Next Article in Journal
First Detection of Trichinella pseudospiralis in the Genus Martes Within a Croatian Mustelid Survey
Next Article in Special Issue
Metabolomic Profiling Reveals Intestinal Metabolic Reprogramming in Chinese Tongue Sole (Cynoglossus semilaevis) Against Vibrio harveyi Infection
Previous Article in Journal
Breed-Specific Obstetric and Neonatal Parameters in Labrador Retrievers: Factors Influencing Early Neonatal Survival
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 16
Issue 4
10.3390/ani16040602
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of Forkhead Box Transcription Factor (foxl) in Sex Differentiation of Chinese Tongue Sole (Cynoglossus semilaevis)

by
Haipeng Yan
1,2,
Lijun Wang
1,2,
Xuexue Sun
1,2,
Mingyue He
2,
Yingming Yang
2,
Zhen Meng
2,
Xihong Li
2,
Na Wang
2,
Zhongdian Dong
1,2,* and
Wenteng Xu
1,2,*
1
Guangdong Provincial Key Laboratory of Aquatic Animal Disease Control and Healthy Culture, College of Fisheries, Guangdong Ocean University, Zhanjiang 524088, China
2
State Key Laboratory of Mariculture Biobreeding and Sustainable Goods, Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao Marine Science and Technology Center, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China
*
Authors to whom correspondence should be addressed.
Animals 2026, 16(4), 602; https://doi.org/10.3390/ani16040602
Submission received: 9 January 2026 / Revised: 6 February 2026 / Accepted: 11 February 2026 / Published: 14 February 2026
(This article belongs to the Special Issue Advances in Reproductive Physiology of Fish)
Browse Figures
Versions Notes

Simple Summary

Chinese tongue sole (Cynoglossus semilaevis) is a cold-water marine fish species in which females grow significantly faster than males. Identifying its key sex-related genes is of great practical significance for improving aquaculture yield. Studies have shown that members of the foxl gene family are closely associated with the hormone-regulated sex determination pathway in C. semilaevis, which provides a fundamental basis for research on sex differentiation and sex maintenance in this species.

Abstract

Chinese tongue sole (Cynoglossus semilaevis) is an important mariculture product in northern China, exhibiting significant sexual dimorphism: females grow 2–4 times faster than males and ultimately attain much greater body weights. As a well-known transcription factor crucial for regulating sex differentiation, foxl2 has been characterized in various mammals. Herein, we identified and characterized three foxl genes, foxl1, foxl2a and foxl2l. Three foxl genes exhibited a gonad-biased expression pattern, where foxl2a showed higher expression in ovary than in testis, while foxl1 and foxl2l exhibited higher expression in testis. All foxl genes were detected in testes and ovaries by ISH; foxl1/foxl2l were expressed in oocytes and sperm, and foxl2a in granulosa cells and sperm. Overexpression of foxl in testicular cells led to KEGG enrichment in DNA repair, MAPK, FOXO and progesterone-mediated oocyte maturation pathways. In tongue sole testicular cell line, knockdown of foxl1 and foxl2l resulted in upregulation of multiple male-related genes. In contrast, knockdown of foxl2a led to decreased expression of aromatase genes and increased expression of ctnnb1, indicating that foxl2a is more closely associated with female differentiation and maintenance. Our study investigated the functions of the foxl gene family in teleosts and offers valuable insights into their role in sex differentiation and gonadal maintenance in teleost fish.

1. Introduction

Chinese tongue sole (Cynoglossus semilaevis) is an economically important mariculture fish species in coastal areas of Northeast Asia, and a key marine economic fish in northern China. This species exhibits sexual dimorphism in growth rate: adult females are 2–4 times heavier than adult males [1]. Additionally, female-to-male sex reversal is observed in C. semilaevis [2].
The sex determination mechanisms of fish are versatile, encompassing various sexual phenotypes from hermaphroditism to gonochorism. Sex determination mechanisms are generally categorized into two major types: Genetic Sex Determination (GSD) and Environmental Sex Determination (ESD) [3]. In organisms with GSD, primary sex is determined during fertilization and regulated by heritable genetic elements. In contrast, organisms with ESD possess undifferentiated gonads until they reach a sensitive period, during which they perceive environmental cues to determine their sex. Some GSD species—primarily fish and reptiles—can alter their primary sex without changing their genotype when exposed to specific environmental factors; this process is termed Environmental Sex Reversal (ESR) [4]. Sex reversal is also a common phenomenon in fish. In recent years, with the advancement of molecular biology techniques, an increasing number of studies have focused on genes related to sex determination and differentiation in fish, including sox9, dmrt1, dax1, wt1, sf1, amh, tra2, foxl2, and aromatase genes.
The Forkhead box (FOX) transcription factor superfamily is an evolutionarily ancient family widely distributed in eukaryotes. All FOX proteins share an evolutionarily conserved DNA-binding domain. Members of this protein family regulate a series of critical biological processes during ontogeny, including development, proliferation, differentiation, and apoptosis. Typically, FOX transcription factors exert specific regulatory functions and exhibit tissue-specific and cell type-specific expression patterns [5].
As a key conserved factor orchestrating ovarian development and antagonizing testicular development in humans and mammals, Foxl2 cooperates with multiple pathways and genes. For instance, Foxl2 collaborates with the Wnt4/Rspo1/β-catenin pathway to promote female development in XX mice; ablation of both foxl2 and rspo1 leads to the masculinization of gonads in XX mice [6]. Foxl2 also interacts with Runx1 to maintain ovarian homeostasis and promote embryonic ovarian differentiation in mice; knockout (KO) of foxl2 results in the upregulation of sox9 and fgfr2 (genes that drive testicular development), impairing the ability of mice to maintain normal ovarian function [7,8]. In fish, Foxl2 cooperates with Nr5a1 to promote the activation of the aromatase cyp19a1a promoter, thereby facilitating female differentiation in rainbow trout (Oncorhynchus mykiss) [9].
In C. semilaevis, four foxl genes with intact Forkhead (FH) domains—foxl1, foxl2a, foxl2l, and foxl3—have been identified. Our previous transcriptome analysis revealed a female-biased expression pattern of foxl genes in the gonads of adult C. semilaevis. As important pioneer transcription factors, Foxl proteins play crucial roles in female sex determination and maintenance. In this study, we employed phylogenetic analysis, spatiotemporal expression profile analysis, RNA interference (RNAi), and overexpression assays. These data provide crucial insights into understanding female sex determination and maintenance in C. semilaevis.

2. Materials and Methods

2.1. Animal Euthanasia and Ethics Statement

In this study, fish were anesthetized with MS-222 (Sigma, Darmstadt, Germany) at a concentration of 120 mg/L to minimize suffering [10]. All experiments were conducted in adherence to the guidelines established by the Institutional Animal Care and Use Committee of the Yellow Sea Fisheries Research Institute (Approve No.: YSFRI-2022035).

2.2. Fish and Sample Collection

Fish samples were collected from the Haiyang Aquaculture Base (Haiyang, China). For genetic sex identification, amplification was performed using genomic DNA extracted via the alkaline lysis method, with pre-validated specific primers. Brains, pituitaries, gonads, kidneys, intestines, spleens, livers, muscles, gills, and hearts were dissected from four female and four male Cynoglossus semilaevis (tongue sole) aged 1.5 years. These tissues were immediately frozen in liquid nitrogen and subsequently stored at −80 °C. Total RNA was extracted from the tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), followed by reverse transcription into cDNA with HiScript IV All-in-One Ultra RT SuperMix for qPCR (Vazyme, Nanjing, China); the resulting cDNA was stored at −20 °C. Gonadal tissues were fixed in 4% paraformaldehyde (Solarbio, Beijing, China), incubated at 4 °C for 24 h, and then subjected to paraffin embedding and sectioning for in situ hybridization (ISH). All primers were synthesized by Sangon Biotech (Shanghai, China) (Table A1).

2.3. Sequence and Evolutionary Analysis

Full-length cDNA was synthesized using the First Strand cDNA Synthesis Kit ReverTra Ace-α (Toyobo, Osaka, Japan). The target fragments were amplified and cloned into the 5 min TA/Blunt-Zero Cloning Kit (Vazyme, Nanjing, China), and the recombinant plasmids were transformed into DH5α Chemically Competent Cells (Coolaber, Beijing, China). The positive clones were sent to Sangon Biotech (Shanghai, China) for Sanger sequencing. Notably, each gene was amplified from the gonads of three different individuals. To clarify the phylogenetic relationships of foxl genes in teleosts, foxl gene family sequences from various species were used. Multiple sequence alignment (MSA) of amino acid sequences was conducted using MAFFT (v7.505; Computational Biology Research Center, AIST, Tokyo, Japan) with default parameters. A phylogenetic tree was then constructed using the maximum likelihood method implemented in IQ-TREE 2 (v2.4.0; Center for Integrative Bioinformatics Vienna, Vienna, Austria). The tree file generated by IQ-TREE 2 was uploaded to iTOL (v5; European Molecular Biology Laboratory, Heidelberg, Germany) for visualization and customization. Conserved structural domains and motifs were characterized using the PFAM database and MEME program (v5.4.1; MEME Suite, National Institutes of Health, Bethesda, MA, USA), followed by visualization with TBtools (v2.142; South China Agricultural University, Guangzhou, China). Chromosomal positions of the sequences were retrieved from the NCBI database. The molecular masses (MWs) and theoretical isoelectric points (pIs) of the encoded proteins were predicted using ExPASy (https://web.expasy.org/protparam/; accessed on 19 June 2025).

2.4. Protein–Protein Interaction (PPI) Prediction

For selected members of the foxl gene family in C. semilaevis, potential interacting proteins were predicted using the STRING database (v12.0; European Molecular Biology Laboratory, Heidelberg, Germany) at a medium confidence score (0.40).

2.5. Quantitative Real-Time PCR (qPCR) Analysis

The primers used for qPCR are provided in the table below. qPCR reactions were performed using THUNDERBIRD™ Next SYBR qPCR Mix (Toyobo, Osaka, Japan) on a QuantGene 9600 instrument (Bioer Technology, Hangzhou, China). Amplification was carried out in a 20 μL reaction volume under the following conditions: initial denaturation at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 5 s and annealing/extension at 60 °C for 34 s. β-actin was used as the reference gene [11]. Quality control was performed via a single-peak melting curve. Experimental data were analyzed using the 2−ΔΔCt method and one-way analysis of variance (ANOVA) with GraphPad Prism (9.0.0.;Insightful Science, San Diego, CA, USA). A p-value < 0.05 was considered statistically significant.

2.6. In Situ Hybridization (ISH) Analysis

Primers containing T7 and SP6 promoter sequences were designed to amplify the probe sequences of foxl1, foxl2a, and foxl2l. For in vitro transcription, the T7 and SP6 promoters (Promega, Madison, WI, USA)were used to synthesize digoxigenin (DIG)-labeled probes with DIG-conjugated deoxyribonucleoside triphosphates (dNTPs; Sigma, Darmstadt, Germany). The synthesized probes were purified via lithium chloride (LiCl;Sigma, Darmstadt, Germany) precipitation, dissolved in diethyl pyrocarbonate (DEPC)-treated water, and stored at −80 °C. 5-Bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT; Beyotime, Shanghai, China) was used as the chromogenic substrate for signal development. Images were captured using a Nikon ECLIPSE 80i microscope (Nikon, Tokyo, Japan).

2.7. Cell Culture, siRNA Transfection, and Overexpression Assays

Testicular (CSTE) cells of C. semilaevis cryopreserved in liquid nitrogen in our laboratory were rapidly thawed in a 37 °C water bath [12]. Cells were collected by centrifugation at 1000× g for 5 min, then cultured in L15 basal medium (Solarbio, Beijing, China) supplemented with 20% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA), 1% penicillin-streptomycin-amphotericin B (Solarbio, Beijing, China), 14 mM β-mercaptoethanol (VWR, Radnor, PA, USA), epidermal growth factor (EGF; Beyotime, Shanghai, China) at 5 ng/mL, basic fibroblast growth factor (bFGF; Beyotime, Shanghai, China) at 5 ng/mL, and leukemia inhibitory factor (LIF; Beyotime, Shanghai, China) at 5 ng/mL. Cultures were maintained in a 24 °C constant-temperature incubator. When cell confluency reached >80%, cells were seeded into 12-well plates for subsequent experiments.
siRNAs targeting foxl1, foxl2a, and foxl2l were designed using DSIR (http://biodev.extra.cea.fr/DSIR/DSIR.html, accessed on 19 June 2025) and synthesized by Sangon Biotech. Ovarian cells of C. semilaevis were transfected with these siRNAs using the RiboFECT™ CP Transfection Kit (Ribobio, Guangzhou, China) according to the manufacturer’s instructions. Transfection efficiency was evaluated using Cy3-labeled siRNA (Ribobio, Guangzhou, China). At 48 h post-transfection, cells were harvested with TRIzol, and qPCR was performed to detect the expression of sex-related genes and foxl-associated genes.
The coding sequences (CDS) of foxl1, foxl2a, and foxl2l from C. semilaevis were cloned into the pcDNA3.1 vector carrying an mSc fluorescent tag using seamless cloning technology. Specifically, target CDS were amplified with primers containing pcDNA3.1 homology arms, then ligated into the Hind III-digested pcDNA3.1-mSc vector using TOROIVD® One Step Fusion Cloning Mix (TOROIVD, Shanghai, China). Recombinant plasmids were transfected into pre-seeded CSTE cells in 12-well plates using Lipo8000 (Beyotime, Shanghai, China). Fluorescence was observed 24 h later to evaluate overexpression efficiency. At 48 h post-transfection, cells were harvested with TRIzol, and qPCR was performed to detect the expression of sex-related genes and foxl-associated genes.

3. Results

3.1. Characterization of foxl Genes

The foxl gene family in C.semilaevis includes 5 genes: foxl1 (LOC103379784), foxl1 (LOC112487111), foxl2a, foxl2l, and foxl3. Among them, foxl1 (LOC112487111) lacks the functional FH domain. foxl1 (LOC103379784) encodes 299 amino acids with a predicted relative molecular mass of 32,985.28 Da and an isoelectric point of 9.86. foxl2a encodes 309 amino acids, with a predicted relative molecular mass of 34,602.1 Da and an isoelectric point of 9.24. foxl2l encodes 240 amino acids, with a predicted relative molecular mass of 22,547.52 Da and an isoelectric point of 9.01. foxl3 encodes 258 amino acids, with a predicted relative molecular mass of 29,490.22 Da and an isoelectric point of 8.62. (Table 1).

3.2. Phylogenetic Tree Analysis

Phylogenetic tree analysis showed that the foxl gene family of C. semilaevis clustered with that of teleosts, distinct from humans, mice, amphibians, and chondrichthyans. Conserved domain prediction revealed that all functionally complete foxl genes across species contain the typical FH domain. foxl1 and foxl3 are more structurally similar, while foxl2a is more evolutionarily conserved, suggesting it may play a more important role. (Figure 1)

3.3. Expression Pattern Analysis

To investigate the expression system of the foxl gene family in Cynoglossus semilaevis, qPCR was used to detect the mRNA abundance of the foxl gene family in 8 tissues of the species. The results showed that the foxl gene family exhibited a gonad-biased expression pattern, where foxl1 had high expression levels in the brain, gonads, and intestine, with significantly higher expression in male gonads than in female gonads; foxl2a showed significantly higher expression in female gonads than in male gonads; foxl2l had expression predominance in the gonads and kidney, and its expression in male gonads was significantly higher than that in female gonads. Quantitative analysis of gonads at different ages revealed that the expression levels of foxl gene family members gradually increased during gonadal development until full maturation, then decreased to a level maintaining gonadal function. (Figure 2).

3.4. In Situ Hybridization

In the ovaries of 1.5-year-post-hatching (yph) individuals, strong hybridization signals of foxl1, foxl2a, and foxl2l were detected, and hybridization signals were also observed in male gonads. This result is consistent with the qPCR data, indicating that these genes are significantly expressed in granulosa cells of ovarian tissues and in sperm of testicular tissues. (Figure 3). Sections hybridized with the sense probe failed to exhibit any staining signal (Figure A1).

3.5. Small RNA Interference in C. semilaevis Testicular Cells and Overexpression in Testicular Cells

Knockdown efficiency was considered reliable when transfection efficiency exceeded 90%. All siRNAs exhibited a knockdown efficiency greater than 50% compared to the negative control (Figure A2). Subsequently, qPCR was performed to detect the expression levels of genes related to sex determination, testicular development, and ovarian development. Following foxl1 knockdown, the expression levels of sox9, hsp70, hsp90, smad3b, wnt4, and nr0b1 were significantly decreased, while the expression levels of gsdf and wt1 were significantly increased; after foxl2a knockdown, the expression levels of smad3b, gata4, gsdf, cyp19a1a, and nr0b1 were significantly decreased, and the expression level of ctnnb1 was significantly increased; upon foxl2l knockdown, the expression levels of hsp70 and hsp90 were significantly decreased, while the expression levels of neurl3, sox9, wnt4, gsdf, wt1, and ctnnb1 were significantly increased (Figure 4A–C).
The pcDNA3.1 vector fused with the mSc fluorescent tag was used as the overexpression plasmid backbone. Overexpression in C. semilaevis testicular cells was considered effective when red fluorescence was observed. Compared to the mSc negative control, the detected foxl genes were overexpressed by more than 500-fold. In the overexpression groups, KEGG enrichment analysis showed that the three groups were all significantly enriched in pathways including the cell cycle, oocyte meiosis, MAPK signaling pathway, cytokine–cytokine receptor interaction, FOXO signaling pathway, homologous recombination, nucleotide excision repair, and progesterone-mediated oocyte maturation (Figure 4D–F). In the Venn diagram of differentially expressed genes (DEGs), a total of 975 common DEGs were detected among the three genes. Specifically, there were 144 unique DEGs for foxl1, 262 unique DEGs for foxl2a, and 531 unique DEGs for foxl2l. GO enrichment analysis of these unique DEGs demonstrated that the unique DEGs of foxl1 were mainly associated with DNA replication, transcription, cellular component and complex binding; those of foxl2a were related to signal regulation, cellular homeostasis and the activity of various complexes; and those of foxl2l were linked to cell/tissue development, cell migration, cell adhesion, chromatin alteration and metabolism (Figure A3).

3.6. Protein–Protein Interaction (PPI) Network Analysis

To better understand the functions and interaction relationships of foxl genes in C. semilaevis, PPI networks of foxl1 and foxl2 were constructed. Based on analysis using the STRING protein database, 21 proteins were found to interact with the foxl gene family. Proteins interacting with foxl1 are mainly involved in cell proliferation and DNA damage repair. Proteins interacting with foxl2 include transcription factors related to sex and gonad development (e.g., sox9, dmrt1), aromatase (cyp19a1), steroid synthesis-related nr0b1, Müllerian duct formation-related amh and amher, and Wnt pathway-related wnt4 and rspo1 (Figure 5).

4. Discussion

Foxl2, the first identified gene involved in maintaining ovarian function, was discovered by Crisponi in 2001 and is the earliest molecular marker associated with ovarian differentiation in vertebrates. Schmidt et al. confirmed in a mouse model that FOXL2 is crucial for the differentiation and functional maintenance of ovarian granulosa cells [13]. In this study, we identified four foxl gene family members with full-length Forkhead (FH) domains, namely foxl1, foxl2a, foxl2l, and foxl3. These genes encode proteins consisting of 258–309 amino acids. Bioinformatics predictions revealed that all foxl genes contain basic Arg/Lys residues in their DNA-binding domains, facilitating nuclear translocation to regulate transcription [14]. These bioinformatic similarities suggest that the foxl gene family may influence various physiological processes through common pathways. For example, in mice, Foxl1 can affect intestinal stem cell signaling via the Wnt pathway, while Foxl2 promotes ovarian differentiation and maintenance by cooperating with the Wnt/Rspo1/β-catenin pathway [15,16].
Phylogenetic tree analysis, along with structural predictions, showed that foxl1, foxl2a, foxl2l, and foxl3 of C. semilaevis cluster with those of other teleosts and all retain the typical FH domain, which is closely associated with the function of transcription factors. The FH domain of FOX proteins regulates the transcription of target genes by binding to the canonical Forkhead binding element (FBE) 5′-RYAAAYA-3′ (R = A or G, Y = C or T) [17].
In previous studies, members of the FOX protein family have exhibited distinct tissue-specific and cell-specific expression patterns. For instance, FOXC1 is an essential component of embryonic development in the brain, eyes, and skeleton. FOXC2, another member of the FOXC subfamily, is a key regulator of adipocyte metabolism, skeletal tissue development, lymphangiogenesis, and lung maturation [18]. FoxA transcription factors are critical regulators of tissue development, tissue function, and metabolism. In the mammary gland, FoxA1 contributes to the differentiation of luminal epithelial cells and cooperatively regulates hormonal responses to estrogen and androgens. In the liver and pancreas, FoxA transcription factors are key controllers of metabolism [19,20,21]. Our results showed that foxl1, foxl2a, and foxl2l of C. semilaevis all exhibit gonad-predominant expression. Within the gonads, foxl2a is more highly expressed in females than in males, while foxl1 and foxl2l show higher expression in males than in females—consistent with expression patterns observed in other species such as humans, mice, and medaka (Oryzias latipes). Consistent with previous studies, foxl2 is specifically highly expressed in granulosa cells that maintain ovarian homeostasis. In situ hybridization analysis revealed signals for all foxl genes in both ovarian and testicular tissues: foxl1 and foxl2l are distributed throughout oocytes, while foxl2a is exclusively expressed in granulosa cells, suggesting functional divergence among these genes.
To investigate the effects of foxl overexpression, we selected a C. semilaevis testicular cell line with weak endogenous foxl expression and transfected it with pcDNA3.1-foxls-mSc plasmids, resulting in a 500–2000-fold increase in foxl expression. KEGG enrichment analysis of all overexpression groups showed significant enrichment of pathways including the cell cycle, homologous recombination, and nucleotide excision repair—indicating a role for foxl in DNA double-strand break (DSB) repair pathways [22]. Enrichment of oocyte meiosis, MAPK signaling pathway, and FOXO signaling pathway suggests that foxl functions during sex determination in C. semilaevis. In mammals and birds, the MAPK pathway influences sex differentiation by regulating the proliferation of primordial germ cells (PGCs) [23,24,25]. In zebrafish (Danio rerio), a greater number of PGCs favors female development [26]. FOXO transcription factors in the FOXO signaling pathway have been shown to positively regulate male differentiation, testicular development, and spermatogenesis in C. semilaevis [27]. The progesterone-mediated oocyte maturation pathway is centered on the binding of progesterone to the progesterone receptor (PR); the resulting PR complex binds to gene regulatory regions to initiate the transcription of progesterone-responsive genes, a process essential for maintaining reproductive function and ovulation. Overexpression of foxls activated the enrichment of this pathway, suggesting that foxls not only function in maintaining female gonadal homeostasis but also participate in ovulation [28]. When we performed GO enrichment analysis on the specific DEGs after gene overexpression, the functions of the three foxl genes exhibited striking divergence. Foxl1 was associated with DNA replication, transcription, cellular components and complex binding, with a greater focus on nucleic acid regulation. Foxl2a was related to signal regulation, cellular homeostasis and the activity of various complexes, and was involved in the regulation of fibroblast migration —a process that may be associated with the proliferation and maintenance of granulosa cells. Foxl2l was linked to cell/tissue development, cell migration, cell adhesion, chromatin alteration and metabolism, which may be more closely correlated with spermatogenesis and germ cell migration.
To further explore the roles of foxl genes, we used RNA interference (RNAi) to downregulate foxl expression in testicular cells and selected key partners involved in sex differentiation, sex determination, or sex-related processes for analysis. The transcription factor SOX9 is a key factor in Sertoli cell differentiation and is necessary and sufficient for testicular development and male differentiation in mice and humans [29,30]. In zebrafish, ectopic expression of sox9 induces oocyte apoptosis and ovarian-to-testicular reversal [31]. During early sex determination, the dominant expression of β-catenin and sox9 is fundamental to mouse sex determination, with Wnt4 and Rspo1 cooperatively promoting β-catenin activation to regulate early mouse sex determination through functional redundancy [32,33]. In zebrafish, wnt4a mutants exhibit reproductive duct developmental defects in both females and males, leading to failure in gamete release [34]. Cyp19 is an enzyme present in all vertebrates that plays a crucial role in gonadal maturation and serves as a key rate-limiting enzyme for estradiol-17β (E2) synthesis. In zebrafish, cyp19a1a−/− mutants develop as males regardless of genotype [35,36]. Nr0b1 encodes DAX1, a vertebrate-specific orphan nuclear receptor. In mice, overexpression of nr0b1 delays testicular development [37], while in zebrafish, nr0b1 mutations reduce germ cell numbers and cause somatic differentiation abnormalities, leading to partial sex reversal [38]. The zinc finger transcription factor WT1 is critical for Sertoli cell differentiation and pre-granulosa cell differentiation in mice. In medaka, WT1 regulates the sex-determining gene dmy and plays an important role in PGC maintenance [39,40]. Gsdf, a member of the TGF-β superfamily, is activated by Dmrt1 in Carassius gibelio; loss of all gsdf copies induces male-to-female sex reversal in this species, and gsdf knockout results in female sterility in Nile tilapia (Oreochromis niloticus) [41,42]. Heat shock proteins Hsp90 and Hsp70 can form complexes with PR, maintaining PR in a conformation permissive for progesterone binding, protecting PR from degradation, and sustaining PR levels to ensure normal female reproductive function [43]. Smad3, a key transcription factor for FSH synthesis, cooperates with Foxl2 to promote FSH production. Functional knockout of smad3 in mice leads to female sterility and reduced male reproductive function. In Monopterus albus, smad3 expression significantly increases during early vitellogenesis in the ovary and decreases as oocytes mature [44,45]. Gata4, an important transcription factor required for male gonadal development, is essential for male gonadal differentiation and dmrt1 expression; Gata4 can also form a transcriptional complex with Fog2 to promote male gonadal differentiation [46]. In C. semilaevis, gata4 exhibits sexual dimorphism in the gonads [47,48]. Neurl3 was previously found to be associated with spermatogenesis in C. semilaevis, with knockdown of neurl3 reducing sperm count [49].
Downregulation of foxl2a resulted in decreased expression of hormone-related genes such as cyp19a1a, smad3b, nr0b1, and gsdf, suggesting that foxl2a, as a transcription factor, may regulate hormone expression in C. semilaevis to influence sex differentiation and maintenance. The concurrent increase in ctnnb1 expression may represent a compensatory response of the β-catenin pathway to reduced foxl2a levels. For foxl1 and foxl2l—genes highly expressed in male gonads—knockdown led to decreased expression of hsp70 and hsp90, which may indirectly affect PR levels and thereby impact sex determination and maintenance in C. semilaevis. Additionally, knockdown of foxl1 and foxl2l resulted in increased expression of genes associated with male differentiation and maintenance, including neurl3, sox9, gsdf, and wt1, indicating that foxl1 and foxl2l are more closely involved in male differentiation and maintenance.

5. Conclusions

In summary, we identified four foxl genes with intact Forkhead (FH) domains, analyzed their evolutionary lineages, and predicted their conserved structural domains as well as protein–protein interaction partners. We employed qPCR to investigate their spatiotemporal expression patterns across 8 tissues and their expression levels in gonads at different developmental stages, followed by in situ hybridization to visualize their distribution in male and female gonads. Overexpression and knockdown assays in testicular cell lines demonstrated that foxl genes are closely associated with non-homologous end joining (NHEJ)-mediated DNA double-strand break (DSB) repair and steroid-related signal transduction, which is highly consistent with their roles in mammals. Collectively, our study provides a preliminary exploration of the functions of the foxl gene family in teleosts and offers valuable insights into the involvement of foxl genes in sex differentiation and gonadal maintenance in teleost fish.

Author Contributions

Conceptualization, H.Y., Z.D. and W.X.; Methodology, M.H.; Validation, H.Y., L.W. and X.S.; Formal analysis, L.W. and X.S.; Resources, Y.Y., Z.M., X.L., N.W., Z.D. and W.X.; Data curation, H.Y., L.W. and M.H.; Writing—original draft preparation, H.Y.; Writing—review and editing, H.Y., Z.M., N.W., Z.D. and W.X.; Visualization, Y.Y., X.L. and N.W.; Supervision, Y.Y., Z.M., X.L. and N.W.; Project administration, X.S. and M.H.; Funding acquisition, Z.D. and W.X. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key Research and Development Program of China (2022YFD2400401),Taishan Scholars Program (tsqn202408298), and the Central Public Interest Scientific Institute Basal Research Fund, CAFS (2023TD20).

Institutional Review Board Statement

The animal experiment was inspected and approved by the Institutional Animal Care and Use Committee at the Yellow Sea Fisheries Research Institute, CAFS (Approval No.:YSFRI-2022035; Date: 2 July 2022).

Informed Consent Statement

Not applicable.

Data Availability Statement

Transcriptome data have been deposited in the SRA database with the accession number PRJNA1408117.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Abbreviations

The following abbreviations are used in this manuscript:
BBrain
SPSpleen
GGonadal
MMuscle
HHeart
LLiver
KKidney
INIntestine

Appendix A

Animals 16 00602 g0a1
Figure A1. Sense probe negative controls for in situ hybridization of foxl1, foxl2a and foxl2l in gonads of 1.5-year-old Cynoglossus semilaevis (A) foxl1 sense probe in ovary; (B) foxl2a sense probe in ovary; (C) foxl2l sense probe in ovary; (D) foxl1 sense probe in testis; (E) foxl2a sense probe in testis; (F) foxl2l sense probe in testis. Note: No specific blue-purple precipitate was detected in all sense probe controls.
Figure A1. Sense probe negative controls for in situ hybridization of foxl1, foxl2a and foxl2l in gonads of 1.5-year-old Cynoglossus semilaevis (A) foxl1 sense probe in ovary; (B) foxl2a sense probe in ovary; (C) foxl2l sense probe in ovary; (D) foxl1 sense probe in testis; (E) foxl2a sense probe in testis; (F) foxl2l sense probe in testis. Note: No specific blue-purple precipitate was detected in all sense probe controls.
Animals 16 00602 g0a1
Animals 16 00602 g0a2
Figure A2. Quantitative analysis of foxl gene knockdown efficiency in Cynoglossus semilaevis testicular cell line. (A) foxl1; (B) foxl2a; (C) foxl2l. * indicates p < 0.05.
Figure A2. Quantitative analysis of foxl gene knockdown efficiency in Cynoglossus semilaevis testicular cell line. (A) foxl1; (B) foxl2a; (C) foxl2l. * indicates p < 0.05.
Animals 16 00602 g0a2
Animals 16 00602 g0a3
Figure A3. Venn diagram of differentially expressed genes (DEGs) in overexpression groups and GO enrichment analysis of DEGs in the least overlapping regions of the three genes. (A) Venn diagram of DEGs in overexpression groups; (B) GO enrichment analysis of DEGs in the least overlapping region of foxl1; (C) GO enrichment analysis of DEGs in the least overlapping region of foxl2a; (D) GO enrichment analysis of DEGs in the least overlapping region of foxl2l.
Figure A3. Venn diagram of differentially expressed genes (DEGs) in overexpression groups and GO enrichment analysis of DEGs in the least overlapping regions of the three genes. (A) Venn diagram of DEGs in overexpression groups; (B) GO enrichment analysis of DEGs in the least overlapping region of foxl1; (C) GO enrichment analysis of DEGs in the least overlapping region of foxl2a; (D) GO enrichment analysis of DEGs in the least overlapping region of foxl2l.
Animals 16 00602 g0a3
Table A1. Primers used in this study.
Table A1. Primers used in this study.
PrimerSequence(5′ to 3′)
sex-,CCTAAATGATGGATGTAGATTCTGTCSex identification
sex-rGATCCAGAGAAAATAAACCCAGG
foxl1-LOC103379784-fCATCACCGGCCTTCATGACT
foxl1-LOC103379784-rACACTTCCACTTCCGTCTGG
foxl2a-cds-fTTTGGTGCACGTGATGATGGCds
foxl2a-cds-rGGGAGACTTTTCTTTGGCAAACT
foxl2l-cds-fACATATGTGCCATGGACGCT
foxl2l-cds-rTGTGAACTGGCTGTTAATGCTG
foxl1-qpcr-fTGTGAACTGGCTGTTAATGCTGQpcr
foxl1-qpcr-rACATGTCCAGACACCGTTGG
foxl2a-qpcr-fCCGCTCCGATATCCTACACG
foxl2a-qpcr-rCCGGATGGTGATGGTGACTC
foxl2l-qpcr-fCCACCGTACCTTCTATCCGC
foxl2l-qpcr-rTTCCACTGAAGGAACAGCCG
neurl3-qpcr-fGCTGTAGGAGACATGGTCCG
neurl3-qpcr-rCAGAGGACGGCTGCTAAACA
wnt4-qpcr-fACATGTGAGCGGTTACGAGG
wnt4-qpcr-rCACTTTGCCAAACACAGGCA
nr0b1-qpcr-fTGTCCGTGGTGGAAATCGAG
nr0b1-qpcr-rTGGATGTAGTGCAGACAGCG
smad3b-qpcr-fGTGAGACCAGTGACCACCAG
smad3b-qpcr-rCCAGAAGGCCGATTCACAGT
hsp90-qpcr-fGGAGCACGACCATGACAAGT
hsp90-qpcr-rGATCCTCCCAGTCGTTGGTC
hsp70-qpcr-fAGGGACTCTGGACGTGTCTT
hsp70-qpcr-rCTGGTTTGGACGGTCAGGTT
gsdf-qpcr-fGGCGCCTTGTCTGACAGAA
gsdf-qpcr-rGCACAATGCACACTGGACA
cyp19-qpcr-fTGCAGGTTCTGGAGACCTTC
cyp19-qpcr-rGGTTTGCAGAACAGGTCCG
sox9-qpcr-fGTCCGTTTGTAGAGGAGGCA
sox9-qpcr-rGCCCATACTGGACGCAG
wt1-qpcr-f ACTTCTCAGGCCAGTTCACG
wt1-qpcr-rGACAGGTACGTTCCACTGGG
gata4-qpcr-fCGGTGTCCTCCTACAACCAC
gata4-qpcr-rCTGCCGTTCGTAGGGATGTT
ctnnb-qpcr-fTTTGTGCCCTACGTCACCTC
ctnnb-qpcr-rATGAGTGGCCAGTGTGATGG
β-actin-qpcr-fTTCCAGCCTTCCTTCCTT
β-actin-qpcr-rTTCCAGCCTTCCTTCCTT
foxl1-si-fGGUGUCUGGACAUGUUCGA/dT/dTSirna
foxl1-si-rUCGAACAUGUCCAGACACC/dT/dT
foxl2a-si-fGUGAAGACAUGUUCGAGAA/dT//dT/
foxl2a-si-rUUCUCGAACAUGUCUUCAC/dT//dT/
foxl2l-si-fCUAUGAGAAGAAUAAGAAA/dT/dT
foxl2l-si-rUUUCUUAUUCUUCUCAUAG/dT/dT
ish-foxl1-sp6ATTTAGGTGACACTATAGAAAGAACTCCATCCGCCAIsh
ish-foxl1-t7TAATACGACTCACTATAGGGCGCTTCCTCCTCATCC
ish-foxl2a-sp6ATTTAGGTGACACTATAGAACGCAGAGGGTGACGAA
ish-foxl2a-t7TAATACGACTCACTATAGGGAGGCGGGGACAGGTAG
ish-foxl2l-sp6ATTTAGGTGACACTATAGAAGGCGAGTCAGGGAGGA
ish-foxl2l-t7TAATACGACTCACTATAGGGAGGGCGGCAGGTAGAA
foxl1-oe-f GCTAGCGTTTAAACTTAAGCTTATGACTCTCTACACCCGCOver expression
foxl1-oe-rAGGATCCCATTGTACCAAGCTTGGTGAGAGCGGAGCGGGA
foxl2a-oe-fGCTAGCGTTTAAACTTAAGCTTATGATGGCGGCTTACCGG
foxl2a-oe-rAGGATCCCATTGTACCAAGCTTAATATCAATCCTCGTGTG
foxl2l-oe-fGCTAGCGTTTAAACTTAAGCTTATGGACGCTAAGCCCCAG
foxl2l-oe-rAGGATCCCATTGTACCAAGCTTATGGTCAAATGAATGGAG

References

  1. Wang, P.; Zheng, M.; Liu, J.; Liu, Y.; Lu, J.; Sun, X. Sexually Dimorphic Gene Expression Associated with Growth and Reproduction of Tongue Sole (Cynoglossus semilaevis) Revealed by Brain Transcriptome Analysis. Int. J. Mol. Sci. 2016, 17, 1402. [Google Scholar] [CrossRef]
  2. Wang, Q.; Liu, K.; Feng, B.; Zhang, Z.; Wang, R.; Tang, L.; Li, W.; Li, Q.; Piferrer, F.; Shao, C. Transcriptome of Gonads From High Temperature Induced Sex Reversal During Sex Determination and Differentiation in Chinese Tongue Sole, Cynoglossus semilaevis. Front. Genet. 2019, 10, 1128. [Google Scholar] [CrossRef]
  3. Bachtrog, D.; Mank, J.E.; Peichel, C.L.; Kirkpatrick, M.; Otto, S.P.; Ashman, T.-L.; Hahn, M.W.; Kitano, J.; Mayrose, I.; Ming, R.; et al. Sex determination: Why so many ways of doing it? PLoS Biol. 2014, 12, e1001899. [Google Scholar] [CrossRef]
  4. Nagahama, Y.; Chakraborty, T.; Paul-Prasanth, B.; Ohta, K.; Nakamura, M. Sex Determination, Gonadal Sex Differentiation and Plasticity in Vertebrate Species. Physiol. Rev. 2020, 101, 1237–1308. [Google Scholar] [CrossRef]
  5. Katoh, M.; Katoh, M. Human FOX gene family (Review). Int. J. Oncol. 2004, 25, 1495–1500. [Google Scholar] [CrossRef] [PubMed]
  6. Auguste, A.; Chassot, A.A.; Grégoire, E.P.; Renault, L.; Pannetier, M.; Treier, M.; Pailhoux, E.; Chaboissier, M.C. Loss of R-spondin1 and Foxl2 amplifies female-to-male sex reversal in XX mice. Sex. Dev. 2011, 5, 304–317. [Google Scholar] [CrossRef] [PubMed]
  7. Nicol, B.; Grimm, S.A.; Chalmel, F.; Lecluze, E.; Pannetier, M.; Pailhoux, E.; Dupin-De-Beyssat, E.; Guiguen, Y.; Capel, B.; Yao, H.H. RUNX1 maintains the identity of the fetal ovary through an interplay with FOXL2. Nat. Commun. 2019, 10, 5116. [Google Scholar] [CrossRef] [PubMed]
  8. Bagheri-Fam, S.; Bird, A.D.; Zhao, L.; Ryan, J.M.; Yong, M.; Wilhelm, D.; Koopman, P.; Eswarakumar, V.P.; Harley, V.R. Testis Determination Requires a Specific FGFR2 Isoform to Repress FOXL2. Endocrinology 2017, 158, 3832–3843. [Google Scholar] [CrossRef]
  9. Bertho, S.; Herpin, A.; Branthonne, A.; Jouanno, E.; Yano, A.; Nicol, B.; Muller, T.; Pannetier, M.; Pailhoux, E.; Miwa, M.; et al. The unusual rainbow trout sex determination gene hijacked the canonical vertebrate gonadal differentiation pathway. Proc. Natl. Acad. Sci. USA 2018, 115, 12781–12786. [Google Scholar] [CrossRef]
  10. Sun, X.; Chen, Y.; Li, T.; Li, C.; Gao, L.; Ma, D. Anesthetic Effect of MS-222 on Half-Smooth Tongue Sole (Cynoglossus semilaevis) and Its Elimination Regularity in Vivo. Fish. Sci. Technol. Inf. 2017, 44, 87–90. [Google Scholar]
  11. Li, Z.; Yang, L.; Wang, J.; Shi, W.; Pawar, R.A.; Liu, Y.; Xu, C.; Cong, W.; Hu, Q.; Lu, T.; et al. beta-Actin is a useful internal control for tissue-specific gene expression studies using quantitative real-time PCR in the half-smooth tongue sole (Cynoglossus semilaevis) challenged with LPS or Vibrio anguillarum. Fish Shellfish Immunol. 2010, 29, 89–93. [Google Scholar] [CrossRef]
  12. Zhang, B.; Wang, X.; Sha, Z.; Yang, C.; Liu, S.; Wang, N.; Chen, S.L. Establishment and characterization of a testicular cell line from the half-smooth tongue sole, Cynoglossus semilaevis. Int. J. Biol. Sci. 2011, 7, 452–459. [Google Scholar] [CrossRef] [PubMed]
  13. Schmidt, D.; Ovitt, C.E.; Anlag, K.; Fehsenfeld, S.; Gredsted, L.; Treier, A.C.; Treier, M. The murine winged-helix transcription factor Foxl2 is required for granulosa cell differentiation and ovary maintenance. Development 2004, 131, 933–942. [Google Scholar] [CrossRef] [PubMed]
  14. Migale, R.; Neumann, M.; Mitter, R.; Rafiee, M.R.; Wood, S.; Olsen, J.; Badge, R.L. FOXL2 interaction with different binding partners regulates the dynamics of ovarian development. Sci. Adv. 2024, 10, eadl0788. [Google Scholar] [CrossRef] [PubMed]
  15. Elzaiat, M.; Todeschini, A.L.; Caburet, S.; Veitia, R.A. The genetic make-up of ovarian development and function: The focus on the transcription factor FOXL2. Clin. Genet. 2017, 91, 173–182. [Google Scholar] [CrossRef]
  16. Perreault, N.; Katz, J.P.; Sackett, S.D.; Kaestner, K.H. Foxl1 controls the Wnt/beta-catenin pathway by modulating the expression of proteoglycans in the gut. J. Biol. Chem. 2001, 276, 43328–43333. [Google Scholar] [CrossRef]
  17. Choi, Y.; Luo, Y.; Lee, S.; Jin, H.; Yoon, H.J.; Hahn, Y.; Bae, J.; Lee, H.H. FOXL2 and FOXA1 cooperatively assemble on the TP53 promoter in alternative dimer configurations. Nucleic Acids Res. 2022, 50, 8929–8946. [Google Scholar] [CrossRef]
  18. Chen, X.; Wei, H.; Li, J.; Liang, X.; Dai, S.; Jiang, L.; Guo, M.; Qu, L.; Chen, Z.; Chen, L.; et al. Structural basis for DNA recognition by FOXC2. Nucleic Acids Res. 2019, 47, 3752–3764. [Google Scholar] [CrossRef]
  19. Slebe, F.; Rojo, F.; Vinaixa, M.; García-Rocha, M.; Testoni, G.; Guiu, M.; Planet, E.; Samino, S.; Arenas, E.J.; Beltran, A.; et al. FoxA and LIPG endothelial lipase control the uptake of extracellular lipids for breast cancer growth. Nat. Commun. 2016, 7, 11199. [Google Scholar] [CrossRef]
  20. Kaestner, K.H. The FoxA factors in organogenesis and differentiation. Curr. Opin. Genet. Dev. 2010, 20, 527–532. [Google Scholar] [CrossRef]
  21. Friedman, J.R.; Kaestner, K.H. The Foxa family of transcription factors in development and metabolism. Cell. Mol. Life Sci. 2006, 63, 2317–2328. [Google Scholar] [CrossRef]
  22. Jin, H.; Lee, B.; Luo, Y.; Choi, Y.; Choi, E.H.; Jin, H.; Kim, K.-B.; Seo, S.B.; Kim, Y.-H.; Lee, H.H.; et al. FOXL2 directs DNA double-strand break repair pathways by differentially interacting with Ku. Nat. Commun. 2020, 11, 2010. [Google Scholar] [CrossRef] [PubMed]
  23. Choi, J.W.; Kim, S.; Kim, T.M.; Kim, Y.M.; Seo, H.W.; Park, T.S.; Jeong, J.W.; Song, G.; Han, J.Y. Basic fibroblast growth factor activates MEK/ERK cell signaling pathway and stimulates the proliferation of chicken primordial germ cells. PLoS ONE 2010, 5, e12968. [Google Scholar] [CrossRef] [PubMed]
  24. Bogani, D.; Siggers, P.; Brixey, R.; Warr, N.; Beddow, S.; Edwards, J.; Williams, D.; Wilhelm, D.; Koopman, P.; Flavell, R.A.; et al. Loss of mitogen-activated protein kinase kinase kinase 4 (MAP3K4) reveals a requirement for MAPK signalling in mouse sex determination. PLoS Biol. 2009, 7, e1000196. [Google Scholar] [CrossRef] [PubMed]
  25. Tang, X.; Zhang, C. Activation of protein kinases A and C promoted proliferation of chicken primordial germ cells. Anim. Reprod. Sci. 2007, 101, 295–303. [Google Scholar] [CrossRef]
  26. Ye, D.; Zhu, L.; Zhang, Q.; Xiong, F.; Wang, H.; Wang, X.; He, M.; Zhu, Z.; Sun, Y. Abundance of Early Embryonic Primordial Germ Cells Promotes Zebrafish Female Differentiation as Revealed by Lifetime Labeling of Germline. Mar. Biotechnol. 2019, 21, 217–228. [Google Scholar] [CrossRef]
  27. Zhang, T.; Zhang, M.; Sun, Y.; Li, L.; Cheng, P.; Li, X.; Wang, N.; Chen, S.; Xu, W. Identification and Functional Analysis of foxo Genes in Chinese Tongue Sole (Cynoglossus semilaevis). Int. J. Mol. Sci. 2023, 24, 7625. [Google Scholar] [CrossRef]
  28. Jacobsen, B.M.; Horwitz, K.B. Progesterone receptors, their isoforms and progesterone regulated transcription. Mol. Cell. Endocrinol. 2012, 357, 18–29. [Google Scholar] [CrossRef]
  29. da Silva, S.M.; Hacker, A.; Harley, V.; Goodfellow, P.; Swain, A.; Lovell-Badge, R. Sox9 expression during gonadal development implies a conserved role for the gene in testis differentiation in mammals and birds. Nat. Genet. 1996, 14, 62–68. [Google Scholar] [CrossRef]
  30. Vidal, V.P.; Chaboissier, M.C.; de Rooij, D.G.; Schedl, A. Sox9 induces testis development in XX transgenic mice. Nat. Genet. 2001, 28, 216–217. [Google Scholar] [CrossRef]
  31. Sun, D.; Zhang, Y.; Wang, C.; Hua, X.; Zhang, X.A.; Yan, J. Sox9-related signaling controls zebrafish juvenile ovary–testis transformation. Cell Death Dis. 2013, 4, e930. [Google Scholar] [CrossRef][Green Version]
  32. Mayère, C.; Regard, V.; Perea-Gomez, A.; Bunce, C.; Neirijnck, Y.; Djari, C.; Bellido-Carreras, N.; Sararols, P.; Reeves, R.; Greenaway, S.; et al. Origin, specification and differentiation of a rare supporting-like lineage in the developing mouse gonad. Sci. Adv. 2022, 8, eabm0972. [Google Scholar] [CrossRef]
  33. Chassot, A.-A.; Ranc, F.; Gregoire, E.P.; Roepers-Gajadien, H.L.; Taketo, M.M.; Camerino, G.; de Rooij, D.G.; Schedl, A.; Chaboissier, M.-C. Activation of β-catenin signaling by Rspo1 controls differentiation of the mammalian ovary. Hum. Mol. Genet. 2008, 17, 1264–1277. [Google Scholar] [CrossRef] [PubMed]
  34. Kossack, M.E.; High, S.K.; Hopton, R.E.; Yan, Y.L.; Postlethwait, J.H.; Draper, B.W. Female Sex Development and Reproductive Duct Formation Depend on Wnt4a in Zebrafish. Genetics 2019, 211, 219–233. [Google Scholar] [CrossRef]
  35. Simpson, E.R.; Davis, S.R. Minireview: Aromatase and the regulation of estrogen biosynthesis--some new perspectives. Endocrinology 2001, 142, 4589–4594. [Google Scholar] [CrossRef]
  36. Yin, Y.; Tang, H.; Liu, Y.; Chen, Y.; Li, G.; Liu, X.; Lin, H. Targeted Disruption of Aromatase Reveals Dual Functions of cyp19a1a During Sex Differentiation in Zebrafish. Endocrinology 2017, 158, 3030–3041. [Google Scholar] [CrossRef]
  37. Nagahama, Y. Overview: Molecular mechanisms of sex determination and differentiation in animals--generality and diversity. Tanpakushitsu Kakusan Koso 2004, 49, 97–101. [Google Scholar]
  38. Chen, S.; Zhang, H.; Wang, F.; Zhang, W.; Peng, G. nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation. Mol. Cell. Endocrinol. 2016, 433, 105–116. [Google Scholar] [CrossRef] [PubMed]
  39. Klüver, N.; Herpin, A.; Braasch, I.; Drieβle, J.; Schartl, M. Regulatory back-up circuit of medaka Wt1 co-orthologs ensures PGC maintenance. Dev. Biol. 2008, 325, 179–188. [Google Scholar] [CrossRef] [PubMed]
  40. Chakraborty, T.; Zhou, L.Y.; Chaudhari, A.; Iguchi, T.; Nagahama, Y. Dmy initiates masculinity by altering Gsdf/Sox9a2/Rspo1 expression in medaka (Oryzias latipes). Sci. Rep. 2016, 6, 19480. [Google Scholar] [CrossRef]
  41. Wang, M.T.; Li, Z.; Ding, M.; Yao, T.Z.; Yang, S.; Zhang, X.J.; Miao, C.; Du, W.X.; Shi, Q.; Li, S.; et al. Two duplicated gsdf homeologs cooperatively regulate male differentiation by inhibiting cyp19a1a transcription in a hexaploid fish. PLoS Genet. 2022, 18, e1010288. [Google Scholar] [CrossRef]
  42. Jiang, D.N.; Peng, Y.X.; Liu, X.Y.; Mustapha, U.F.; Huang, Y.Q.; Shi, H.J.; Li, M.H.; Li, G.L.; Wang, D.S. Homozygous Mutation of gsdf Causes Infertility in Female Nile Tilapia (Oreochromis niloticus). Front. Endocrinol. 2022, 13, 813320. [Google Scholar] [CrossRef]
  43. Kosano, H.; Stensgard, B.; Charlesworth, M.C.; McMahon, N.; Toft, D. The assembly of progesterone receptor-hsp90 complexes using purified proteins. J. Biol. Chem. 1998, 273, 32973–32979. [Google Scholar] [CrossRef]
  44. Li, Y.; Schang, G.; Boehm, U.; Deng, C.X.; Graff, J.; Bernard, D.J. SMAD3 Regulates Follicle-stimulating Hormone Synthesis by Pituitary Gonadotrope Cells in Vivo. J. Biol. Chem. 2017, 292, 2301–2314. [Google Scholar] [CrossRef]
  45. He, Z.; Wang, H.; Zheng, L.; Chen, Q.; Xiong, J.; Chen, M.; Ding, W.; Huang, J.; Gao, K.; Lai, B.; et al. Possible involvement of Jun, Foxo1, Nobox in the regulation of smad2/3 transcription in the protogynous hermaphroditic ricefield eel (Monopterus albus). Aquac. Rep. 2024, 39, 102465. [Google Scholar] [CrossRef]
  46. Manuylov, N.L.; Zhou, B.; Ma, Q.; Fox, S.C.; Pu, W.T.; Tevosian, S.G. Conditional ablation of Gata4 and Fog2 genes in mice reveals their distinct roles in mammalian sexual differentiation. Dev. Biol. 2011, 353, 229–241. [Google Scholar] [CrossRef]
  47. Liu, J.; Zhang, W.; Du, X.; Jiang, J.; Wang, C.; Wang, X.; Zhang, Q.; He, Y. Molecular characterization and functional analysis of the GATA4 in tongue sole (Cynoglossus semilaevis). Comp. Biochem. Physiol. Part B 2016, 193, 1–8. [Google Scholar] [CrossRef]
  48. Bouma, G.J.; Washburn, L.L.; Albrecht, K.H.; Eicher, E.M. Correct dosage of Fog2 and Gata4 transcription factors is critical for fetal testis development in mice. Proc. Natl. Acad. Sci. USA 2007, 104, 14994–14999. [Google Scholar] [CrossRef]
  49. Xu, W.; Li, H.; Dong, Z.; Cui, Z.; Zhang, N.; Meng, L.; Zhu, Y.; Liu, Y.; Li, Y.; Guo, H.; et al. Ubiquitin ligase gene neurl3 plays a role in spermatogenesis of half-smooth tongue sole (Cynoglossus semilaevis) by regulating testis protein ubiquitination. Gene 2016, 592, 215–220. [Google Scholar] [CrossRef]
Animals 16 00602 g001
Figure 1. Phylogenetic analysis and conserved domain prediction of the foxl gene family. (A) Phylogenetic tree. Different colors represent different gene subfamilies. foxl genes from Cynoglossus semilaevis are marked with red stars. (B) Conserved domain prediction of the foxl gene family. Different colors on the left represent distinct Motifs, and different colors on the right indicate functional regions of the genes (gray: regions with no predicted function). The protein structure and corresponding amino acid sequences are indicated by the scale bar below. (Ms) Micropterus salmoides; (Po) Paralichthys olivaceus; (Sm) Scophthalmus maximus; (Ol) Oryzias latipes; (Cs) Cynoglossus semilaevis; (Dr) Danio rerio; (Ee) Electrophorus electricus; (Xl) Xenopus laevis; (Gg) Gallus gallus; (Mm) Mus musculus; (Hs) Homo sapiens.
Figure 1. Phylogenetic analysis and conserved domain prediction of the foxl gene family. (A) Phylogenetic tree. Different colors represent different gene subfamilies. foxl genes from Cynoglossus semilaevis are marked with red stars. (B) Conserved domain prediction of the foxl gene family. Different colors on the left represent distinct Motifs, and different colors on the right indicate functional regions of the genes (gray: regions with no predicted function). The protein structure and corresponding amino acid sequences are indicated by the scale bar below. (Ms) Micropterus salmoides; (Po) Paralichthys olivaceus; (Sm) Scophthalmus maximus; (Ol) Oryzias latipes; (Cs) Cynoglossus semilaevis; (Dr) Danio rerio; (Ee) Electrophorus electricus; (Xl) Xenopus laevis; (Gg) Gallus gallus; (Mm) Mus musculus; (Hs) Homo sapiens.
Animals 16 00602 g001
Animals 16 00602 g002
Figure 2. Expression levels of foxl1, foxl2a, and foxl2l in different tissues and at different gonadal developmental stages of Cynoglossus semilaevis. (A) foxl1 in different tissues; (B) foxl2a in different tissues; (C) foxl2l in different tissues; (D) foxl1 at different gonadal developmental stages; (E) foxl2a at different gonadal developmental stages; (F) foxl2l at different gonadal developmental stages. F: Female; M: Male. B: Brain; L: Liver; M: Muscle; H: Heart; G: Gonad; SP: Spleen; IN: Intestine; K: Kidney. Different letters indicate significant differences (p < 0.05). Statistical analyses were performed using Levene’s test for homogeneity of variances, followed by One-way ANOVA with the assumption of equal variances and the Waller-Duncan (W) test for post hoc comparisons.
Figure 2. Expression levels of foxl1, foxl2a, and foxl2l in different tissues and at different gonadal developmental stages of Cynoglossus semilaevis. (A) foxl1 in different tissues; (B) foxl2a in different tissues; (C) foxl2l in different tissues; (D) foxl1 at different gonadal developmental stages; (E) foxl2a at different gonadal developmental stages; (F) foxl2l at different gonadal developmental stages. F: Female; M: Male. B: Brain; L: Liver; M: Muscle; H: Heart; G: Gonad; SP: Spleen; IN: Intestine; K: Kidney. Different letters indicate significant differences (p < 0.05). Statistical analyses were performed using Levene’s test for homogeneity of variances, followed by One-way ANOVA with the assumption of equal variances and the Waller-Duncan (W) test for post hoc comparisons.
Animals 16 00602 g002
Animals 16 00602 g003
Figure 3. In situ hybridization of foxl1, foxl2a, and foxl2l in gonads of 1.5-year-old (1.5y) Cynoglossus semilaevis. Blue-purple precipitate indicates the in situ expression of the genes. (A) foxl1 signal detected by antisense probe in the ovary; (B) foxl2a signal detected by antisense probe in the ovary; (C) foxl2l signal detected by antisense probe in the ovary; (D) foxl1 signal detected by antisense probe in the testis; (E) foxl2a signal detected by antisense probe in the testis; (F) foxl2l signal detected by antisense probe in the testis. OC: Oocyte; GC: Granulosa cell; SM: Sperm; SL: Sertoli cell.
Figure 3. In situ hybridization of foxl1, foxl2a, and foxl2l in gonads of 1.5-year-old (1.5y) Cynoglossus semilaevis. Blue-purple precipitate indicates the in situ expression of the genes. (A) foxl1 signal detected by antisense probe in the ovary; (B) foxl2a signal detected by antisense probe in the ovary; (C) foxl2l signal detected by antisense probe in the ovary; (D) foxl1 signal detected by antisense probe in the testis; (E) foxl2a signal detected by antisense probe in the testis; (F) foxl2l signal detected by antisense probe in the testis. OC: Oocyte; GC: Granulosa cell; SM: Sperm; SL: Sertoli cell.
Animals 16 00602 g003
Animals 16 00602 g004
Figure 4. Downstream qPCR analysis after foxl gene knockdown and KEGG enrichment analysis of foxl gene overexpression in Cynoglossus semilaevis testicular cell line. (A) qPCR analysis after foxl1 knockdown; (B) qPCR analysis after foxl2a knockdown; (C) qPCR analysis after foxl2l knockdown; (D) KEGG enrichment of foxl1 overexpression; (E) KEGG enrichment of foxl2a overexpression; (F) KEGG enrichment of foxl2l overexpression. Asterisks indicate significant differences: * p < 0.05, ** p < 0.01, *** p < 0.001. The statistical method employed was the pairwise independent samples t-test.
Figure 4. Downstream qPCR analysis after foxl gene knockdown and KEGG enrichment analysis of foxl gene overexpression in Cynoglossus semilaevis testicular cell line. (A) qPCR analysis after foxl1 knockdown; (B) qPCR analysis after foxl2a knockdown; (C) qPCR analysis after foxl2l knockdown; (D) KEGG enrichment of foxl1 overexpression; (E) KEGG enrichment of foxl2a overexpression; (F) KEGG enrichment of foxl2l overexpression. Asterisks indicate significant differences: * p < 0.05, ** p < 0.01, *** p < 0.001. The statistical method employed was the pairwise independent samples t-test.
Animals 16 00602 g004
Animals 16 00602 g005
Figure 5. Protein–protein interaction prediction analysis of foxl1 and foxl2 in Cynoglossus semilaevis. (A) Proteins interacting with Foxl1 protein; (B) Proteins interacting with Foxl2 protein. Blue line: curated databases; Pink line: experimentally determined; Green line: gene neighborhood; Red line: gene fusions; Dark blue line: gene co-occurrence; Light green line: textmining; Black line: co-expression; Purple line: protein homology.
Figure 5. Protein–protein interaction prediction analysis of foxl1 and foxl2 in Cynoglossus semilaevis. (A) Proteins interacting with Foxl1 protein; (B) Proteins interacting with Foxl2 protein. Blue line: curated databases; Pink line: experimentally determined; Green line: gene neighborhood; Red line: gene fusions; Dark blue line: gene co-occurrence; Light green line: textmining; Black line: co-expression; Purple line: protein homology.
Animals 16 00602 g005
Table 1. Basic information on foxl genes in Cynoglossus semilaevis.
Table 1. Basic information on foxl genes in Cynoglossus semilaevis.
GeneIDGene NamePiMW (Da)ORF (bp)Chromosomal Location
103379784cs-foxl19.8632,985.28897Chromosome 6: 4789988–4793384
103378228cs-foxl2a9.2434,602.1927Chromosome 4: 14132463–14134249
103385043cs-foxl2l9.0122,547.52720Chromosome 10: 11890675–11891958
103382326cs-foxl38.6229,490.22774Chromosome 8: 13485385–13488662
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yan, H.; Wang, L.; Sun, X.; He, M.; Yang, Y.; Meng, Z.; Li, X.; Wang, N.; Dong, Z.; Xu, W. Characterization of Forkhead Box Transcription Factor (foxl) in Sex Differentiation of Chinese Tongue Sole (Cynoglossus semilaevis). Animals 2026, 16, 602. https://doi.org/10.3390/ani16040602

AMA Style

Yan H, Wang L, Sun X, He M, Yang Y, Meng Z, Li X, Wang N, Dong Z, Xu W. Characterization of Forkhead Box Transcription Factor (foxl) in Sex Differentiation of Chinese Tongue Sole (Cynoglossus semilaevis). Animals. 2026; 16(4):602. https://doi.org/10.3390/ani16040602

Chicago/Turabian Style

Yan, Haipeng, Lijun Wang, Xuexue Sun, Mingyue He, Yingming Yang, Zhen Meng, Xihong Li, Na Wang, Zhongdian Dong, and Wenteng Xu. 2026. "Characterization of Forkhead Box Transcription Factor (foxl) in Sex Differentiation of Chinese Tongue Sole (Cynoglossus semilaevis)" Animals 16, no. 4: 602. https://doi.org/10.3390/ani16040602

APA Style

Yan, H., Wang, L., Sun, X., He, M., Yang, Y., Meng, Z., Li, X., Wang, N., Dong, Z., & Xu, W. (2026). Characterization of Forkhead Box Transcription Factor (foxl) in Sex Differentiation of Chinese Tongue Sole (Cynoglossus semilaevis). Animals, 16(4), 602. https://doi.org/10.3390/ani16040602

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop