18, 168–173. [Google Scholar] [CrossRef]
  19. Moula, N.; Hornick, J.-L.; Cabaraux, J.-F.; Korsak, N.; Daube, G.; Dawans, E.; Antoine, N.; Taminiau, B.; Detilleux, J. Effects of dietary black soldier fly larvae on performance of broilers mediated or not through changes in microbiota. J. Insects Food Feed 2018, 4, 31–42. [Google Scholar] [CrossRef]
  20. Józefiak, A.; Kierończyk, B.; Rawski, M.; Mazurkiewicz, J.; Benzertiha, A.; Gobbi, P.; Nogales-Merida, S.; Świątkiewicz, S.; Józefiak, D. Full-fat insect meals as feed additive–The effect on broiler chicken growth performance and gastrointestinal tract microbiota. J. Anim. Feed Sci. 2018, 27, 131–139. [Google Scholar] [CrossRef]
  21. Esteban, M.; Cuesta, A.; Ortuno, J.; Meseguer, J. Immunomodulatory effects of dietary intake of chitin on gilthead seabream (Sparus aurata L.) innate immune system. Fish Shellfish Immunol. 2001, 11, 303–315. [Google Scholar] [CrossRef]
  22. Koide, S. Chitin-chitosan: Properties, benefits and risks. Nutr. Res. 1998, 18, 1091–1101. [Google Scholar] [CrossRef]
  23. Xu, Y.; Shi, B.; Yan, S.; Li, T.; Guo, Y.; Li, J. Effects of chitosan on body weight gain, growth hormone. Asian Australas. J. Anim. Sci. 2013, 26, 1484. [Google Scholar] [CrossRef]
  24. De Marco, M.; Martínez, S.; Hernandez, F.; Madrid, J.; Gai, F.; Rotolo, L.; Belforti, M.; Bergero, D.; Katz, H.; Dabbou, S.; et al. Nutritional value of two insect larval meals (Tenebrio molitor and Hermetia illucens) for broiler chickens: Apparent nutrient digestibility, apparent ileal amino acid digestibility and apparent metabolizable energy. Anim. Feed Sci. Technol. 2015, 209, 208–211. [Google Scholar] [CrossRef]
  25. Schiavone, A.; De Marco, M.; Rotolo, L.; Belforti, M.; Martinez Mirò, S.; Madrid Sanchez, J.; Hernandez Ruiperez, F.; Bianchi, C.; Sterpone, L.; Malfatto, V.M. Nutrient digestibility of Hermetia illucens and Tenebrio molitor meal in broiler chickens. In Proceedings of the 1st International conference “Insects to Feed the World”, Wageningen, The Netherlands, 14–17 May 2014; p. 73. [Google Scholar]
  26. Benzertiha, A.; Kierończyk, B.; Kołodziejski, P.; Pruszyńska–Oszmałek, E.; Rawski, M.; Józefiak, D.; Józefiak, A. Tenebrio molitor and Zophobas morio full-fat meals as functional feed additives affect broiler chickens’ growth performance and immune system traits. Poult. Sci. 2019. [Google Scholar] [CrossRef] [PubMed]
  27. National Research Council (N.R.C.). Nutrient Requirements of Poultry, 9th ed.; The National Academies Press: Washington, DC, USA, 1994; pp. 27, 63. [Google Scholar]
  28. Association of Official Analytical Chemists (AOAC). Official Methods of Analysis, 18th ed.; Association of Official Analytical Chemists: Arlington, VA, USA, 2005; ISBN 0-935584-77-3. [Google Scholar]
  29. Ptak, A.; Józefiak, D.; Kierończyk, B.; Rawski, M.; Żyła, K.; Świątkiewicz, S. Effect of different phytases on the performance, nutrient retention and tibia composition in broiler chickens. Arch. Anim. Breed. 2013, 56, 1028–1038. [Google Scholar] [CrossRef]
  30. Soon, C.Y.; Tee, Y.B.; Tan, C.H.; Rosnita, A.T.; Khalina, A. Extraction and physicochemical characterization of chitin and chitosan from Zophobas morio larvae in varying sodium hydroxide concentration. Int. J. Biol. Macromol. 2018, 108, 135–142. [Google Scholar] [CrossRef] [PubMed]
  31. Myers, W.; Ludden, P.; Nayigihugu, V.; Hess, B. A procedure for the preparation and quantitative analysis of samples for titanium dioxide. J. Anim. Sci. 2004, 82, 179–183. [Google Scholar] [CrossRef]
  32. Short, F.; Gorton, P.; Wiseman, J.; Boorman, K. Determination of titanium dioxide added as an inert marker in chicken digestibility studies. Anim. Feed Sci. Technol. 1996, 59, 215–221. [Google Scholar] [CrossRef]
  33. Kaczmarek, S.; Hejdysz, M.; Kubiś, M.; Kasprowicz-Potocka, M.; Rutkowski, A. The nutritional value of yellow lupin (Lupinus luteus L.) for broilers. Anim. Feed Sci. Technol. 2016, 222, 43–53. [Google Scholar] [CrossRef]
  34. Pruszyńska-Oszmałek, E.; Kołodziejski, P.; Stadnicka, K.; Sassek, M.; Chałupka, D.; Kuston, B.; Nogowski, L.; Maćkowiak, P.; Maiorano, G.; Jankowski, J. In ovo injection of prebiotics and synbiotics affects the digestive potency of the pancreas in growing chickens. Poult. Sci. 2015, 94, 1909–1916. [Google Scholar] [CrossRef] [PubMed]
  35. Fotschki, B.; Juśkiewicz, J.; Jurgoński, A.; Kołodziejczyk, K.; Milala, J.; Kosmala, M.; Zduńczyk, Z. Anthocyanins in strawberry polyphenolic extract enhance the beneficial effects of diets with fructooligosaccharides in the rat cecal environment. PLoS ONE 2016, 11, e0149081. [Google Scholar] [CrossRef] [PubMed]
  36. Juśkiewicz, J.; Zduńczyk, Z.; Jankowski, J. Effect of adding mannan-oligosaccharide to the diet on the performance, weight of digestive tract segments, and caecal digesta parameters in young turkeys. J. Anim. Feed Sci. 2003, 12, 133–142. [Google Scholar] [CrossRef]
  37. Józefiak, D.; Kierończyk, B.; Juśkiewicz, J.; Zduńczyk, Z.; Rawski, M.; Długosz, J.; Sip, A.; Højberg, O. Dietary nisin modulates the gastrointestinal microbial ecology and enhances growth performance of the broiler chickens. PLoS ONE 2013, 8, e85347. [Google Scholar] [CrossRef]
  38. Rawski, M.; Kierończyk, B.; Długosz, J.; Świątkiewicz, S.; Jozefiak, D. Dietary probiotics affect gastrointestinal microbiota, histological structure and shell mineralization in turtles. PLoS ONE 2016, 11, e0147859. [Google Scholar] [CrossRef]
  39. Manz, W.; Szewzyk, U.; Ericsson, P.; Amann, R.; Schleifer, K.; Stenström, T. In situ identification of bacteria in drinking water and adjoining biofilms by hybridization with 16S and 23S rRNA-directed fluorescent oligonucleotide probes. Appl. Environ. Microbiol. 1993, 59, 2293–2298. [Google Scholar]
  40. Fallani, M.; Rigottier-Gois, L.; Aguilera, M.; Bridonneau, C.; Collignon, A.; Edwards, C.A.; Corthier, G.; Doré, J. Clostridium difficile and Clostridium perfringens species detected in infant faecal microbiota using 16S rRNA targeted probes. J. Microbiol. Methods 2006, 67, 150–161. [Google Scholar] [CrossRef] [PubMed]
  41. Sghir, A.; Gramet, G.; Suau, A.; Rochet, V.; Pochart, P.; Dore, J. Quantification of bacterial groups within human fecal flora by oligonucleotide probe hybridization. Appl. Environ. Microbiol. 2000, 66, 2263–2266. [Google Scholar] [CrossRef]
  42. Harmsen, H.J.; Elfferich, P.; Schut, F.; Welling, G.W. A 16S rRNA-targeted probe for detection of lactobacilli and enterococci in faecal samples by fluorescent in situ hybridization. Microb. Ecol. Health Dis. 1999, 11, 3–12. [Google Scholar]
  43. Welling, G.W.; Wildeboer-Veloo, L.; Raangs, G.C.; Franks, A.H.; Jansen, G.J.; Tonk, R.H.; Degener, J.E.; Harmsen, H.J. Variations of bacterial populations in human faeces measured by FISH with group-specific 16S rRNA-targeted oligonucleotide probes. Biosci. Microflora 2000, 19, 79–84. [Google Scholar] [CrossRef]
  44. Sghir, A.; Antonopoulos, D.; Mackie, R.I. Design and evaluation of a Lactobacillus group-specific ribosomal RNA-targeted hybridization probe and its application to the study of intestinal microecology in pigs. Syst. Appl. Microbiol. 1998, 21, 291–296. [Google Scholar] [CrossRef]
  45. Forder, R.; Howarth, G.; Tivey, D.; Hughes, R. Bacterial Modulation of Small Intestinal Goblet Cells and Mucin Composition During Early Posthatch Development of Poultry1. Poult. Sci. 2007, 86, 2396–2403. [Google Scholar] [CrossRef] [PubMed]
  46. Sommer, F.; Bäckhed, F. The gut microbiota—Masters of host development and physiology. Nat. Rev. Microbiol. 2013, 11, 227. [Google Scholar] [CrossRef] [PubMed]
  47. Bovera, F.; Loponte, R.; Marono, S.; Piccolo, G.; Parisi, G.; Iaconisi, V.; Gasco, L.; Nizza, A. Use of Tenebrio molitor larvae meal as protein source in broiler diet: Effect on growth performance, nutrient digestibility, and carcass and meat traits. J. Anim. Sci. 2016, 94, 639–647. [Google Scholar] [CrossRef] [PubMed]
  48. Finke, M.D. Estimate of chitin in raw whole insects. Zoo Biol. 2007, 26, 105–115. [Google Scholar] [CrossRef] [PubMed]
  49. Józefiak, D.; Kierończyk, B.; Rawski, M.; Hejdysz, M.; Rutkowski, A.; Engberg, R.M.; Højberg, O. Clostridium perfringens challenge and dietary fat type affect broiler chicken performance and fermentation in the gastrointestinal tract. Animal 2014, 8, 912–922. [Google Scholar] [CrossRef]
  50. Józefiak, D.; Świątkiewicz, S.; Kierończyk, B.; Rawski, M.; Długosz, J.; Engberg, R.M.; Højberg, O. Clostridium perfringens challenge and dietary fat type modifies performance, microbiota composition and histomorphology of the broiler chicken gastrointestinal tract. Eur. Poult. Sci. 2016, 80. [Google Scholar]
  51. Falagas, M.E.; Siakavellas, E. Bacteroides, Prevotella, and Porphyromonas species: A review of antibiotic resistance and therapeutic options. Int. J. Antimicrob. Agents 2000, 15, 1–9. [Google Scholar] [CrossRef]
  52. Engström, B.; Fermer, C.; Lindberg, A.; Saarinen, E.; Båverud, V.; Gunnarsson, A. Molecular typing of isolates of Clostridium perfringens from healthy and diseased poultry. Vet. Microbiol. 2003, 94, 225–235. [Google Scholar] [CrossRef]
  53. Immerseel, F.V.; Buck, J.D.; Pasmans, F.; Huyghebaert, G.; Haesebrouck, F.; Ducatelle, R. Clostridium perfringens in poultry: An emerging threat for animal and public health. Avian Pathol. 2004, 33, 537–549. [Google Scholar] [CrossRef]
  54. Keyburn, A.L.; Bannam, T.L.; Moore, R.J.; Rood, J.I. NetB, a pore-forming toxin from necrotic enteritis strains of Clostridium perfringens. Toxins 2010, 2, 1913–1927. [Google Scholar] [CrossRef] [PubMed]
  55. Juśkiewicz, J.; Gruzauskas, R.; Zduńczyk, Z.; Semaskaite, A.; Jankowski, J.; Totilas, Z.; Jarule, V.; Sasyte, V.; Zduńczyk, P.; Raceviciute-Stupeliene, A. Effects of dietary addition of Macleaya cordata alkaloid extract on growth performance, caecal indices and breast meat fatty acids profile in male broilers. J. Anim. Physiol. Anim. Nutr. 2011, 95, 171–178. [Google Scholar] [CrossRef] [PubMed]
  56. Zduńczyk, Z.; Juśkiewicz, J.; Jankowski, J.; Koncicki, A. Performance and caecal adaptation of turkeys to diets without or with antibiotic and with different levels of mannan-oligosaccharide. Arch. Anim. Nutr. 2004, 58, 367–378. [Google Scholar] [CrossRef] [PubMed]
  57. Juśkiewicz, J.; Zduńczyk, Z.; Wróblewska, M. The effect of the administration of cellulose and fructans with different degree of polymerization to rats on caecal fermentation and biochemical indicators in the serum. Czech J. Anim. Sci. 2005, 50, 273–280. [Google Scholar] [CrossRef]
  58. Djouzi, Z.; Andiueux, C. Compared effects of three oligosaccharides on metabolism of intestinal microflora in rats inoculated with a human faecal flora. Br. J. Nutr. 1997, 78, 313–324. [Google Scholar] [CrossRef]
Table 1. Composition of the basal experimental diets.
Table 1. Composition of the basal experimental diets.
Ingredients (%)1–14 Days15–35 Days
Soybean meal20.7816.95
Rapeseed meal10.0010.00
Soybean oil4.997.11
Fish meal2.002.00
Monocalcium phosphate1.310.67
Vitamin–mineral premix a0.30.3
Methionine 88% liquid0.310.25
L–Lysine HCl0.290.24
Sodium carbonate (Na2CO3)0.220.17
Salt (NaCl)0.110.13
Titanium dioxide (TiO2) b-0.2
Calculated nutritive value (%)
Crude protein21.5620.06
Ether extract6.548.63
Crude fiber3.313.22
Calcium (Ca)0.850.70
Total phosphorus (P)0.790.63
Methionine + cysteine0.990.90
AMEN (MJ·kg−1)12.5613.31
a Provided per 1 kg of diet: vitamin A, 11,166 IU; vitamin D3, 2500 IU; vitamin E, 80 mg; menadione, 2.50 mg; vitamin B1, 2.17 mg; vitamin B2, 7.0 mg; vitamin B6, 4.0 mg; vitamin B7, 0.18 mg; vitamin B9, 1.17 mg; vitamin B12, 0.02 mg; choline, 379 mg; D–pantothenic acid, 12.50 mg; niacin, 41.67 mg; ethoxyquin, 0.09 mg; Mn (MnO2), 73 mg; Zn (ZnO), 55 mg; Fe (FeSO4), 45 mg; Cu (CuSO4), 20 mg; I (CaI2O6), 0.62 mg; and Se (Na2SeO3), 0.3 mg. b Replaced the corresponding amount of wheat in each diet from 30 to 35 days of broiler growth.
Table 2. Nutrient composition of Tenebrio molitor and Zophobas morio full-fat meals used in the experiment (g kg−1 of DM).
Table 2. Nutrient composition of Tenebrio molitor and Zophobas morio full-fat meals used in the experiment (g kg−1 of DM).
ItemsTenebrio molitorZophobas morio
Dry matter (%)95.5896.32
Crude protein470493
Ether extract296336
Crude ash25.625.2
Crude fiber56.051.0
Table 3. Oligonucleotide probes used for cecal microbiota analysis using fluorescent in situ hybridization (FISH).
Table 3. Oligonucleotide probes used for cecal microbiota analysis using fluorescent in situ hybridization (FISH).
TargetProbeSequence (5′ to 3′)References
Bacteroides–Prevotella clusterBacto303CCAATGTGGGGGACCTT[39]
Clostridium perfringensCperf191GTAGTAAGTTGGTTTCCTCG[40]
Lactobacillus spp./Enterococcus spp.Lab158GGTATTAGCAYCTGTTTCCA[42]
Clostridium coccoides–Eubacterium rectale clusterErec482GCTTCTTAGTCARGTACCG[43]
Clostridium leptum subgroupClept1240GTTTTRTCAACGGCAGTC[44]
Table 4. Coefficients of apparent ileal digestibility of crude protein, ether extract, and apparent metabolizable energy corrected to zero nitrogen balance, as well as activities of selected pancreatic enzymes in the duodenal digesta of broiler chickens, expressed as % of control.
Table 4. Coefficients of apparent ileal digestibility of crude protein, ether extract, and apparent metabolizable energy corrected to zero nitrogen balance, as well as activities of selected pancreatic enzymes in the duodenal digesta of broiler chickens, expressed as % of control.
Coefficients of apparent ileal digestibility
AMEN (MJ)10.6412.0511.9512.0411.3711.870.910.140
Activity of pancreatic enzymes
PC—positive control (salinomycin, 60 ppm); NC—negative control (no additives); TM02—(0.2% T. molitor full-fat meal); ZM02—(0.2% Z. morio full-fat meal); TM03—(0.3% T. molitor full-fat meal); ZM03—(0.3% Z. morio full-fat meal); SEM—standard error of the mean; CP—crude protein; EE—ether extract.
Table 5. The effect of dietary supplementation with insect meals on the pH value of the gastrointestinal tract (GIT) content.
Table 5. The effect of dietary supplementation with insect meals on the pH value of the gastrointestinal tract (GIT) content.
PC—positive control (salinomycin, 60 ppm); NC—negative control (no additives); TM02—(0.2% T. molitor full-fat meal); ZM02—(0.2% Z. morio full-fat meal); TM03—(0.3% T. molitor full-fat meal); ZM03—(0.3% Z. morio full-fat meal); SEM—standard error of the mean.
Table 6. Activity of extracellular bacterial enzymes in the cecal digesta (µmol/h/g digesta).
Table 6. Activity of extracellular bacterial enzymes in the cecal digesta (µmol/h/g digesta).
α_glucosidase14.53 ab10.99 c14.29 ab15.97 a19.10 a12.58 bc3.140.004
β_glucosidase1.53 c1.89 bc2.45 ab3.22 a1.87 bc1.62 bc0.910.001
α_galactosidase10.57 b7.36 b8.00 b15.09 a9.78 b9.46 b3.66<0.001
β_glucuronidase3.01 c5.73 ab4.17 bc6.51 a4.23 bc5.14 ab2.130.009
α_arabinopyranosidase0.84 c1.88 a1.07 bc1.66 ab1.59 ab0.67 c0.66<0.001
β_xylosidase1.35 b1.71 b2.23 ab2.69 a1.84 ab1.35 b0.90.017
PC—positive control (salinomycin, 60 ppm); NC—negative control (no additives); TM02—(0.2% T. molitor full-fat meal); ZM02—(0.2% Z. morio full-fat meal); TM03—(0.3% T. molitor full-fat meal); ZM03—(0.3% Z. morio full-fat meal); SEM—standard error of the mean; a–c means within a row with no common superscripts differ significantly (p ≤ 0.05).
Table 7. Short-chain fatty acids concentration and profile in the cecal digesta of broiler chickens.
Table 7. Short-chain fatty acids concentration and profile in the cecal digesta of broiler chickens.
SCFA concentration (µmol/g digesta)
Acetic acid67.7958.7362.8261.9763.0957.1315.170.695
Propionic acid7.095.495.445.55.364.81.790.071
Butyric acid13.0715.0515.0914.2113.6313.195.930.949
Valeric acid1.250.961.
Iso-valeric acid0.620.480.590.550.550.580.220.803
Iso-butyric acid0.580.360.40.420.420.40.210.249
sum SCFA90.480.4385.4583.6584.17720.070.765
SCFA profile (% of total SCFA)
Acetic acid profile75.1773.0573.7874.2775.3173.64.020.774
Propionic acid profile7.876.616.616.536.457.222.560.793
Butyric acid profile14.3517.9117.116.8115.8416.225.110.720
PC—positive control (salinomycin, 60 ppm); NC—negative control (no additives); TM02—(0.2% T. molitor full-fat meal); ZM02—(0.2% Z. morio full-fat meal); TM03—(0.3% T. molitor full-fat meal); ZM03—(0.3% Z. morio full-fat meal); SEM—standard error of the mean; PSCFA—putrefactive short-chain fatty acid; SCFA–short-chain fatty acid.
Table 8. Selected microbiota counts in the cecal digesta (log CFU/g of digesta) determined by DAPI (4’,6-diamidino-2-phenylindole) staining and fluorescent in situ hybridization (FISH).
Table 8. Selected microbiota counts in the cecal digesta (log CFU/g of digesta) determined by DAPI (4’,6-diamidino-2-phenylindole) staining and fluorescent in situ hybridization (FISH).
Total number of bacteria10.2410.1610.1910.1910.2210.150.070.254
Bacteroides–Prevotella cluster9.52 a9.53 a9.45 ab9.26 c9.37 bc9.34 bc0.10.001
Clostridium leptum subgroup9.329.
Clostridium perfringens9.4 ab9.37 b9.35 b9.31 b9.36 b9.54 a0.110.033
Clostridium coccoidesEubacterium rectale cluster9.419.319.399.49.469.390.130.663
Lactobacillus spp./Enterococcus spp.9.389.349.339.299.349.460.140.543
PC—positive control (salinomycin, 60 ppm); NC—negative control (no additives); TM02—(0.2% T. molitor full-fat meal); ZM02—(0.2% Z. morio full-fat meal); TM03—(0.3% T. molitor full-fat meal); ZM03—(0.3% Z. morio full-fat meal); SEM—standard error of the mean; a–c means within a row with no common superscripts differ significantly (p ≤ 0.05).
Back to TopTop