Tenebrio molitor and Zophobas morio Full-Fat Meals in Broiler Chicken Diets: Effects on Nutrients Digestibility, Digestive Enzyme Activities, and Cecal Microbiome
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Birds and Housing
2.2. Diets and Feeding Program
2.3. Preparation of Insect Full-Fat Meals
2.4. Data and Sample Collection
2.5. Chemical Analysis and Digestibility Determination
2.6. Analysis of pH and Pancreatic Enzyme Activity
2.7. Analysis of Fermentation Products and Bacterial Enzyme Activities in the Ceca
2.8. Microbial Community Analysis by Fluorescent In Situ Hybridization (FISH)
2.9. Calculations and Statistical Analysis
3. Results
3.1. Coefficients of Apparent Ileal Digestibility and Pancreatic Enzyme Activity
3.2. Gastrointestinal Tract Content pH
3.3. Microbial Fermentation Patterns and Enzyme Activities
3.4. Microbial Community Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Kogut, M.H. The effect of microbiome modulation on the intestinal health of poultry. Anim. Feed Sci. Technol. 2019, 250, 32–40. [Google Scholar] [CrossRef] [Scilit]
- Kogut, M.H.; Arsenault, R.J. Gut health: The new paradigm in food animal production. Front. Vet. Sci. 2016, 3, 71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Engberg, R.M.; Hedemann, M.S.; Jensen, B.B. The influence of grinding and pelleting of feed on the microbial composition and activity in the digestive tract of broiler chickens. Br. Poult. Sci. 2002, 43, 569–579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Engberg, R.M.; Hedemann, M.S.; Steenfeldt, S.; Jensen, B.B. Influence of whole wheat and xylanase on broiler performance and microbial composition and activity in the digestive tract. Poult. Sci. 2004, 83, 925–938. [Google Scholar] [CrossRef] [Scilit]
- Józefiak, D.; Rutkowski, A.; Martin, S. Carbohydrate fermentation in the avian ceca: A review. Anim. Feed Sci. Technol. 2004, 113, 1–15. [Google Scholar] [CrossRef] [Scilit]
- Van der Hoeven-Hangoor, E.; Van der Vossen, J.; Schuren, F.; Verstegen, M.; De Oliveira, J.; Montijn, R.; Hendriks, W. Ileal microbiota composition of broilers fed various commercial diet compositions. Poult. Sci. 2013, 92, 2713–2723. [Google Scholar] [CrossRef] [Scilit]
- Józefiak, D.; Sip, A.; Rawski, M.; Rutkowski, A.; Kaczmarek, S.; Højberg, O.; Jensen, B.B.; Engberg, R.M. Dietary divercin modifies gastrointestinal microbiota and improves growth performance in broiler chickens. Br. Poult. Sci. 2011, 52, 492–499. [Google Scholar] [CrossRef] [Scilit]
- Oakley, B.B.; Lillehoj, H.S.; Kogut, M.H.; Kim, W.K.; Maurer, J.J.; Pedroso, A.; Lee, M.D.; Collett, S.R.; Johnson, T.J.; Cox, N.A. The chicken gastrointestinal microbiome. FEMS Microbiol. Lett. 2014, 360, 100–112. [Google Scholar] [CrossRef] [Scilit]
- Svihus, B.; Choct, M.; Classen, H. Function and nutritional roles of the avian caeca: A review. World’s Poult. Sci. J. 2013, 69, 249–264. [Google Scholar] [CrossRef] [Scilit]
- Benzertiha, A.; Kierończyk, B.; Rawski, M.; Kołodziejski, P.; Bryszak, M.; Józefiak, D. Insect oil as an alternative to palm oil and poultry fat in broiler chicken nutrition. Animals 2019, 9, 116. [Google Scholar] [CrossRef] [Scilit]
- Józefiak, D.; Józefiak, A.; Kierończyk, B.; Rawski, M.; Świątkiewicz, S.; Długosz, J.; Engberg, R.M. Insects—A natural nutrient source for poultry—A review. Ann. Anim. Sci. 2016, 16, 297–313. [Google Scholar] [CrossRef] [Scilit]
- Kierończyk, B.; Rawski, M.; Józefiak, A.; Mazurkiewicz, J.; Świątkiewicz, S.; Siwek, M.; Bednarczyk, M.; Szumacher-Strabel, M.; Cieślak, A.; Benzertiha, A. Effects of replacing soybean oil with selected insect fats on broilers. Anim. Feed Sci. Technol. 2018, 240, 170–183. [Google Scholar] [CrossRef] [Scilit]
- Premalatha, M.; Abbasi, T.; Abasi, T.; Abbasi, S. Energy-efficient food production to reduce global warming and ecodegradation: The use of edible insects. Renew. Sustain. Energy Rev. 2011, 15, 4357–4360. [Google Scholar] [CrossRef] [Scilit]
- Sánchez-Muros, M.-J.; Barroso, F.G.; Manzano-Agugliaro, F. Insect meal as renewable source of food for animal feeding: A review. J. Clean. Prod. 2014, 65, 16–27. [Google Scholar] [CrossRef] [Scilit]
- Biasato, I.; Ferrocino, I.; Biasibetti, E.; Grego, E.; Dabbou, S.; Sereno, A.; Gai, F.; Gasco, L.; Schiavone, A.; Cocolin, L. Modulation of intestinal microbiota, morphology and mucin composition by dietary insect meal inclusion in free-range chickens. BMC Vet. Res. 2018, 14, 383. [Google Scholar] [CrossRef] [Scilit]
- Biasato, I.; Ferrocino, I.; Grego, E.; Dabbou, S.; Gai, F.; Gasco, L.; Cocolin, L.; Capucchio, M.T.; Schiavone, A. Gut microbiota and mucin composition in female broiler chickens fed diets including yellow mealworm (Tenebrio molitor, L.). Animals 2019, 9, 213. [Google Scholar] [CrossRef] [Scilit]
- Borrelli, L.; Coretti, L.; Dipineto, L.; Bovera, F.; Menna, F.; Chiariotti, L.; Nizza, A.; Lembo, F.; Fioretti, A. Insect-based diet, a promising nutritional source, modulates gut microbiota composition and SCFAs production in laying hens. Sci. Rep. 2017, 7, 16269. [Google Scholar] [CrossRef] [Scilit]
- Loponte, R.; Bovera, F.; Piccolo, G.; Gasco, L.; Secci, G.; Iaconisi, V.; Parisi, G. Fatty acid profile of lipids and caeca volatile fatty acid production of broilers fed a full fat meal from Tenebrio molitor larvae. Ital. J. Anim. Sci. 2019, 18, 168–173. [Google Scholar] [CrossRef] [Scilit]
- Moula, N.; Hornick, J.-L.; Cabaraux, J.-F.; Korsak, N.; Daube, G.; Dawans, E.; Antoine, N.; Taminiau, B.; Detilleux, J. Effects of dietary black soldier fly larvae on performance of broilers mediated or not through changes in microbiota. J. Insects Food Feed 2018, 4, 31–42. [Google Scholar] [CrossRef] [Scilit]
- Józefiak, A.; Kierończyk, B.; Rawski, M.; Mazurkiewicz, J.; Benzertiha, A.; Gobbi, P.; Nogales-Merida, S.; Świątkiewicz, S.; Józefiak, D. Full-fat insect meals as feed additive–The effect on broiler chicken growth performance and gastrointestinal tract microbiota. J. Anim. Feed Sci. 2018, 27, 131–139. [Google Scholar] [CrossRef] [Scilit]
- Esteban, M.; Cuesta, A.; Ortuno, J.; Meseguer, J. Immunomodulatory effects of dietary intake of chitin on gilthead seabream (Sparus aurata L.) innate immune system. Fish Shellfish Immunol. 2001, 11, 303–315. [Google Scholar] [CrossRef] [Scilit]
- Koide, S. Chitin-chitosan: Properties, benefits and risks. Nutr. Res. 1998, 18, 1091–1101. [Google Scholar] [CrossRef] [Scilit]
- Xu, Y.; Shi, B.; Yan, S.; Li, T.; Guo, Y.; Li, J. Effects of chitosan on body weight gain, growth hormone. Asian Australas. J. Anim. Sci. 2013, 26, 1484. [Google Scholar] [CrossRef] [Scilit]
- De Marco, M.; Martínez, S.; Hernandez, F.; Madrid, J.; Gai, F.; Rotolo, L.; Belforti, M.; Bergero, D.; Katz, H.; Dabbou, S.; et al. Nutritional value of two insect larval meals (Tenebrio molitor and Hermetia illucens) for broiler chickens: Apparent nutrient digestibility, apparent ileal amino acid digestibility and apparent metabolizable energy. Anim. Feed Sci. Technol. 2015, 209, 208–211. [Google Scholar] [CrossRef] [Scilit]
- Schiavone, A.; De Marco, M.; Rotolo, L.; Belforti, M.; Martinez Mirò, S.; Madrid Sanchez, J.; Hernandez Ruiperez, F.; Bianchi, C.; Sterpone, L.; Malfatto, V.M. Nutrient digestibility of Hermetia illucens and Tenebrio molitor meal in broiler chickens. In Proceedings of the 1st International conference “Insects to Feed the World”, Wageningen, The Netherlands, 14–17 May 2014; p. 73. [Google Scholar]
- Benzertiha, A.; Kierończyk, B.; Kołodziejski, P.; Pruszyńska–Oszmałek, E.; Rawski, M.; Józefiak, D.; Józefiak, A. Tenebrio molitor and Zophobas morio full-fat meals as functional feed additives affect broiler chickens’ growth performance and immune system traits. Poult. Sci. 2019. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- National Research Council (N.R.C.). Nutrient Requirements of Poultry, 9th ed.; The National Academies Press: Washington, DC, USA, 1994; pp. 27, 63. [Google Scholar]
- Association of Official Analytical Chemists (AOAC). Official Methods of Analysis, 18th ed.; Association of Official Analytical Chemists: Arlington, VA, USA, 2005; ISBN 0-935584-77-3. [Google Scholar]
- Ptak, A.; Józefiak, D.; Kierończyk, B.; Rawski, M.; Żyła, K.; Świątkiewicz, S. Effect of different phytases on the performance, nutrient retention and tibia composition in broiler chickens. Arch. Anim. Breed. 2013, 56, 1028–1038. [Google Scholar] [CrossRef] [Scilit]
- Soon, C.Y.; Tee, Y.B.; Tan, C.H.; Rosnita, A.T.; Khalina, A. Extraction and physicochemical characterization of chitin and chitosan from Zophobas morio larvae in varying sodium hydroxide concentration. Int. J. Biol. Macromol. 2018, 108, 135–142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Myers, W.; Ludden, P.; Nayigihugu, V.; Hess, B. A procedure for the preparation and quantitative analysis of samples for titanium dioxide. J. Anim. Sci. 2004, 82, 179–183. [Google Scholar] [CrossRef] [Scilit]
- Short, F.; Gorton, P.; Wiseman, J.; Boorman, K. Determination of titanium dioxide added as an inert marker in chicken digestibility studies. Anim. Feed Sci. Technol. 1996, 59, 215–221. [Google Scholar] [CrossRef] [Scilit]
- Kaczmarek, S.; Hejdysz, M.; Kubiś, M.; Kasprowicz-Potocka, M.; Rutkowski, A. The nutritional value of yellow lupin (Lupinus luteus L.) for broilers. Anim. Feed Sci. Technol. 2016, 222, 43–53. [Google Scholar] [CrossRef] [Scilit]
- Pruszyńska-Oszmałek, E.; Kołodziejski, P.; Stadnicka, K.; Sassek, M.; Chałupka, D.; Kuston, B.; Nogowski, L.; Maćkowiak, P.; Maiorano, G.; Jankowski, J. In ovo injection of prebiotics and synbiotics affects the digestive potency of the pancreas in growing chickens. Poult. Sci. 2015, 94, 1909–1916. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fotschki, B.; Juśkiewicz, J.; Jurgoński, A.; Kołodziejczyk, K.; Milala, J.; Kosmala, M.; Zduńczyk, Z. Anthocyanins in strawberry polyphenolic extract enhance the beneficial effects of diets with fructooligosaccharides in the rat cecal environment. PLoS ONE 2016, 11, e0149081. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Juśkiewicz, J.; Zduńczyk, Z.; Jankowski, J. Effect of adding mannan-oligosaccharide to the diet on the performance, weight of digestive tract segments, and caecal digesta parameters in young turkeys. J. Anim. Feed Sci. 2003, 12, 133–142. [Google Scholar] [CrossRef] [Scilit]
- Józefiak, D.; Kierończyk, B.; Juśkiewicz, J.; Zduńczyk, Z.; Rawski, M.; Długosz, J.; Sip, A.; Højberg, O. Dietary nisin modulates the gastrointestinal microbial ecology and enhances growth performance of the broiler chickens. PLoS ONE 2013, 8, e85347. [Google Scholar] [CrossRef] [Scilit]
- Rawski, M.; Kierończyk, B.; Długosz, J.; Świątkiewicz, S.; Jozefiak, D. Dietary probiotics affect gastrointestinal microbiota, histological structure and shell mineralization in turtles. PLoS ONE 2016, 11, e0147859. [Google Scholar] [CrossRef] [Scilit]
- Manz, W.; Szewzyk, U.; Ericsson, P.; Amann, R.; Schleifer, K.; Stenström, T. In situ identification of bacteria in drinking water and adjoining biofilms by hybridization with 16S and 23S rRNA-directed fluorescent oligonucleotide probes. Appl. Environ. Microbiol. 1993, 59, 2293–2298. [Google Scholar]
- Fallani, M.; Rigottier-Gois, L.; Aguilera, M.; Bridonneau, C.; Collignon, A.; Edwards, C.A.; Corthier, G.; Doré, J. Clostridium difficile and Clostridium perfringens species detected in infant faecal microbiota using 16S rRNA targeted probes. J. Microbiol. Methods 2006, 67, 150–161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sghir, A.; Gramet, G.; Suau, A.; Rochet, V.; Pochart, P.; Dore, J. Quantification of bacterial groups within human fecal flora by oligonucleotide probe hybridization. Appl. Environ. Microbiol. 2000, 66, 2263–2266. [Google Scholar] [CrossRef] [Scilit]
- Harmsen, H.J.; Elfferich, P.; Schut, F.; Welling, G.W. A 16S rRNA-targeted probe for detection of lactobacilli and enterococci in faecal samples by fluorescent in situ hybridization. Microb. Ecol. Health Dis. 1999, 11, 3–12. [Google Scholar]
- Welling, G.W.; Wildeboer-Veloo, L.; Raangs, G.C.; Franks, A.H.; Jansen, G.J.; Tonk, R.H.; Degener, J.E.; Harmsen, H.J. Variations of bacterial populations in human faeces measured by FISH with group-specific 16S rRNA-targeted oligonucleotide probes. Biosci. Microflora 2000, 19, 79–84. [Google Scholar] [CrossRef] [Scilit]
- Sghir, A.; Antonopoulos, D.; Mackie, R.I. Design and evaluation of a Lactobacillus group-specific ribosomal RNA-targeted hybridization probe and its application to the study of intestinal microecology in pigs. Syst. Appl. Microbiol. 1998, 21, 291–296. [Google Scholar] [CrossRef] [Scilit]
- Forder, R.; Howarth, G.; Tivey, D.; Hughes, R. Bacterial Modulation of Small Intestinal Goblet Cells and Mucin Composition During Early Posthatch Development of Poultry1. Poult. Sci. 2007, 86, 2396–2403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sommer, F.; Bäckhed, F. The gut microbiota—Masters of host development and physiology. Nat. Rev. Microbiol. 2013, 11, 227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bovera, F.; Loponte, R.; Marono, S.; Piccolo, G.; Parisi, G.; Iaconisi, V.; Gasco, L.; Nizza, A. Use of Tenebrio molitor larvae meal as protein source in broiler diet: Effect on growth performance, nutrient digestibility, and carcass and meat traits. J. Anim. Sci. 2016, 94, 639–647. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Finke, M.D. Estimate of chitin in raw whole insects. Zoo Biol. 2007, 26, 105–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Józefiak, D.; Kierończyk, B.; Rawski, M.; Hejdysz, M.; Rutkowski, A.; Engberg, R.M.; Højberg, O. Clostridium perfringens challenge and dietary fat type affect broiler chicken performance and fermentation in the gastrointestinal tract. Animal 2014, 8, 912–922. [Google Scholar] [CrossRef] [Scilit]
- Józefiak, D.; Świątkiewicz, S.; Kierończyk, B.; Rawski, M.; Długosz, J.; Engberg, R.M.; Højberg, O. Clostridium perfringens challenge and dietary fat type modifies performance, microbiota composition and histomorphology of the broiler chicken gastrointestinal tract. Eur. Poult. Sci. 2016, 80. [Google Scholar]
- Falagas, M.E.; Siakavellas, E. Bacteroides, Prevotella, and Porphyromonas species: A review of antibiotic resistance and therapeutic options. Int. J. Antimicrob. Agents 2000, 15, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Engström, B.; Fermer, C.; Lindberg, A.; Saarinen, E.; Båverud, V.; Gunnarsson, A. Molecular typing of isolates of Clostridium perfringens from healthy and diseased poultry. Vet. Microbiol. 2003, 94, 225–235. [Google Scholar] [CrossRef] [Scilit]
- Immerseel, F.V.; Buck, J.D.; Pasmans, F.; Huyghebaert, G.; Haesebrouck, F.; Ducatelle, R. Clostridium perfringens in poultry: An emerging threat for animal and public health. Avian Pathol. 2004, 33, 537–549. [Google Scholar] [CrossRef] [Scilit]
- Keyburn, A.L.; Bannam, T.L.; Moore, R.J.; Rood, J.I. NetB, a pore-forming toxin from necrotic enteritis strains of Clostridium perfringens. Toxins 2010, 2, 1913–1927. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Juśkiewicz, J.; Gruzauskas, R.; Zduńczyk, Z.; Semaskaite, A.; Jankowski, J.; Totilas, Z.; Jarule, V.; Sasyte, V.; Zduńczyk, P.; Raceviciute-Stupeliene, A. Effects of dietary addition of Macleaya cordata alkaloid extract on growth performance, caecal indices and breast meat fatty acids profile in male broilers. J. Anim. Physiol. Anim. Nutr. 2011, 95, 171–178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zduńczyk, Z.; Juśkiewicz, J.; Jankowski, J.; Koncicki, A. Performance and caecal adaptation of turkeys to diets without or with antibiotic and with different levels of mannan-oligosaccharide. Arch. Anim. Nutr. 2004, 58, 367–378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Juśkiewicz, J.; Zduńczyk, Z.; Wróblewska, M. The effect of the administration of cellulose and fructans with different degree of polymerization to rats on caecal fermentation and biochemical indicators in the serum. Czech J. Anim. Sci. 2005, 50, 273–280. [Google Scholar] [CrossRef] [Scilit]
- Djouzi, Z.; Andiueux, C. Compared effects of three oligosaccharides on metabolism of intestinal microflora in rats inoculated with a human faecal flora. Br. J. Nutr. 1997, 78, 313–324. [Google Scholar] [CrossRef] [Scilit]
| Ingredients (%) | 1–14 Days | 15–35 Days |
|---|---|---|
| Wheat | 48.74 | 51.34 |
| Soybean meal | 20.78 | 16.95 |
| Rye | 10.00 | 10.00 |
| Rapeseed meal | 10.00 | 10.00 |
| Soybean oil | 4.99 | 7.11 |
| Fish meal | 2.00 | 2.00 |
| Monocalcium phosphate | 1.31 | 0.67 |
| Limestone | 0.8 | 0.68 |
| Vitamin–mineral premix a | 0.3 | 0.3 |
| Methionine 88% liquid | 0.31 | 0.25 |
| L–Lysine HCl | 0.29 | 0.24 |
| Sodium carbonate (Na2CO3) | 0.22 | 0.17 |
| L–Threonine | 0.15 | 0.16 |
| Salt (NaCl) | 0.11 | 0.13 |
| Titanium dioxide (TiO2) b | - | 0.2 |
| Calculated nutritive value (%) | ||
| Crude protein | 21.56 | 20.06 |
| Ether extract | 6.54 | 8.63 |
| Crude fiber | 3.31 | 3.22 |
| Calcium (Ca) | 0.85 | 0.70 |
| Total phosphorus (P) | 0.79 | 0.63 |
| Lysine | 1.25 | 1.12 |
| Methionine | 0.61 | 0.53 |
| Methionine + cysteine | 0.99 | 0.90 |
| Threonine | 0.91 | 0.86 |
| AMEN (MJ·kg−1) | 12.56 | 13.31 |
| Items | Tenebrio molitor | Zophobas morio |
|---|---|---|
| Dry matter (%) | 95.58 | 96.32 |
| Crude protein | 470 | 493 |
| Ether extract | 296 | 336 |
| Crude ash | 25.6 | 25.2 |
| Crude fiber | 56.0 | 51.0 |
| Chitin | 89.1 | 45.9 |
| Calcium | 0.5 | 0.5 |
| Phosphorus | 7.2 | 6.2 |
| Target | Probe | Sequence (5′ to 3′) | References |
|---|---|---|---|
| Bacteroides–Prevotella cluster | Bacto303 | CCAATGTGGGGGACCTT | [39] |
| Clostridium perfringens | Cperf191 | GTAGTAAGTTGGTTTCCTCG | [40] |
| Enterobacteriaceae | Enter1432 | CTTTTGCAACCCACT | [41] |
| Lactobacillus spp./Enterococcus spp. | Lab158 | GGTATTAGCAYCTGTTTCCA | [42] |
| Clostridium coccoides–Eubacterium rectale cluster | Erec482 | GCTTCTTAGTCARGTACCG | [43] |
| Clostridium leptum subgroup | Clept1240 | GTTTTRTCAACGGCAGTC | [44] |
| Items | Treatments | |||||||
|---|---|---|---|---|---|---|---|---|
| PC | NC | TM02 | ZM02 | TM03 | ZM03 | SEM | p-Value | |
| Coefficients of apparent ileal digestibility | ||||||||
| CP | 0.73 | 0.76 | 0.75 | 0.75 | 0.73 | 0.77 | 0.03 | 0.304 |
| EE | 0.92 | 0.94 | 0.94 | 0.94 | 0.93 | 0.94 | 0.01 | 0.092 |
| AMEN (MJ) | 10.64 | 12.05 | 11.95 | 12.04 | 11.37 | 11.87 | 0.91 | 0.140 |
| Activity of pancreatic enzymes | ||||||||
| Lipase | 100 | 88.33 | 93.23 | 91.12 | 87.13 | 88.33 | 32.431 | 0.958 |
| Amylase | 100 | 91.73 | 103.44 | 118.81 | 151.10 | 240.76 | 161.67 | 0.322 |
| Trypsin | 100 | 88.9 | 100.67 | 95.04 | 87.48 | 104.87 | 49.224 | 0.962 |
| Items | Treatments | |||||||
|---|---|---|---|---|---|---|---|---|
| PC | NC | TM02 | ZM02 | TM03 | ZM03 | SEM | p-Value | |
| Crop | 4.48 | 4.17 | 4.64 | 4.48 | 4.7 | 4.62 | 0.06 | 0.071 |
| Jejunum | 5.81 | 5.91 | 5.96 | 5.99 | 6.04 | 6.03 | 0.03 | 0.102 |
| Cecum | 5.81 | 6.11 | 6.17 | 6.07 | 6.08 | 6.05 | 0.07 | 0.802 |
| Items | Treatments | |||||||
|---|---|---|---|---|---|---|---|---|
| PC | NC | TM02 | ZM02 | TM03 | ZM03 | SEM | p-Value | |
| α_glucosidase | 14.53 ab | 10.99 c | 14.29 ab | 15.97 a | 19.10 a | 12.58 bc | 3.14 | 0.004 |
| β_glucosidase | 1.53 c | 1.89 bc | 2.45 ab | 3.22 a | 1.87 bc | 1.62 bc | 0.91 | 0.001 |
| α_galactosidase | 10.57 b | 7.36 b | 8.00 b | 15.09 a | 9.78 b | 9.46 b | 3.66 | <0.001 |
| β_galactosidase | 25.17 | 22.59 | 22.67 | 29.66 | 25.9 | 22.79 | 7.1 | 0.199 |
| β_glucuronidase | 3.01 c | 5.73 ab | 4.17 bc | 6.51 a | 4.23 bc | 5.14 ab | 2.13 | 0.009 |
| α_arabinopyranosidase | 0.84 c | 1.88 a | 1.07 bc | 1.66 ab | 1.59 ab | 0.67 c | 0.66 | <0.001 |
| β_xylosidase | 1.35 b | 1.71 b | 2.23 ab | 2.69 a | 1.84 ab | 1.35 b | 0.9 | 0.017 |
| Items | Treatments | |||||||
|---|---|---|---|---|---|---|---|---|
| PC | NC | TM02 | ZM02 | TM03 | ZM03 | SEM | p-Value | |
| SCFA concentration (µmol/g digesta) | ||||||||
| Acetic acid | 67.79 | 58.73 | 62.82 | 61.97 | 63.09 | 57.13 | 15.17 | 0.695 |
| Propionic acid | 7.09 | 5.49 | 5.44 | 5.5 | 5.36 | 4.8 | 1.79 | 0.071 |
| Butyric acid | 13.07 | 15.05 | 15.09 | 14.21 | 13.63 | 13.19 | 5.93 | 0.949 |
| Valeric acid | 1.25 | 0.96 | 1.12 | 1.02 | 1.07 | 0.92 | 0.4 | 0.497 |
| Iso-valeric acid | 0.62 | 0.48 | 0.59 | 0.55 | 0.55 | 0.58 | 0.22 | 0.803 |
| Iso-butyric acid | 0.58 | 0.36 | 0.4 | 0.42 | 0.42 | 0.4 | 0.21 | 0.249 |
| PSCFA | 2.44 | 1.8 | 2.11 | 1.99 | 2.03 | 1.89 | 0.67 | 0.359 |
| sum SCFA | 90.4 | 80.43 | 85.45 | 83.65 | 84.1 | 77 | 20.07 | 0.765 |
| SCFA profile (% of total SCFA) | ||||||||
| Acetic acid profile | 75.17 | 73.05 | 73.78 | 74.27 | 75.31 | 73.6 | 4.02 | 0.774 |
| Propionic acid profile | 7.87 | 6.61 | 6.61 | 6.53 | 6.45 | 7.22 | 2.56 | 0.793 |
| Butyric acid profile | 14.35 | 17.91 | 17.1 | 16.81 | 15.84 | 16.22 | 5.11 | 0.720 |
| Items | Treatments | |||||||
|---|---|---|---|---|---|---|---|---|
| PC | NC | TM02 | ZM02 | TM03 | ZM03 | SEM | p-Value | |
| Total number of bacteria | 10.24 | 10.16 | 10.19 | 10.19 | 10.22 | 10.15 | 0.07 | 0.254 |
| Bacteroides–Prevotella cluster | 9.52 a | 9.53 a | 9.45 ab | 9.26 c | 9.37 bc | 9.34 bc | 0.1 | 0.001 |
| Clostridium leptum subgroup | 9.32 | 9.22 | 9.29 | 9.22 | 9.36 | 9.32 | 0.16 | 0.648 |
| Clostridium perfringens | 9.4 ab | 9.37 b | 9.35 b | 9.31 b | 9.36 b | 9.54 a | 0.11 | 0.033 |
| Clostridium coccoides–Eubacterium rectale cluster | 9.41 | 9.31 | 9.39 | 9.4 | 9.46 | 9.39 | 0.13 | 0.663 |
| Lactobacillus spp./Enterococcus spp. | 9.38 | 9.34 | 9.33 | 9.29 | 9.34 | 9.46 | 0.14 | 0.543 |
| Enterobacteriaceae | 9.22 | 9.32 | 9.16 | 9.24 | 9.43 | 9.4 | 0.17 | 0.140 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Benzertiha, A.; Kierończyk, B.; Rawski, M.; Józefiak, A.; Kozłowski, K.; Jankowski, J.; Józefiak, D. Tenebrio molitor and Zophobas morio Full-Fat Meals in Broiler Chicken Diets: Effects on Nutrients Digestibility, Digestive Enzyme Activities, and Cecal Microbiome. Animals 2019, 9, 1128. https://doi.org/10.3390/ani9121128
Benzertiha A, Kierończyk B, Rawski M, Józefiak A, Kozłowski K, Jankowski J, Józefiak D. Tenebrio molitor and Zophobas morio Full-Fat Meals in Broiler Chicken Diets: Effects on Nutrients Digestibility, Digestive Enzyme Activities, and Cecal Microbiome. Animals. 2019; 9(12):1128. https://doi.org/10.3390/ani9121128
Chicago/Turabian StyleBenzertiha, Abdelbasset, Bartosz Kierończyk, Mateusz Rawski, Agata Józefiak, Krzysztof Kozłowski, Jan Jankowski, and Damian Józefiak. 2019. "Tenebrio molitor and Zophobas morio Full-Fat Meals in Broiler Chicken Diets: Effects on Nutrients Digestibility, Digestive Enzyme Activities, and Cecal Microbiome" Animals 9, no. 12: 1128. https://doi.org/10.3390/ani9121128
APA StyleBenzertiha, A., Kierończyk, B., Rawski, M., Józefiak, A., Kozłowski, K., Jankowski, J., & Józefiak, D. (2019). Tenebrio molitor and Zophobas morio Full-Fat Meals in Broiler Chicken Diets: Effects on Nutrients Digestibility, Digestive Enzyme Activities, and Cecal Microbiome. Animals, 9(12), 1128. https://doi.org/10.3390/ani9121128

