Changes in Ras and Ras-Associated GTPases During Maturation of Porcine Cumulus Cells and Oocytes
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. IVM
2.2. Collection of Cumulus Cells and Oocytes
2.3. Real-Time PCR
2.4. Quantitative Reverse Transcription PCR
2.5. Statistical Analysis
3. Results
3.1. Morphological and Molecular Changes During Maturation in Porcine COCs
3.2. Changes in Hormone Receptor and Ras-Related Gene During Maturation in Porcine Oocytes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Torkashvand, H.; Shabani, R.; Artimani, T.; Amiri, I.; Pilehvari, S.; Torkashvand, L.; Mehdizadeh, R.; Mehdizadeh, M. Oocyte competence develops: Nuclear maturation synchronously with cytoplasm maturation. Zygote 2024, 32, 421–428. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhang, Y.; Li, T.; Ren, Y.; Zhou, P.; Fu, L.; Xiao, C.; Huang, Z.; Huang, H.; Xie, W.; et al. Transcriptional insights on the incomplete cytoplasmic maturation and developmental potential of oocytes cultured without granulosa cells in mice. BMC Genom. 2025, 26, 270. [Google Scholar] [CrossRef] [PubMed]
- Gao, M.; Wang, H.; Chen, M.; Zhu, S.; He, Y.; Wang, Q.; Gu, L. Characterization of metabolic patterns in porcine cumulus cells during meiotic maturation. Theriogenology 2024, 220, 56–69. [Google Scholar] [CrossRef] [PubMed]
- Six, R.; Benedetti, C.; Fan, Y.; Guan, X.; Gansemans, Y.; Hedia, M.; Bogado Pascottini, O.; Pavani, K.C.; Van Nieuwerburgh, F.; Deforce, D.; et al. Expression profile and gap-junctional transfer of microRNAs in the bovine cumulus-oocyte complex. Front. Cell Dev. Biol. 2024, 12, 1404675. [Google Scholar] [CrossRef] [PubMed]
- Mozzarelli, A.M.; Simanshu, D.K.; Castel, P. Functional and structural insights into RAS effector proteins. Mol. Cell 2024, 84, 2807–2821. [Google Scholar] [CrossRef] [PubMed]
- Yamashita, Y.; Hishinuma, M.; Shimada, M. Activation of PKA, p38 MAPK and ERK1/2 by gonadotropins in cumulus cells is critical for induction of EGF-like factor and TACE/ADAM17 gene expression during in vitro maturation of porcine COCs. J. Ovarian Res. 2009, 2, 20. [Google Scholar] [CrossRef] [PubMed]
- Blaha, M.; Nemcova, L.; Kepkova, K.V.; Vodicka, P.; Prochazka, R. Gene expression analysis of pig cumulus-oocyte complexes stimulated in vitro with follicle stimulating hormone or epidermal growth factor-like peptides. Reprod. Biol. Endocrinol. 2015, 13, 113. [Google Scholar] [CrossRef] [PubMed]
- Appeltant, R.; Somfai, T.; Nakai, M.; Bodó, S.; Maes, D.; Kikuchi, K.; Van Soom, A. Interactions between oocytes and cumulus cells during in vitro maturation of porcine cumulus-oocyte complexes in a chemically defined medium: Effect of denuded oocytes on cumulus expansion and oocyte maturation. Theriogenology 2015, 83, 567–576. [Google Scholar] [CrossRef] [PubMed]
- Shimada, M.; Maeda, T.; Terada, T. Dynamic Changes of Connexin-43, Gap Junctional Protein, in Outer Layers of Cumulus Cells Are Regulated by PKC and PI 3-Kinase During Meiotic Resumption in Porcine Oocytes. Biol. Reprod. 2001, 64, 1255–1263. [Google Scholar] [CrossRef] [PubMed]
- Susor, A.; Jansova, D.; Cerna, R.; Danylevska, A.; Anger, M.; Toralova, T.; Malik, R.; Supolikova, J.; Cook, M.S.; Oh, J.S.; et al. Temporal and spatial regulation of translation in the mammalian oocyte via the mTOR–eIF4F pathway. Nat. Commun. 2015, 6, 6078. [Google Scholar] [CrossRef] [PubMed]
- Luong, X.G.; Daldello, E.M.; Rajkovic, G.; Yang, C.-R.; Conti, M. Genome-wide analysis reveals a switch in the translational program upon oocyte meiotic resumption. Nucleic Acids Res. 2020, 48, 3257–3276. [Google Scholar] [CrossRef] [PubMed]
- Weber, S.M.; Carroll, S.L. The role of R-Ras proteins in normal and pathologic migration and morphologic change. Am. J. Pathol. 2021, 191, 1499–1510. [Google Scholar] [CrossRef] [PubMed]
- Dupré, A.; Suziedelis, K.; Valuckaite, R.; de Gunzburg, J.; Ozon, R.; Jessus, C.; Haccard, O. Xenopus H-RasV12 promotes entry into meiotic M phase and cdc2 activation independently of Mos and p42MAPK. Oncogene 2002, 21, 6425–6433. [Google Scholar] [CrossRef] [PubMed]
- Johnson, A.D.; Cork, R.J.; Williams, M.A.; Robinson, K.R.; Smith, L.D. H-ras(val12) induces cytoplasmic but not nuclear events of the cell cycle in small Xenopus oocytes. Cell Regul. 1990, 1, 543–554. [Google Scholar] [CrossRef] [PubMed]
- Soto-Cruz, I.; Magee, A.I. Effect of synthetic peptides representing the hypervariable region of p21ras on Xenopus laevis oocyte maturation. Biochem. J. 1995, 306, 11–14. [Google Scholar] [CrossRef] [PubMed]
- Valuckaite, R.; Suziedeliene, E.; Suziedelis, K. Involvement of K-Ras during meiotic division in Xenopus laevis oocytes. Biologija 2004, 50, 52–56. [Google Scholar]
- Furuhjelm, J.; Peränen, J. The C-terminal end of R-Ras contains a focal adhesion targeting signal. J. Cell Sci. 2003, 116, 3729–3738. [Google Scholar] [CrossRef] [PubMed]
- Wayne, C.M.; Fan, H.-Y.; Cheng, X.; Richards, J.S. Follicle-Stimulating Hormone Induces Multiple Signaling Cascades: Evidence that Activation of Rous Sarcoma Oncogene, RAS, and the Epidermal Growth Factor Receptor Are Critical for Granulosa Cell Differentiation. Mol. Endocrinol. 2007, 21, 1940–1957. [Google Scholar] [CrossRef] [PubMed]
- Fan, H.-Y.; Shimada, M.; Liu, Z.; Cahill, N.; Noma, N.; Wu, Y.; Gossen, J.; Richards, J.S. Selective expression of KrasG12D in granulosa cells of the mouse ovary causes defects in follicle development and ovulation. Development 2008, 135, 2127–2137. [Google Scholar] [CrossRef] [PubMed]
- Nam, Y.; Cheong, H.-T.; Lee, S.-H. Changes of gonadotropin receptors and Ras subfamily genes during maturation in porcine cumulus cells. J. Anim. Reprod. Biotechnol. 2025, 40, 50–57. [Google Scholar] [CrossRef]
- Seok, E.; Son, M.; Lee, S.; Cheong, H.-T.; Lee, S.-H. The Role of Gonadotropins and Growth Factor in Regulating Ras During Maturation in Cumulus–Oocyte Complexes of Pigs. Animals 2025, 15, 2100. [Google Scholar] [CrossRef] [PubMed]
- Davis, D.; Sadler, S.E. Analysis of the p21 ras system during development of meiotic competence in Xenopus laevis oocytes. Dev. Biol. 1992, 149, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Fabian, J.; Morrison, D.; Daar, I. Requirement for Raf and MAP kinase function during the meiotic maturation of Xenopus oocytes. J. Cell Biol. 1993, 122, 645–652. [Google Scholar] [CrossRef] [PubMed]
- Bayaa, M.; Booth, R.A.; Sheng, Y.; Liu, X.J. The classical progesterone receptor mediates Xenopus oocyte maturation through a nongenomic mechanism. Proc. Natl. Acad. Sci. USA 2000, 97, 12607–12612. [Google Scholar] [CrossRef] [PubMed]
- Norris, R.P.; Ratzan, W.J.; Freudzon, M.; Mehlmann, L.M.; Krall, J.; Movsesian, M.A.; Wang, H.; Ke, H.; Nikolaev, V.O.; Jaffe, L.A. Cyclic GMP from the surrounding somatic cells regulates cyclic AMP and meiosis in the mouse oocyte. Development 2009, 136, 1869–1878. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Su, Y.-Q.; Sugiura, K.; Xia, G.; Eppig, J.J. Granulosa Cell Ligand NPPC and Its Receptor NPR2 Maintain Meiotic Arrest in Mouse Oocytes. Science 2010, 330, 366–369. [Google Scholar] [CrossRef] [PubMed]
- Norris, R.P.; Freudzon, M.; Mehlmann, L.M.; Cowan, A.E.; Simon, A.M.; Paul, D.L.; Lampe, P.D.; Jaffe, L.A. Luteinizing hormone causes MAP kinase-dependent phosphorylation and closure of connexin 43 gap junctions in mouse ovarian follicles: One of two paths to meiotic resumption. Development 2008, 135, 3229–3238. [Google Scholar] [CrossRef] [PubMed]
- Herrick, J.R.; Brad, A.M.; Krisher, R.L. Chemical manipulation of glucose metabolism in porcine oocytes: Effects on nuclear and cytoplasmic maturation in vitro. Reproduction 2006, 131, 289–298. [Google Scholar] [CrossRef] [PubMed]
- Viet Linh, N.; Dang-Nguyen, T.Q.; Nguyen, B.X.; Manabe, N.; Nagai, T. Effects of Cysteine During In Vitro Maturation of Porcine Oocytes Under Low Oxygen Tension on Their Subsequent In Vitro Fertilization and Development. J. Reprod. Dev. 2009, 55, 594–598. [Google Scholar] [CrossRef] [PubMed]
- Lunney, J.K.; Van Goor, A.; Walker, K.E.; Hailstock, T.; Franklin, J.; Dai, C. Importance of the pig as a human biomedical model. Sci. Transl. Med. 2021, 13, eabd5758. [Google Scholar] [CrossRef] [PubMed]
- Zhou, N.; Wang, X.; Xia, Y.; Liu, Z.; Luo, L.; Jin, R.; Tong, X.; Shi, Z.; Wang, Z.; Sui, H.; et al. Comparatively profiling the transcriptome of human, Porcine and mouse oocytes undergoing meiotic maturation. BMC Genom. 2025, 26, 236. [Google Scholar] [CrossRef] [PubMed]
- Chardin, P.; Camonis, J.H.; Gale, N.W.; van Aelst, L.; Schlessinger, J.; Wigler, M.H.; Bar-Sagi, D. Human Sos1: A guanine nucleotide exchange factor for Ras that binds to GRB2. Science 1993, 260, 1338–1343. [Google Scholar] [CrossRef] [PubMed]
- Trahey, M.; McCormick, F. A Cytoplasmic Protein Stimulates Normal N-ras p21 GTPase, But Does Not Affect Oncogenic Mutants. Science 1987, 238, 542–545. [Google Scholar] [CrossRef] [PubMed]
- Ballester, R.; Marchuk, D.; Boguski, M.; Saulino, A.; Letcher, R.; Wigler, M.; Collins, F. The NF1 locus encodes a protein functionally related to mammalian GAP and yeast IRA proteins. Cell 1990, 63, 851–859. [Google Scholar] [CrossRef] [PubMed]
- Mochizuki, N.; Yamashita, S.; Kurokawa, K.; Ohba, Y.; Nagai, T.; Miyawaki, A.; Matsuda, M. Spatio-temporal images of growth-factor-induced activation of Ras and Rap1. Nature 2001, 411, 1065–1068. [Google Scholar] [CrossRef] [PubMed]
- Herrero, A.; Casar, B.; Colón-Bolea, P.; Agudo-Ibáñez, L.; Crespo, P.; Gutkind, J.S. Defined spatiotemporal features of RAS-ERK signals dictate cell fate in MCF-7 mammary epithelial cells. Mol. Biol. Cell 2016, 27, 1958–1968. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Liang, C.-G.; Xiong, B.; Xu, B.-Z.; Lin, S.-L.; Hou, Y.; Chen, D.-Y.; Schatten, H.; Sun, Q.-Y. PI3-kinase and mitogen-activated protein kinase in cumulus cells mediate EGF-induced meiotic resumption of porcine oocyte. Domest. Anim. Endocrinol. 2008, 34, 360–371. [Google Scholar] [CrossRef] [PubMed]
- Prochazka, R.; Blaha, M.; Nemcova, L. Signaling pathways regulating FSH- and amphiregulin-induced meiotic resumption and cumulus cell expansion in the pig. Reproduction 2012, 144, 535–546. [Google Scholar] [CrossRef] [PubMed]
- Peng, L.; He, Y.; Wang, W.; Chu, Y.; Lin, Q.; Rui, R.; Li, Q.; Ju, S. PAK1 Is Involved in the Spindle Assembly during the First Meiotic Division in Porcine Oocytes. Int. J. Mol. Sci. 2023, 24, 1123. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Wang, Q.-C.; Liu, J.; Xiong, B.; Cui, X.-S.; Kim, N.-H.; Sun, S.-C. The small GTPase CDC42 regulates actin dynamics during porcine oocyte maturation. J. Reprod. Dev. 2017, 63, 505–510. [Google Scholar] [CrossRef] [PubMed]
- Tsai, P.-S.; van Haeften, T.; Gadella, B.M. Preparation of the Cortical Reaction: Maturation-Dependent Migration of SNARE Proteins, Clathrin, and Complexin to the Porcine Oocyte’s Surface Blocks Membrane Traffic until Fertilization. Biol. Reprod. 2011, 84, 327–335. [Google Scholar] [CrossRef] [PubMed]
- Sawamukai, K.; Suzuki, K.; Ogawa, H.; Shimizu, H.; Mori, T. Distribution of Cortical Granules in Porcine Oocytes Inseminated In Vitro at Various Times of Culture for Maturation In Vitro. J. Mamm. Ova Res. 1998, 15, 139–145. [Google Scholar] [CrossRef]
- Lee, J.B.; Lee, M.G.; Lin, T.; Shin, H.Y.; Lee, J.E.; Kang, J.W.; Jin, D.-I. Effect of oocyte chromatin status in porcine follicles on the embryo development in vitro. Asian-Australas. J. Anim. Sci. 2019, 32, 956–965. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.; Kim, H.; An, J.; Cheong, H.-T.; Lee, S.-H. Comparison of development and antioxidative ability in fertilized crossbred (Yorkshire × landrace × duroc) oocytes using duroc and landrace sperm. Animals 2024, 14, 3562. [Google Scholar] [CrossRef] [PubMed]
- Jeong, J.-Y.; Cai, L.; Kim, M.; Choi, H.; Oh, D.; Jawad, A.; Kim, S.; Zheng, H.; Lee, E.; Lee, J.; et al. Antioxidant effect of ergothioneine on in vitro maturation of porcine oocytes. J. Vet. Sci. 2023, 24, e24. [Google Scholar] [CrossRef] [PubMed]
- Choi, H.; Oh, D.; Kim, M.; Cai, L.; Lee, J.; Kim, E.; Lee, G.; Hyun, S.-H. Copper deficiency affects the developmental competence of porcine oocytes matured in vitro. Front. Cell Dev. Biol. 2022, 10, 993030. [Google Scholar] [CrossRef] [PubMed]
- Yokoo, M.; Kimura, N.; Abe, H.; Sato, E. Influence of hyaluronan accumulation during cumulus expansion on in vitro porcine oocyte maturation. Zygote 2008, 16, 309–314. [Google Scholar] [CrossRef] [PubMed]
- Kimura, N.; Konno, Y.; Miyoshi, K.; Matsumoto, H.; Sato, E. Expression of hyaluronan synthases and CD44 messenger RNAs in porcine cumulus-oocyte complexes during in vitro maturation. Biol. Reprod. 2002, 66, 707–717. [Google Scholar] [CrossRef] [PubMed]
- Sasseville, M.; Gagnon, M.-C.; Guillemette, C.; Sullivan, R.; Gilchrist, R.B.; Richard, F.J. Regulation of gap junctions in porcine cumulus-oocyte complexes: Contributions of granulosa cell contact, gonadotropins, and lipid rafts. Mol. Endocrinol. 2009, 23, 700–710. [Google Scholar] [CrossRef] [PubMed]
- Schoevers, E.J.; Kidson, A.; Verheijden, J.H.M.; Bevers, M.M. Effect of follicle-stimulating hormone on nuclear and cytoplasmic maturation of sow oocytes in vitro. Theriogenology 2003, 59, 2017–2028. [Google Scholar] [CrossRef] [PubMed]
- Procházka, R.; Petlach, M.; Nagyová, E.; Němcová, L. Effect of epidermal growth factor-like peptides on pig cumulus cell expansion, oocyte maturation, and acquisition of developmental competence in vitro: Comparison with gonadotropins. Reproduction 2011, 141, 425–435. [Google Scholar] [CrossRef] [PubMed]
- Prochazka, R.; Kalab, P.; Nagyova, E. Epidermal growth factor-receptor tyrosine kinase activity regulates expansion of porcine oocyte-cumulus cell complexes in vitro. Biol. Reprod. 2003, 68, 797–803. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Zhang, R.; Zhang, S.; Ji, Y.; Zhou, Q.; Leng, L.; Meng, F.; Gong, F.; Lu, G.; Lin, G.; et al. Transcriptomic profiles reveal the characteristics of oocytes and cumulus cells at GV, MI, and MII in follicles before ovulation. J. Ovarian Res. 2023, 16, 225. [Google Scholar] [CrossRef] [PubMed]


| Gene | Sequence (5′–3′) | Annealing Temp. (°C) | Cycle | Product Size (bp) | Accession No. | PCR Type |
|---|---|---|---|---|---|---|
| CX43 | F: TCATCTTCATGCTGGTCGTATC | 60 | 40 | 99 | NM_001244212.1 | RT-PCR |
| R: TTCCCTTCACACGATCCTTAAC | ||||||
| LHR | F: GGAGAATGCACACCTGAAGA | 60 | 40 | 94 | JN120794.1 | RT-PCR |
| R: GGCCTGTAGTTTAGTGGAAGAA | ||||||
| LHR | F: CTGTCCTCTTTGTTCTCCTGAC | 60 | 34 | 191 | NM_214449.1 | qPCR |
| R: AGCAACACTACACCCATTCC | ||||||
| FSHR | F: CTGCCTGCCCATGGATATT | 60 | 40 | 104 | NM_214386.3 | RT-PCR |
| R: GAGTATAGCAGCCACAGATGAC | ||||||
| FSHR | F: GATCCTGATCACCAGCCAATAC | 60 | 34 | 217 | NM_214386 | qPCR |
| R: GACTGAGAGCTCACTAGCAAAG | ||||||
| EGFR | F: CCCAGCACCCGAATATGTAA | 60 | 40 | 87 | NM_214007.1 | RT-PCR |
| R: CTGAGAGGCTGATTGTGGTAG | ||||||
| EGFR | F: CCTTGGGAACTTGGAGATCACCTAC | 60 | 34 | 344 | NM_214007 | qPCR |
| R: TGTTGCTTAGAAAGTCGCTGTTGAC | ||||||
| R-Ras | F: CCTGCTGGTGTTTGCCATTA | 60 | 40 | 94 | XM_003355998.3 | RT-PCR |
| R: GAAGTCATCTCGGTCCTTGACT | ||||||
| K-Ras | F: GATGGAGAAACCTGTCTCTTGG | 60 | 40 | 80 | XM_005653151 | RT-PCR |
| R: CTCATGTACTGGTCCCTCATTG | ||||||
| H-Ras | F: CCCTGACCATCCAGCTTAT | 60 | 40 | 89 | XM_021082554.1 | RT-PCR |
| R: GTCAATGACCACTTGCTTCC | ||||||
| N-Ras | F: AACCAGACAGGGTGTTGAAG | 60 | 40 | 103 | NM_001044537.1 | RT-PCR |
| R: ACAACCTTGAGTCCCATCATC | ||||||
| NF1 | F: GCAGTTCAGACCCTAGTTTAC | 60 | 40 | 123 | XM_021067460.1 | RT-PCR |
| R: TGTTGGCTGGGATACATAACC | ||||||
| RASA1 | F: TCCAGAACAAGCAGAGGATTG | 60 | 40 | 97 | XM_021084515.1 | RT-PCR |
| R: GACCTGACGCAGACGTTTAT | ||||||
| SOS1 | F: TCCTCCTGCTTCTGGTGCTTCTAG | 60 | 40 | 97 | XM_021087589.1 | RT-PCR |
| R: AAAGACGGTATCGCTGCTTGAGTG | ||||||
| β-actin | F: TCTGGCACCACACCTTCTA | 60 | 40 | 102 | XM_021086047.1 | RT-PCR |
| R: TCTTCTCACGGTTGGCTTTG | ||||||
| β-actin | F: GGACTTCGAGCAGGAGATGG | 60 | 32 | 233 | XM_003124280 | qPCR |
| R: GCACCGTGTTGGCGTAGAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Nam, Y.; Song, H.; Seok, E.; Lee, S.-H. Changes in Ras and Ras-Associated GTPases During Maturation of Porcine Cumulus Cells and Oocytes. Animals 2026, 16, 2125. https://doi.org/10.3390/ani16142125
Nam Y, Song H, Seok E, Lee S-H. Changes in Ras and Ras-Associated GTPases During Maturation of Porcine Cumulus Cells and Oocytes. Animals. 2026; 16(14):2125. https://doi.org/10.3390/ani16142125
Chicago/Turabian StyleNam, Yuna, Hyeonseo Song, Eunju Seok, and Sang-Hee Lee. 2026. "Changes in Ras and Ras-Associated GTPases During Maturation of Porcine Cumulus Cells and Oocytes" Animals 16, no. 14: 2125. https://doi.org/10.3390/ani16142125
APA StyleNam, Y., Song, H., Seok, E., & Lee, S.-H. (2026). Changes in Ras and Ras-Associated GTPases During Maturation of Porcine Cumulus Cells and Oocytes. Animals, 16(14), 2125. https://doi.org/10.3390/ani16142125

