Next Article in Journal
Effects of Grape Pomace Complete Pellet Feed on Growth Performance, Fatty Acid Composition, and Rumen Fungal Composition in Beef Cattle
Previous Article in Journal
African Swine Fever: A One Health Perspective and Global Challenges
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Supplemental Essential Oils Blend on Broiler Meat Quality, Fatty Acid Profile, and Lipid Quality

Research Centre for Livestock Environmental Control and Smart Production, College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China
*
Authors to whom correspondence should be addressed.
Animals 2025, 15(7), 929; https://doi.org/10.3390/ani15070929
Submission received: 25 February 2025 / Revised: 20 March 2025 / Accepted: 22 March 2025 / Published: 24 March 2025
(This article belongs to the Section Poultry)

Simple Summary

Essential oils (EOs) are regarded as a promising alternative to antibiotics, owing to their growth-promoting and antioxidant properties. However, studies on the inclusion of EOs in drinking water (DW) and their effects on meat quality remain limited. Therefore, this study aims to explore the impact of the essential oils blend (EOB) supplementation in the broiler DW on performance, meat quality, fatty acid (FA) profile, and the expression of genes related to lipid metabolism. The findings demonstrate that the EOB supplementation can improve meat quality by stabilizing antioxidants, enhancing the lipid quality index, promoting fatty acid oxidation, and suppressing the activity of genes associated with lipid metabolism, particularly those involved in fat synthesis.

Abstract

This investigation evaluates the impact of the EOB on chicken growth performance, meat quality, and lipid metabolism. Two hundred and fifty-six one-day-old, white-feathered broilers were randomly allocated to four groups. Each group was subdivided into eight replicates, each with eight unsexed chicks, including the control group (CON), EOB150, EOB250, and EOB350, with 0, 150, 250, and 350 mg/L of the EOB added to the drinking water, respectively. The expression levels of genes associated with antioxidants and lipid metabolism were analyzed using real-time polymerase chain reaction (RT-PCR). Additionally, the FA profile of the breast muscle was determined using gas chromatography. The data displayed that those birds in the EOB250 group had a higher breast muscle index compared to the CON group. The breast meat in the EOB groups showed that there is increased yellowness, water holding capacity (WHC), and polyunsaturated fatty acids (PUFAs), while cooking losses, drip losses, and saturated fatty acids (SFAs) were reduced compared to the CON. The application of supplements for the EOB250 and EOB350 groups increased antioxidant indices as well as the expression of antioxidant-related genes in the liver and muscles. However, these groups decreased the concentrations of triglycerides (TG), total cholesterol (TC), and low-density lipoprotein (LDL-C) in serum and liver compared to the EOB150 and CON groups. These EOB groups downregulated expression of some genes linked to liver FA synthesis and elevated the expressions of lipid β-oxidation-related genes compared to the CON. It can be concluded that the supplementation with 250 mg/L of the EOB has the potential as an alternative water additive in the broiler industry.

1. Introduction

The global demand for inexpensive and highly palatable protein has driven the tremendous growth of the poultry sector [1]. For decades, antibiotics were administered to promote growth and to protect chickens against pathogenic microbes [2]. Antibiotics are banned in the European Union and China because of their unwanted effects, including antibiotic-resistant bacteria, residue contamination of animal products, and ecosystem contamination [3]. The replacement of synthetic growth enhancers and antibiotics with organic nutritional supplements was reported to improve the birds’ immunity, growth, and carcass quality [4,5]. EOs have emerged as a potential substitute for antibiotics in broiler production because of their natural antibacterial and anti-inflammatory characteristics. Thus, utilizing these plant-extracted compounds can enhance performance and gut health, as well as meat quality and oxidative stability, without the risks associated with antibiotic residue and antibiotic-resistant bacteria proliferation [6].
One of the natural strategies that has been widely used in broiler production is using oregano essential oil (OEO), which has contributed to positive results in several studies [7]. These studies indicate that OEO acts as a growth promoter, a natural antibiotic, and acts to elevate beneficial bacteria in the digestive tract [8,9]. OEO has also been suggested as an efficient mechanism for enhancing broiler meat quality [10]. Carvacrol and thymol are principal volatile compounds present in OEO, which contribute to the biological activity of the oil. Orange EO contains a plethora of compounds and is composed of 85–99% volatile constituents, which are extracted from the peel of the fruit [11]. Most of these volatile compounds are terpenoids and their oxygenated derivatives. EOs of orange and thyme were reported to also inhibit lipid oxidation in meat without compromising quality [12]. Cinnamon spice is achieved from the inner surface of Cinnamomum verum, a hardy, evergreen plant that is part of the Lauraceae family and has natural aromatic properties. Cinnamon and its EOs and bioactive compounds, including cinnamaldehyde and eugenol, are commonly used in poultry production as dietary additives. Cinnamon supplementation has been found to enhance meat quality and improve its shelf life [13].
Many researchers have observed the influence of EOs by adding them to broiler feeds and studying their impact on performance and meat quality data [7,14]. Another approach is to include EOs in DW to observe how EOs affect broiler performance. The EOB supplementation has been shown to increase the carcass yield, tenderness, and WHC in chickens [15]. EOs are reported to have anti-oxidative properties on lipids in tissues and serum, meanwhile enhancing meat quality and extending shelf life [16]. Based on previous studies, EOs in DW have the potential to enhance the growth, health, and meat quality of birds. EO supplementation has demonstrated improvements in productivity and antioxidant capacity in chickens [17]. Lipid peroxidation (MDA) is a common indication of oxidative stress in poultry [18], suggesting that EOs may reduce MDA levels, improve health tissues, and thus improve meat quality. Chickens that were administered EOs have also reported decreased TC, TG, and LDL-C [19], indicating that EOs may contribute to lipid metabolism regulation. Lipid content is closely related to metabolic disorders, like atherosclerosis, coronary heart disease, and fatty liver. Both total lipid intake and the ratio of FAs in the daily diet, when properly managed, can reduce the incidence of cardiovascular disease [20]. Moreover, lipid oxidation could also influence the quality and flavor of meat during FA production [21]. As an example, chicken breast meat, which has high levels of unsaturated fatty acids (UFAs), can decrease both the thrombogenicity and atherogenicity indices [22]. Oregano oil and cinnamon oil have been shown to have antibacterial and growth-promoting effects, and are widely used in poultry production. In addition, limonene has also been shown to improve antioxidant properties and gut health in broilers [23].
Few studies have been conducted to investigate whether the EOB extract supplementation from oregano leaves, cinnamon, and orange peels in broiler DW affects their meat quality and lipid metabolism. Thus, the purpose of this experiment is to thoroughly assess the influence of the EOB supplements in the DW on growth performance, breast meat quality, oxidative functions, FA profiles, and lipid quality indexes. This study applies valuable insight into broiler production.

2. Materials and Methods

2.1. Source of the EOB

The EOB used in the current study is a commercial product provided by Yangzhou Well Biological Technology Co., Ltd. (Nanjing, China). According to Zhang et al. [24], the EOB was extracted via steam distillation from the leaves of oregano, the peels of cinnamon, and the peels of oranges, and they are mixed in equal proportions. Due to the hydrophobic nature of the EOs, Tween-20 was incorporated as an emulsifier to enhance the solubility and stability in water. The final mixture consists of 10% essential oils (EOs), 50% Tween-20 emulsifier, and 40% pure water.

2.2. The Trial Design, Birds, and Treatments

A total of 256 one-day-old, unsexed AA broiler chicks (46.30 ± 0.23 g) were purchased from a broiler breeder company in Nanjing, China. Using a completely randomized design, it was randomly distributed to 4 groups of 8 replicates, each with 8 chicks/replicate. The experimental treatments included the CON, EOB150, EOB250, and EOB350, supplemented with EOB in DW (0, 150, 250, and 350 mg/L). The EOB supplementation levels were determined based on established efficacious concentrations (100–500 mg/kg or mg/L) of oregano, cinnamon, and orange peel essential oils in poultry nutrition, as demonstrated in the previous studies [19,25,26,27]. Optimal dosage was adjusted according to bioactive compound composition and corresponding biological activities. The EOB was fully dissolved in DW to ensure homogeneous distribution and was provided continuously throughout the trial. The trial phase continued for 42 d, involving the early phase (1 to 21 D) and end phase (22 to 40 D). The room temperature was maintained at 34–35 °C for the first day and decreased until the temperature was 21–22 °C. The experimental rations were similar across each group and prepared by NRC (1994). Table 1 displays the basic formula and nutritional level. Birds received ad libitum feed and water in galvanized wired cages measuring (90 cm × 60 cm × 35 cm). During early growth, each group (64 chicks) was housed in 8 cages (8 birds/cage). As the birds matured, housing density was reduced by doubling cage numbers to 16 (2 per replicate), while maintaining the original dimensions, ensuring adequate space for welfare and development. Upon arrival, the chicks were subjected to a continuous illumination regimen featuring a lighting routine of 23 h of light and 1 h of dark.

2.3. Estimation of Growth Performance and Carcass Traits

During the 42-day experimental period, total body weight and remaining feed per pen were measured and recorded on days 1, 21, and 42, in the early morning following an 8-h feed deprivation. Average body weight (ABW), average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio (FCR) were calculated. Mortality was monitored daily, and deceased birds were recorded and weighed to adjust growth performance parameters, including gain, feed intake, and FCR estimates as appropriate.
At day 42 of the experiment, eight birds from each treatment group were randomly selected based on the average body weight and humanely slaughtered by cervical dislocation following a 12 h fasting period to evaluate slaughter performance. The birds were slaughtered in a designated slaughterhouse next to the poultry farm to avoid the stress of transportation. The body weight of all birds was measured before slaughter. After euthanasia, the birds were scalded and processed, and feathers, heads, viscera, and feet were removed. Post-evisceration, the semi-eviscerated carcass, fully eviscerated carcass, abdominal fat, breast muscle, liver, spleen, and Fabricius bursa were anatomically dissected and weighed alone. These components were weighed and calculated as a proportion relative to the bird’s body weight.

2.4. Sampling

At day 42, eight birds from every treatment group were chosen and weighed. Blood samples were obtained from the wing vein and transfused into a coagulation tube. The serum was isolated by centrifugation (3000 rpm for 15 min, 4 °C) and kept at −20 °C, and the birds were slaughtered through cervical dislocation for tissue samples. Parameters of meat quality were measured in the breast muscles. Subsequently, the liver and breast muscles were isolated and weighed, then rapidly collected, immediately frozen in liquid nitrogen, and kept at −80 °C for further measurement.

2.5. Biochemical Analysis

Blood samples were obtained from the wing vein of eight chickens of each group at 42 days old. The contents of TG, TC, LDL-C, and HDL-C in serum and liver were evaluated utilizing specific commercial kits, as per the producer’s directions (Nanjing Jiancheng Biotechnology Co., Ltd., Nanjing, China).

2.6. Meat Quality Parameters Assess

Meat samples were collected from eight chickens per group for physicochemical analysis. The pH of the breast muscle was measured 45-min post-slaughter using a pH meter (HI9125, Hanna Instruments, Cluj-Napoca, Romania). Three measurements were taken per sample, and the mean value was recorded. Meat color parameters, including lightness (L*), redness (a*), and yellowness (b*), were evaluated one hour post-slaughter using a chromameter (CR-410, Konica Minolta, Tokyo, Japan). To ensure accurate measurements, meat samples had a minimum thickness of 1.5 cm. Additionally, total color change (ΔE), chroma (saturation index), hue angle, and browning index (BI) were calculated using established equations as described in [28]. Color assessments were performed at three distinct locations on the left pectoralis minor muscle, and the mean value was used for analysis.
Water holding capacity was estimated using the technique described in [29], with some modifications. Breast fillets were sampled by the cranial side after 24 h exposure and cut into approximately 10 g cubes. Both samples were double analyzed. They were sandwiched between two pieces of filter paper and pressed a weight of 10 kg for 5 min. The weight of the samples was recorded before and after compression, and WHC was quantified based on the amount of exuded water. The following equation was used to calculate WHC:
WHC = 100 − {[(initial weight − final weight)/initial weight] × 100}.
Drip loss was measured based on a method described in [13]. The breast portions utilized for the drip test were individually weighed, vacuum packed, and stored at 4 °C for 24 h. The weight change before and after storage was determined and calculated as a proportion of drop loss.
For cooking loss, approximately 30 g of meat samples were precisely cut (2 cm × 2 cm × 5 cm) and weighed in a plastic sack. Samples were heated in a thermostat water bath maintained at 85 °C, sufficient to raise the internal temperature of the meat to 77 °C, cooled, and reweighed. Cooking loss was determined based on the following formula:
The cooking loss percentage = [(initial weight − cooked weight)/initial weight] × 100
Shear force (SF) has determined the same samples that were used to measure cooking loss. According to [30] protocol, we obtained two adjacent columns of 2.5 cm2 from each meat sample that were used to measure cooking loss. Using a shear device (C-LM3, Northeast Agricultural University, Harbin, China), each column was cut three times crosswise with surface muscle fibers being oriented in a longitudinal direction. We subsequently measured maximum SF (N) from each cutting. The two columns were averaged, and mean values were used to calculate the shear value for each sample.

Meat Texture Analysis

Meat samples taken from 2 cylinders (diameter: 20 mm, height: 20 mm) were sliced perpendicular to muscle fiber direction and subjected to textural profile determination using a texture analyzer (XT Plus, Stable Micro Systems Ltd., Godalming, UK) based on [31]. Samples were subjected to a set of parameters: 2 compressions with a compression ratio of 50%, a pre-test rate of 5 mm/s, a test rate of 5 mm/s, a post-test rate of 10 mm/s, a actuate pressure of 5 g, and a test duration of 1 s [32].

2.7. Antioxidant Capacity Analysis

The activities of antioxidant enzymes [total superoxide dismutase (T-SOD; A001-1), glutathione peroxidase (GSH-Px; A005-1), catalase (CAT; A007-1), total antioxidant capacity (T-AOC; A015-1) and MDA (MDA; A003-1)] in serum, liver, and breast muscle samples were assayed by commercial analytical kits according to the manufacturer’s recommendations (Jiancheng Bioengineering Institute, Nanjing, China). Total protein content was assessed using a bicinchoninic acid assay (P0009, Beyotime, Shanghai, China).

2.8. Fatty Acid Profile Determination

In breast muscle samples, lipids were isolated using chloroform–methanol following the protocol in [33]. Gas chromatographic analysis was performed on sodium hydroxide/methanol-FA-methyl esters. Fatty acyl compositions were analyzed with an SP-2380 capillary chromatographic column (100 m × 0.25 mm × 0.20 µm; ANPEL Laboratory Technologies Inc., Shanghai, China) using a 7890A gas chromatograph (Agilent Technologies Co., Ltd., Palo Alto, CA, USA) with a flame ionization sensor for fatty acyl methyl esters. The FA was identified by comparing the stay periods to those of the established reference substances obtained from ANPEL Laboratory Technologies Inc. (Shanghai, China). The composition of FAs was measured using internal standard method [34].

Lipid Quality Indexes

Different lipid parameters were calculated by comparing ratios, including n-6/n-3 PUFA, ΣPUFA/ΣSFA, linoleic acid/α-linolenic acid (LA/ALA), eicosapentaenoic acid and docosahexaenoic acid (EPA + DHA), unsaturation index (UI), health-promoting index (HPI), flesh lipid quality (FLQ), nutrition value index (NVI), Index of Atherogenicity (IA), thrombosis index (TI), hypocholesterolemic/hypercholesterolemic (h/H), peroxidation trend index (PI), inflammatory biomarker (IB), dietary fatty acids (DFAs), nutritional ratio (NR), thioesterase, elongase, and desaturase indices, of broiler muscle utilizing equations according to [35,36].

2.9. RNA Extraction and RT-qPCR Verification

Total RNA was attained by TRIzol™ Total RNA Kit (Vazyme Biotech Co., Ltd., Nanjing, China). The quantity of RNA was assessed using Nanodrop 2000 (Thermo Fisher Scientific, Wilmington, DE, USA), and cDNA reverse transcription was carried out using ABScript III RT Master Mix for qPCR with gDNA Remover (ABclonal, Wuhan, China). According to instructions of SYBR Green I (ABclonal, Wuhan, China) real-time fluorescence quantitative PCR kit, the total reaction system was 20 μL, and reagents required for the reaction were applied as needed. After this, the melting curve was run and analyzed to check whether the process was acceptable. The mRNA expression of the target gene was normalized by β-actin (∆CT), and the PCR data were analyzed by the 2−∆∆CT method. RT-qPCR was performed to measure expression levels of genes encoding antioxidant mediators in the liver and muscles (CAT, SOD, GSH, and nuclear factor erythroid 2-related factor 2 (NRF2)), and genes related to lipid metabolism [sterol regulatory element-binding protein-1c (SREBP-1c), acetyl-CoA carboxylase (ACC), FA synthase (FAS), FA desaturase-2 (FADS2), stearoyl-CoA desaturase (SCD), peroxisome proliferator activated receptor gamma (PPARγ), CCAAT / Enhancer Binding Protein α (C/EBPα), peroxisome proliferator-activated receptor alpha (PPARα), acyl-CoA oxidase 1 (ACOX1), carnitine palmitoyl transferase 1a (CPT1), lipoprotein lipase (LPL), FA-binding protein (FABP), and FA transport protein 1 (FATP1)]. The RT-qPCR assay primer sequences are provided in Table 2.

2.10. Statistical Analysis

Statistical analysis for each data group was carried out by SPSS 27.0 software. Group differences were evaluated via one-way ANOVA, and individual comparisons were measured by the Duncan test. Graphs were made using GraphPad Prism 9.0 software (GraphPad Software, San Diego, CA, USA). Data are expressed as an average ± SEM; p < 0.05 is indicated for significance assertion.

3. Results

3.1. Growth Performance

Supplementation with the EOB resulted in variable growth performance at different doses in the broilers. As indicated in Table 3, no differences were observed in the ABW, ADG, ADFI, and FCR through the 1–21 d period. During the overall 1–42 d experimental period, the EOB250 group demonstrated an increased ABW and reduced FCR, but there were no variations between the groups (p > 0.05).

3.2. Carcass Traits

As illustrated in Table 4, the breast muscle index percentage of the EOB250 group was significantly greater than the CON (p < 0.05). But there were no differences observed on carcass traits, such as the liver index, spleen index, bursa of Fabricius index, abdominal fat index, semi-evisceration index, and full-evisceration index among the four groups (p > 0.05).

3.3. Biochemical Indices in Serum and Liver

The impacts of the EOB supplementation on lipid metabolism in chickens are displayed in Figure 1. Compared to the CON group, the EOB250 and EOB350 supplementation decreased TG and LDL-C levels, while HDL-C levels were enhanced in both the liver and serum (p < 0.05). Moreover, the EOB250 supplementation also reduced the serum TC levels (p < 0.05), while the EOB350 decreased the liver TC levels relative to the CON (p < 0.05).

3.4. Meat Quality

The impact of the EOB supplementation on meat quality is shown in Table 5. No differences in the post-slaughter pH values were found among the treatment groups. Nevertheless, other quality parameters improved substantially. Meat from groups supplemented with the EOB showed significantly greater WHC in breast meat (p < 0.05). Furthermore, the EOB250 and EOB350 groups had significantly less drip loss (p < 0.05). Cooking loss was also reduced by the EOB supplementation, with the lowest values from the EOB350 group (p < 0.05). Moreover, notable differences in meat color parameters (b*, chroma, and BI) were observed. These parameters in the EOB250 group were higher than those in the EOB150 and CON groups (p < 0.05). By contrast, no effects were observed on L*, a*, ΔE, or hue angle (p > 0.05).

Meat Texture Analysis

The texture analysis of the breast meat is illustrated in Figure 2. The EOB250 and EOB350 groups exhibited higher resilience values than the EOB150 and CON (p < 0.05). Moreover, the CON group displayed a lower meat cohesiveness value than the EOB150 and EOB250 (p < 0.05). No variations were found in other parameters of texture; however, hardness, gumminess, chewiness, and springiness were numerically higher in the CON group (p > 0.05).

3.5. Antioxidant Activity

The results showed that the EOB supplementation increased antioxidant activity in the serum (Figure 3, A1–A5). T-AOC was raised in the EOB250 group relative to both the EOB150 and CON. Moreover, the EOB350 group showed increased T-SOD activity compared to the CON (p < 0.05). Both CAT and GSH-Px activities were higher in the EOB250 and EOB350 groups, in contrast to the CON (p < 0.05). There were no changes between the groups for MDA levels (p > 0.05).
The activity of antioxidant enzymes in the liver (B1–B5) and breast muscle (C1–C5) is displayed in Figure 3. In the liver, relative to the CON group, CAT activity was higher in both the EOB250 and EOB350 (p < 0.05). Moreover, GSH-Px activity in the EOB250 group was noticeably higher in comparison with the CON (p < 0.05). Furthermore, MDA levels were lower with augmenting amounts of the EOB groups (p < 0.05). In the breast muscle, the EOB350 supplementation markedly elevated both CAT and T-AOC levels (p < 0.05). Moreover, the activity of GSH-Px was amplified in both the EOB250 and EOB350 groups, relative to the CON (p < 0.05).

3.6. Hepatic and Breast Muscle Antioxidant-Related Gene Expression

Figure 4 shows the effect of the EOB supplementation on the regulation of antioxidant-related genes in the liver and breast muscle. In the liver, mRNA expression levels of CAT and NRF2 were elevated in the EOB250 group compared with the EOB150 and CON (p < 0.05). Likewise, expression of the GSH gene was enhanced in the EOB250 and EOB350 groups, in comparison to the CON (p < 0.05). In the breast muscle, supplementation with EOB350 markedly upregulated mRNA levels for CAT and GSH (p < 0.05). Throughout, the expression of the SOD gene was upregulated in the EOB250 group relative to the CON (p < 0.05). Moreover, the expression level of the NRF2 gene was amplified in the EOB250 and EOB350 groups compared to the CON (p < 0.05).

3.7. Fatty Acid Profile and Lipid Quality Indexes

Table 6 presents the influence of the EOB supplementation on the FA profile of the breast muscle. The results indicate that supplementation with EOB250 and EOB350 reduced levels of SFAs, such as C18:0 and C12:0 (p < 0.05). Contradictorily, the concentrations of PUFAs, particularly C18:2n6c, C18:3n3, C20:4n6, and C22:4n6, were higher in the EOB250 and EOB350 groups in comparison to the CON. The level of monounsaturated fatty acids (MUFAs) was greater in the EOB250 group than in the EOB150 and CON, although the difference was not significant (p > 0.05). Furthermore, supplementation with EOB250 and EOB350 increased concentrations of n-3 and n-6 PUFAs in chicken breast meat (p < 0.05).
Table 7 indicates a notable rise (p < 0.05) in the PUFA/SFA ratio, as well as in EPA + DHA, UI, HPI, h/H, FLQ, PI, and DFA in the EOB250 and EOB350 groups compared to the EOB150 and CON. Conversely, a significant decrease was observed in the AI, TI, and NR in the EOB250 and EOB350 groups (p < 0.05). Furthermore, the activities of Δ9-desaturase (18) and Δ9-desaturase (16 + 18) were higher in the EOB250 and EOB350 group compared to the CON (p < 0.05). Nevertheless, no variations were detected in the activities of elongase, thioesterase, Δ9-desaturase (16), and activity index across the treatment groups (p > 0.05).

3.8. Gene Expression Related to Hepatic Lipid Metabolism

The effect of the EOB supplementation on lipid metabolism was assessed in the liver by measuring the mRNA expression of important FA biosynthesis enzymes (Figure 5A). The EOB250 and EOB350 group showed downregulated mRNA expression of SREBP-1c and ACC (p < 0·05); while FADS2 expression was notably increased in the EOB250 and EOB350 groups compared with the EOB150 and CON. Moreover, the EOB250 group displayed significantly fewer expressions of FAS and PPARγ genes relative to the CON (p < 0·05). Further analysis announced that genes related to FA catabolism, including PPARα, ACOX1, and CPT1, had higher expression levels in the EOB250 group relative to the CON (p < 0·05), as shown in Figure 5B. However, no changes were observed in the expression of FATB1, C/EBPα, LPL, SCD, or FABP across the different treatment groups (p > 0.05).

4. Discussion

The present study describes the impacts of varying levels of EOB supplementation on growth attributes, carcass traits, meat FA composition, and oxidative stability. The results of this study showed that there were no significant differences in growth performance between the treatments throughout the experimental period. Conversely, along with our findings, ref. [37] observed higher chicken profitability and similar growth efficiency measures across all dietary regimens when essential oil blends were included as feed additives. The antioxidant properties of EO supplements, along with the regulation of digestive enzyme activity, may support intestinal function and consequently higher nutrient utilization, leading to superior growth rates [38]. Earlier research has discussed similar results with no negative effects on ADFI or BW that were observed for Ross broilers that received DW supplemented with a total of two types of Mexican OEO at 400 mg/L [27]. Variability in EO dosage, plant source, chemical composition, oil type, and environment could account for these differences in experimental findings.
Slaughter characteristics are an important performance indicator of meat production for both poultry and livestock, and are directly related to the profit of the chicken industry. The breast muscle index in the EOB250 group showed an increase compared to the CON group. This result is consistent with {Formatting Citation}, who found that a mixture of EO supplementation increased the carcass yield of birds, while other slaughter characteristics were not affected among treatments. EOs include carvacrol, which promotes pancreatic secretions, increasing digestive efficiency and the assimilation of nutrients. This process ultimately leads to higher carcass production [39]. The researchers believed an increase in valuable muscle mass was caused by EOs’ support of muscle development. However, other research has shown that EOs and organic acid supplementation did not affect the carcass characteristics in chickens [40]. The differences in EO composition and dosage levels could lead to variability in carcass traits observed in chickens fed with EOs.
Excessive amounts of lipids lead to a chronic disease known as hyperlipidemia, which increases the risk of developing heart disease and stroke [41]. Our experiment indicated that the EOB supplementation increased HDL content and decreased TG, TC, and LDL-C concentrations in both the liver and serum of the birds. This decrease helps to avoid metabolic diseases. The supplementation of EOs in diet was reported to decrease plasma TG levels and enhance HDL concentrations, adjust the FA composition profile of the breast muscle, decrease drip loss, and improve the meat quality of the chickens [42]. Therefore, we speculated that the potential function of the EOB in improving meat quality might relate to its regulation of the lipid metabolism. Studies show that the administration of an EOB to birds reduces serum TC concentrations, which may be associated with the inhibitory effects of the EO compounds on the activity of 3-hydroxy-3-methylglutaryl coenzyme A reductase, a key enzyme in the regulatory pathway of TC synthesis [43].
The sensory and physical characteristics of meat, including color, texture, and flavor, are critical factors influencing consumer consumption choices [44]. We studied how the EOB supplementation influenced the breast meat quality, and found that the EOB250 treatment significantly elevated the yellow intensity of the breast fillets. Various factors regulate the color of broiler meat, including myoglobin and other sarcoplasmic proteins (including hemoglobin, cytochromes, and catalases), diet, age, pH, breed, sex, and management practices [45]. The yellowness of the breast fillets was found to be higher when the chickens were given an EOB of cinnamaldehyde, thymol, and carvacrol [46]. In another study, it was reported that the inclusion of thymol, cinnamaldehyde, and carvacrol showed an increase in yellowness, with or without curcumin added [47]. Besides the enhancement of color, the WHC was improved by the EOB supplementation, with decreased cooking and drip loss. In agreement with our findings, ref. [48] also reported that thyme EO in a broiler diet improved the WHC and minimized drip loss, thereby increasing tenderness. This improvement seems to be directly related to an increased oxidative defense system in the muscle [49]. Therefore, oxidation is a natural process that will affect meat quality by changing its pigments, fats, and proteins, resulting in a reduction in its shelf-life reduction [50]. Free radicals generated during lipid oxidation disrupt the membrane structure by targeting unsaturated fatty acids, lipoproteins, and other components within the phospholipid bilayer of cell membranes. This damage increases membrane permeability, compromising cellular integrity. Maintaining the structural integrity of cell membranes can help restrict the production of free radicals, reduce oxidative reactions, decrease the leakage of sarcoplasmic fluid, and enhance the WHC [51,52]. EOs contain bioactive compounds, including phenolics and terpenoids, which exhibit medicinal properties by reducing oxidative stress in broilers [52]. The increased levels of T-AOC, CAT, and GSH-Px suggested that improvement of the WHC, a factor contributing to lower cooking loss of the chicken meat for the EOB-supplemented group, also came from improvement of the muscle antioxidant capacity. Furthermore, higher muscle redox status and muscle water retention ability may be considered additional factors that could help to achieve improved meat quality results [53].
Texture profile analysis, a widely used method, uses a double compression cycle to mimic chewing, enabling the analysis of textural properties in the chicken meat [54]. This study also contributes to the understanding of the texture profile of the meat, specifically examining the effects of the EOB addition on cohesiveness and resilience. The EOB has the potential to improve meat tenderness, according to the findings. Similar findings [55] showed that the meat of chickens raised on diets with oregano or anise EOs had improved tenderness and juiciness. Two types of Mexican OEO in DW were tested in broiler chickens, and they improved meat quality by reducing cooking loss and increasing cohesiveness and resilience [27]. Physicochemical characteristics of meat, in general, can enhance the quality of chicken meat making it more palatable to consumers.
The activity of antioxidant defense enzymes in the body that reflects the physiological response of an organism to oxidative stress is tightly related to the general state of health [56]. Our results suggested that the EOB supplementation can improve antioxidant activity by increasing the T-SOD, CAT, GSH-Px, and T-AOC of the serum, liver, and breast muscle in broiler chickens. Several studies have reported that EOs can improve the oxidative stability of chicken tissues [57]. This study also found that the EOB supplementation lowered MDA levels, a marker of oxidative stress, in the liver and breast muscle tissues. MDA is a byproduct of the peroxidation of PUFAs in cells, and its excessive formation is driven by an increase in free radicals [58]. Consistent with our findings, similar studies have reported that the inclusion of aromatic plant extracts enhances GPx activity and reduces MDA levels [59,60]. Additionally, a balance was observed between the levels of reactive oxygen species and antioxidants in the chickens. The absence of secondary lipid peroxidation (MDA) and protein oxidation suggests that the broilers exhibited a robust antioxidant defense capacity, which effectively interrupted oxidative reactions and contained ROS. This indicates a potential protective effect of the EOB against oxidative damage. Nrf2 is a transcription factor that is a master regulator of cell antioxidant defense pathways. It induces cells to activate the expression of antioxidant response elements that regulate the expression of genes that control oxidative stress [61]. Broilers fed with EOB250 had a significantly higher mRNA level of Nrf2, demonstrating the stimulation of their intrinsic antioxidant system. Nrf2 upregulation suggests that the EOB supplementation may trigger a defensive mechanism against oxidative damage, thereby enhancing meat quality and stability. This antioxidant effect is combined by synergistic actions of T-SOD and CAT, in addition to GSH-Px, which work together to prevent reactive oxygen species (ROS) from inducing oxidative stress to muscle tissues. This study revealed that some antioxidants in the EOB entered the blood, remained in tissues, and protected the body from oxidative stress by building antioxidant enzymes.
Meat from PUFA-rich diets, especially n-3 PUFAs, provides health-promoting benefits. However, Our findings demonstrated that the PUFA content of muscle increased when the EOB was administered. The observed changes in fatty acid composition may be associated with the antioxidant properties of plant-derived compounds, such as flavonoids and terpenoids, and/or their ability to modify the gut microbial community [62,63], as well as the reduction of biohydrogenation of unsaturated fatty acids, which led to an increase in the PUFA/SFA rate [64]. Moreover, an upregulation of the expression of FADS2 mRNA in birds supplied with the EOB was also detected, indicating that in birds receiving the EOB, the rise in PUFA levels was associated with upregulation of the FADS2 pathway for PUFA synthesis. In the lipid metabolic pathway, FADS2 is responsible for desaturating the FAs linoleate and alpha-linolenate into PUFAs [65]. Moreover, the birds that were supplemented with EOB250 and EOB350 had less SFA fractions, as shown by decreased C14:0, C16:0, and C18:0 contents. SFA is suggested to promote high levels of LDL-C and TC [66]. Consuming more SFAs in diets might lead to the hypercholesterolemic effects associated with coronary artery disease [67].
Meat health indices are valuable for analyzing the influence of a dietary FA profile on susceptibility to common chronic diseases. These indices are more cost-effective than lengthy laboratory procedures [68]. Whereas SFAs have been shown to have pro-inflammatory effects, EPA and DHA are considered anti-inflammatory [69]. The UI indicator for the level of unsaturation of FAs causing its structure, which is useful for assessing oxidative stability and suggesting possible oxidative protection approaches for livestock feed [70]. Also, the PI evaluates the stability of PUFAs in food, contributing to the prevention of oxidation processes [71]. In the relationship to health, NVI gives information about possible health consequences of the lipid profiles that positively correlate with the quality of the FAs [72]. More consistent with our findings, the elevated amounts of EPA + DHA, UI, and PI in the supplemented groups indicated a positive impact of the EOB supplementation on the health-promoting properties of chicken meat. IA and TI indices and h/H are good indicators of lipid health and nutritional quality. A lower IA and TI indicate a healthier fatty acid profile, which decreases the risk of platelet clumping and coronary diseases, while a high h/H ratio denotes a better quality of nutrition [73]. The EOB supplementation reduced TI and IA while elevating h/H in meat, indicating improved meat quality; it was demonstrated herein that the EOB350 and EOB250 levels of supplementation were the most effective treatment among the supported levels. Additionally, DFA, FLQ, and NVI serve as key markers of the overall health-promoting properties of the meat [36]. These results indicate that the EOB supplementation can improve meat quality, usually by modifying the FA profile in the breast meat, which is beneficial for consumer health.
To analyze the molecular mechanisms that led to alterations in the FA profile, we measured the expression of key genes associated with the liver lipid metabolism. A transcription factor, SREBP-1c, regulates genes associated with FA and TG synthesis, like SCD, FAS, and ACC [74]. In our study, the mRNA abundance level of SREBP-1c was reduced in the EOB-treated chickens compared to the CON, which was supported with lower levels of blood TG and TC. The activity of the EOB reduced blood TC and TG levels in experimental groups, which was related to decreased expression of FAS and ACC, especially in the EOB-treated groups. Another study reported similar findings, which revealed that carvacrol inhibits fat accumulation by downregulating SREBP-1c and FAS, thereby inhibiting lipogenesis and increasing CPT1 expression to promote FA oxidation in high-fat diet-fed mice [75]. PPARγ is a nuclear receptor required for adipogenesis and acts by recruiting C/EBPα to generate a transcriptional complex regulating adipocyte differentiation and lipid storage [76]. In the present study, PPARγ mRNA expression level was higher in the CON group than the EOB250. This finding follows other studies [77] that cinnamaldehyde inhibits the development of adipocytes and modulates adipose tissue metabolism by downregulating PPARγ and C/EBPα. This regulation leads to the prevention of adipocyte differentiation and fat accumulation. Cinnamaldehyde also restricted the expression of SREBP-1c and FAS, which can also inhibit FA synthesis and lipid storage.
To further understand the impact of the EOB on lipid metabolism, we assessed the expression level of enzymes involved in FA catabolism in liver tissue. PPARα regulates numerous metabolic processes that facilitate cellular uptake of FA and metabolism via FA β-oxidation, ultimately promoting cellular respiration [78], including expression of CPT1, which is responsible for FA transport into mitochondria for β-oxidation. ACOX1 is another important enzyme for FA catabolism in the peroxisome, which is considered a rate-limiting step during peroxisomal β-oxidation [78]. In this study, supplementation of the EOB increased the mRNA expression of PPARα, ACOX1, and CPT1 in liver tissue compared to the CON. These results are in agreement with previous findings, which showed that cinnamon can upregulate PPARα gene expression in liver tissue while decreasing serum and liver TC levels as well as serum TG. Generally, these findings suggested that the EOB modulates FA β-oxidation, at least in part by activating the PPARα pathway, leading to enhanced FA β-oxidation [79]. To summarize, the EOB supplementation increased ABW, FCR, and breast weight compared to the CON, which may have a major economic impact on the industry.

5. Conclusions

This investigation revealed that supplementing drinking water with EOB250 and EOB350 improved breast fillet yellowness, WHC, and unsaturated fatty acid content while reducing drip loss and cooking loss. Additionally, these groups demonstrated enhanced lipid quality indices and antioxidant activity in the breast muscle. Moreover, EOB250 and EOB350 were found to regulate liver lipid metabolism by downregulating the expression of genes associated with fatty acid synthesis and upregulating those involved in fatty acid oxidation. These results indicate that EOB supplementation enhances the overall meat quality of broilers, making it more nutritionally beneficial. In conclusion, this study suggests that supplementing broiler drinking water with 250 mg/L of the EOB holds significant potential as an effective alternative water additive for the broiler industry.

Author Contributions

Conceptualization, M.K. and C.L.; methodology, M.K. and J.D.; validation, K.W., H.X. and S.L.; formal analysis, S.L. and D.S.; investigation, H.X.; resources, S.L. and D.S.; data curation, S.L. and D.S.; writing—original draft preparation, M.K.; writing—review and editing, M.K. and C.L.; visualization, D.S.; supervision, C.L.; project administration, C.L.; funding acquisition, C.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the horizontal project of the Nanjing Agricultural University (No. 2023320122000131).

Institutional Review Board Statement

The Nanjing Agricultural University Animal Ethics Committee approved all the animal procedures (SYXK(SU) 2022-0031).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

The authors thank every member who helped during the experiment.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Castro, F.L.S.; Chai, L.; Arango, J.; Owens, C.M.; Smith, P.A.; Reichelt, S.; DuBois, C.; Menconi, A. Poultry Industry Paradigms: Connecting the Dots. J. Appl. Poult. Res. 2023, 32, 100310. [Google Scholar] [CrossRef] [Scilit]
  2. Yang, W.; Li, J.; Yao, Z.; Li, M. A Review on the Alternatives to Antibiotics and the Treatment of Antibiotic Pollution: Current Development and Future Prospects. Sci. Total Environ. 2024, 926, 171757. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Dibner, J.J.; Richards, J.D. Antibiotic Growth Promoters in Agriculture: History and Mode of Action. Poult. Sci. 2005, 84, 634–643. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Kamal, M.; Aljahdali, N.; Jaber, F.A.; Majrashi, K.A.; Kishk, W.H.; Khalil, H.A.; Abdel-Khalek, A.M.; Ayoub, M.A.; Abd El-Hack, M.E. Influence of Dietary Chitosan Supplementation on Ovarian Development and Reproductive Performance of New Zealand White Rabbit Does. Ann. Anim. Sci. 2023, 23, 757–764. [Google Scholar] [CrossRef] [Scilit]
  5. Abd El-Hack, M.E.; Ashour, E.A.; Aljahdali, N.; Zabermawi, N.M.; Baset, S.A.; Kamal, M.; Radhi, K.S.; Moustafa, M.; Algopishi, U.; Alshaharni, M.O.; et al. Does the Dietary Supplementation of Organic Nano-Zinc as a Growth Promoter Impact Broiler’s Growth, Carcass and Meat Quality Traits, Blood Metabolites and Cecal Microbiota? Poult. Sci. 2024, 103, 103550. [Google Scholar] [CrossRef] [Scilit]
  6. Zhang, L.; Gao, F.; Ge, J.; Li, H.; Xia, F.; Bai, H.; Piao, X.; Shi, L. Potential of Aromatic Plant-Derived Essential Oils for the Control of Foodborne Bacteria and Antibiotic Resistance in Animal Production: A Review. Antibiotics 2022, 11, 1673. [Google Scholar] [CrossRef] [Scilit]
  7. López, L.B. Oregano Essential Oils as a Nutraceutical Additive in Poultry Diets. In Essential Oils-Recent Advances, New Perspectives and Applications; IntechOpen: London, UK, 2023. [Google Scholar]
  8. Zhang, L.; Wang, X.; Huang, S.; Huang, Y.; Shi, H.; Bai, X. Effects of Dietary Essential Oil Supplementation on Growth Performance, Carcass Yield, Meat Quality, and Intestinal Tight Junctions of Broilers with or without Eimeria Challenge. Poult. Sci. 2023, 102, 102874. [Google Scholar] [CrossRef] [Scilit]
  9. Movahedi, F.; Nirmal, N.; Wang, P.; Jin, H.; Grøndahl, L.; Li, L. Recent Advances in Essential Oils and Their Nanoformulations for Poultry Feed. J. Anim. Sci. Biotechnol. 2024, 15, 110. [Google Scholar] [CrossRef] [Scilit]
  10. Silva-Vázquez, R.; Duran-Meléndez, L.A.; Hernández-Martínez, C.A.; Gutiérrez-Soto, J.G.; Hume, M.E.; Méndez-Zamora, G. Effects of Two Sources of Mexican Oregano Oil on Performance, Blood Profile, Carcass Variables, and Meat of Broilers. Rev. Bras. Zootec. 2018, 47, e20170198. [Google Scholar] [CrossRef] [Scilit]
  11. Wang, L.; Zhang, Y.; Fan, G.; Ren, J.; Zhang, L.; Pan, S. Effects of Orange Essential Oil on Intestinal Microflora in Mice. J. Sci. Food Agric. 2019, 99, 4019–4028. [Google Scholar] [CrossRef] [Scilit]
  12. Rimini, S.; Petracci, M.; Smith, D.P. The Use of Thyme and Orange Essential Oils Blend to Improve Quality Traits of Marinated Chicken Meat. Poult. Sci. 2014, 93, 2096–2102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Qaid, M.M.; Al-Mufarrej, S.I.; Azzam, M.M.; Al-Garadi, M.A.; Alqhtani, A.H.; Al-abdullatif, A.A.; Hussein, E.O.; Suliman, G.M. Dietary Cinnamon Bark Affects Growth Performance, Carcass Characteristics, and Breast Meat Quality in Broiler Infected with Eimeria Tenella Oocysts. Animals 2022, 12, 166. [Google Scholar] [CrossRef] [Scilit]
  14. Ashour, E.A.; Aldhalmi, A.K.; Ismail, I.E.; Kamal, M.; Elolimy, A.A.; Swelum, A.A.; Abd El-Hack, M.E. The Effect of Using Echinacea Extract as an Immune System Stimulant and Antioxidant on Blood Indicators, Growth Efficiency, and Carcass Characteristics in Broiler Chickens to Produce a Healthy Product. Poult. Sci. 2025, 104, 104392. [Google Scholar] [PubMed]
  15. Agus, A.; Anas, M.A.; Luthfiana, R.; Hidayat, A.A. Effect of Blend of Natural Essential Oils Addition in the Drinking Water on Productivity, Carcass Yield and Meat Quality of Broiler. IOP Conf. Ser. Earth Environ. Sci. 2019, 387, 012078. [Google Scholar] [CrossRef] [Scilit]
  16. Jimoh, O.A.; Akinleye, S.B.; Simon, C.J.; Kayode, A.O.; Akande, M.O.; Ogunjobi, T.E.; Tijani, L.T.; Ayileye, K.T. Oxidative Stability in Meat (Pectoralis Major) of Broiler Orally Supplemented with Essential Oils of Allium Sativum, Curcuma Longa, Zingiber Officinale, and Cinnamomum Zeylanicum. Transl. Anim. Sci. 2024, 8, txae073. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Righi, F.; Pitino, R.; Manuelian, C.L.; Simoni, M.; Quarantelli, A.; De Marchi, M.; Tsiplakou, E. Plant Feed Additives as Natural Alternatives to the Use of Synthetic Antioxidant Vitamins on Poultry Performances, Health, and Oxidative Status: A Review of the Literature in the Last 20 Years. Antioxidants 2021, 10, 659. [Google Scholar] [CrossRef] [Scilit]
  18. Adil, S.; Banday, M.T.; Hussain, S.A.; Wani, M.A.; Al-Olayan, E.; Patra, A.K.; Rasool, S.; Gani, A.; Sheikh, I.U.; Khan, A.A.; et al. Impact of Nanoencapsulated Rosemary Essential Oil as a Novel Feed Additive on Growth Performance, Nutrient Utilization, Carcass Traits, Meat Quality and Gene Expression of Broiler Chicken. Foods 2024, 13, 1515. [Google Scholar] [CrossRef] [Scilit]
  19. Abd El-Hack, M.E.; El-Saadony, M.T.; Saad, A.M.; Salem, H.M.; Ashry, N.M.; Abo Ghanima, M.M.; Shukry, M.; Swelum, A.A.; Taha, A.E.; El-Tahan, A.M.; et al. Essential Oils and Their Nanoemulsions as Green Alternatives to Antibiotics in Poultry Nutrition: A Comprehensive Review. Poult. Sci. 2022, 101, 101584. [Google Scholar] [CrossRef] [Scilit]
  20. Srnic, N.; Westcott, F.; Caney, E.; Hodson, L. Dietary Fat Quantity and Composition Influence Hepatic Lipid Metabolism and Metabolic Disease Risk in Humans. Dis. Model. Mech. 2025, 18, dmm050878. [Google Scholar] [CrossRef] [Scilit]
  21. Shimizu, H.; Iwamoto, S. Problems of Lipid Oxidation in Minced Meat Products for a Ready-Made Meal during Cooking, Processing, and Storage. Rev. Agric. Sci. 2022, 10, 24–35. [Google Scholar] [CrossRef] [Scilit]
  22. Marçal, J.O.; Oliveira, G.P.; Geraldo, A.; Lima, L.M.Z.; Erasmus, S.W.; Faria, P.B. Sexual Maturity, Slaughter Age, and Sex on Meat Fatty Acid Composition of Chickens Raised in a Free-Range System. J. Food Compos. Anal. 2024, 131, 106218. [Google Scholar] [CrossRef] [Scilit]
  23. Ewais, O.; Abdel-Tawab, H.; El-Fayoumi, H.; Aboelhadid, S.M.; Al-Quraishy, S.; Falkowski, P.; Abdel-Baki, A.-A.S. Antioxidant Properties of D-Limonene and Its Nanoemulsion Form Enhance Its Anticoccidial Efficiency in Experimentally Infected Broilers with Eimeria Tenella: An in Vitro and in Vivo Study. Vet. Res. Commun. 2024, 48, 3711–3725. [Google Scholar]
  24. Zhang, H.; Huang, T.; Liao, X.; Zhou, Y.; Chen, S.; Chen, J.; Xiong, W. Extraction of Camphor Tree Essential Oil by Steam Distillation and Supercritical CO2 Extraction. Molecules 2022, 27, 5385. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Hashemipour, H.; Kermanshahi, H.; Golian, A.; Veldkamp, T. Metabolism and Nutrition: Effect of Thymol and Carvacrol Feed Supplementation on Performance, Antioxidant Enzyme Activities, Fatty Acid Composition, Digestive Enzyme Activities, and Immune Response in Broiler Chickens. Poult. Sci. 2013, 92, 2059–2069. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Chhaganlal, S.A. Effect of Lemon and Orange Peel Essential Oils on Performance of Broilers During Summer Season. Ph.D. Thesis, Maharashtra Animal and Fishery Sciences University, Nagpur, India, 2018. [Google Scholar]
  27. Hernández-Coronado, A.C.; Silva-Vázquez, R.; Rangel-Nava, Z.E.; Hernández-Martínez, C.A.; Kawas-Garza, J.R.; Hume, M.E.; Méndez-Zamora, G. Mexican Oregano Essential Oils given in Drinking Water on Performance, Carcass Traits, and Meat Quality of Broilers. Poult. Sci. 2019, 98, 3050–3058. [Google Scholar] [CrossRef] [Scilit]
  28. Ledesma, E.; Laca, A.; Rendueles, M.; Díaz, M. Texture, Colour and Optical Characteristics of a Meat Product Depending on Smoking Time and Casing Type. LWT 2016, 65, 164–172. [Google Scholar] [CrossRef] [Scilit]
  29. Hamm, R. Biochemistry of Meat Hydratation. Adv. Food Res. 1960, 10, 335–443. [Google Scholar]
  30. Tang, H.; Gong, Y.Z.; Wu, C.X.; Jiang, J.; Wang, Y.; Li, K. Variation of Meat Quality Traits among Five Genotypes of Chicken. Poult. Sci. 2009, 88, 2212–2218. [Google Scholar] [CrossRef] [Scilit]
  31. Dondero, M.; Figueroa, V.; Morales, X.; Curotto, E. Transglutaminase Effects on Gelation Capacity of Thermally Induced Beef Protein Gels. Food Chem. 2006, 99, 546–554. [Google Scholar] [CrossRef] [Scilit]
  32. Bian, T.; Xing, T.; Zhao, X.; Xu, X. Effects of Wooden Breast Myopathy on Meat Quality Characteristics of Broiler Pectoralis Major Muscle and Its Changes with Intramuscular Connective Tissue. Foods 2024, 13, 507. [Google Scholar] [CrossRef] [Scilit]
  33. Folch, J.; Lees, M.; Sloane Stanley, G.H. A Simple Method for the Isolation and Purification of Total Lipides from Animal Tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef] [Scilit]
  34. Luo, H.F.; Wei, H.K.; Huang, F.R.; Zhou, Z.; Jiang, S.W.; Peng, J. The Effect of Linseed on Intramuscular Fat Content and Adipogenesis Related Genes in Skeletal Muscle of Pigs. Lipids 2009, 44, 999–1010. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Kumar, F.; Tyagi, P.K.; Mir, N.A.; Dev, K.; Begum, J.; Biswas, A.; Sheikh, S.A.; Tyagi, P.K.; Sharma, D.; Sahu, B.; et al. Dietary Flaxseed and Turmeric Is a Novel Strategy to Enrich Chicken Meat with Long Chain Ømega-3 Polyunsaturated Fatty Acids with Better Oxidative Stability and Functional Properties. Food Chem. 2020, 305, 125458. [Google Scholar] [CrossRef] [Scilit]
  36. Dal Bosco, A.; Cartoni Mancinelli, A.; Vaudo, G.; Cavallo, M.; Castellini, C.; Mattioli, S. Indexing of Fatty Acids in Poultry Meat for Its Characterization in Healthy Human Nutrition: A Comprehensive Application of the Scientific Literature and New Proposals. Nutrients 2022, 14, 3110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Dong, Y.; Gao, X.; Qiao, C.; Han, M.; Miao, Z.; Liu, C.; Yan, L.; Li, J. Effects of Mixed Organic Acids and Essential Oils in Drinking Water on Growth Performance, Intestinal Digestive Capacity, and Immune Status in Broiler Chickens. Animals 2024, 14, 2160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Meligy, A.M.A.; El-Hamid, M.I.A.; Yonis, A.E.; Elhaddad, G.Y.; Abdel-Raheem, S.M.; El-Ghareeb, W.R.; Mohamed, M.H.A.; Ismail, H.; Ibrahim, D. Liposomal Encapsulated Oregano, Cinnamon, and Clove Oils Enhanced the Performance, Bacterial Metabolites Antioxidant Potential, and Intestinal Microbiota of Broiler Chickens. Poult. Sci. 2023, 102, 102683. [Google Scholar] [CrossRef] [Scilit]
  39. Su, G.; Wang, L.; Zhou, X.; Wu, X.; Chen, D.; Yu, B.; Huang, Z.; Luo, Y.; Mao, X.; Zheng, P.; et al. Effects of Essential Oil on Growth Performance, Digestibility, Immunity, and Intestinal Health in Broilers. Poult. Sci. 2021, 100, 101242. [Google Scholar] [CrossRef] [Scilit]
  40. Adewole, D.I.; Oladokun, S.; Santin, E. Effect of Organic Acids–Essential Oils Blend and Oat Fiber Combination on Broiler Chicken Growth Performance, Blood Parameters, and Intestinal Health. Anim. Nutr. 2021, 7, 1039–1051. [Google Scholar] [CrossRef] [Scilit]
  41. Wassie, T.; Cheng, B.; Zhou, T.; Gao, L.; Lu, Z.; Wang, J.; Mulu, B.; Taye, M.; Wu, X. Enteromorpha Polysaccharide and Yeast Glycoprotein Mixture Improves Growth, Antioxidant Activity, Serum Lipid Profile and Regulates Lipid Metabolism in Broiler Chickens. Poult. Sci. 2022, 101, 102064. [Google Scholar] [CrossRef] [Scilit]
  42. Yu, C.; Zhang, J.; Li, Q.; Xiang, X.; Yang, Z.; Wang, T. Effects of Trans-Anethole Supplementation on Serum Lipid Metabolism Parameters, Carcass Characteristics, Meat Quality, Fatty Acid, and Amino Acid Profiles of Breast Muscle in Broiler Chickens. Poult. Sci. 2021, 100, 101484. [Google Scholar] [CrossRef] [Scilit]
  43. Khattak, F.; Ronchi, A.; Castelli, P.; Sparks, N. Effects of Natural Blend of Essential Oil on Growth Performance, Blood Biochemistry, Cecal Morphology, and Carcass Quality of Broiler Chickens. Poult. Sci. 2014, 93, 132–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Cardona, M.; Izquierdo, D.; Barat, J.M.; Fernández-Segovia, I. Intrinsic and Extrinsic Attributes That Influence Choice of Meat and Meat Products: Techniques Used in Their Identification. Eur. Food Res. Technol. 2023, 249, 2485–2514. [Google Scholar] [CrossRef] [Scilit]
  45. Mullenix, G.J.; Greene, E.S.; Ramser, A.; Maynard, C.; Dridi, S. Effect of a Microencapsulated Phyto/Phycogenic Blend Supplementation on Growth Performance, Processing Parameters, Meat Quality, and Sensory Profile in Male Broilers. Front. Vet. Sci. 2024, 11, 1382535. [Google Scholar] [CrossRef] [Scilit]
  46. Reis, J.H.; Gebert, R.R.; Barreta, M.; Baldissera, M.D.; dos Santos, I.D.; Wagner, R.; Campigotto, G.; Jaguezeski, A.M.; Gris, A.; de Lima, J.L.F.; et al. Effects of Phytogenic Feed Additive Based on Thymol, Carvacrol and Cinnamic Aldehyde on Body Weight, Blood Parameters and Environmental Bacteria in Broilers Chickens. Microb. Pathog. 2018, 125, 168–176. [Google Scholar] [CrossRef] [Scilit]
  47. Galli, G.M.; Gerbet, R.R.; Griss, L.G.; Fortuoso, B.F.; Petrolli, T.G.; Boiago, M.M.; Souza, C.F.; Baldissera, M.D.; Mesadri, J.; Wagner, R.; et al. Combination of Herbal Components (Curcumin, Carvacrol, Thymol, Cinnamaldehyde) in Broiler Chicken Feed: Impacts on Response Parameters, Performance, Fatty Acid Profiles, Meat Quality and Control of Coccidia and Bacteria. Microb. Pathog. 2020, 139, 103916. [Google Scholar] [CrossRef] [Scilit]
  48. Puvača, N.; Tufarelli, V.; Giannenas, I. Essential Oils in Broiler Chicken Production, Immunity and Meat Quality: Review of Thymus Vulgaris, Origanum Vulgare, and Rosmarinus Officinalis. Agriculture 2022, 12, 874. [Google Scholar] [CrossRef] [Scilit]
  49. Morrissey, P.A.; Sheehy, P.J.A.; Galvin, K.; Kerry, J.P.; Buckley, D.J. Lipid Stability in Meat and Meat Products. Meat Sci. 1998, 49, S73–S86. [Google Scholar] [CrossRef]
  50. Cheng, Q.; Sun, D.-W. Factors Affecting the Water Holding Capacity of Red Meat Products: A Review of Recent Research Advances. Crit. Rev. Food Sci. Nutr. 2008, 48, 137–159. [Google Scholar] [CrossRef] [Scilit]
  51. He, P.; Lei, Y.; Zhang, K.; Zhang, R.; Bai, Y.; Li, Z.; Jia, L.; Shi, J.; Cheng, Q.; Ma, Y.; et al. Dietary Oregano Essential Oil Supplementation Alters Meat Quality, Oxidative Stability, and Fatty Acid Profiles of Beef Cattle. Meat Sci. 2023, 205, 109317. [Google Scholar] [CrossRef] [Scilit]
  52. Brenes, A.; Roura, E. Essential Oils in Poultry Nutrition: Main Effects and Modes of Action. Anim. Feed Sci. Technol. 2010, 158, 1–14. [Google Scholar]
  53. Carvalho, R.H.; Ida, E.I.; Madruga, M.S.; Martínez, S.L.; Shimokomaki, M.; Estévez, M. Underlying Connections between the Redox System Imbalance, Protein Oxidation and Impaired Quality Traits in Pale, Soft and Exudative (PSE) Poultry Meat. Food Chem. 2017, 215, 129–137. [Google Scholar] [CrossRef] [Scilit]
  54. Xiong, R.; Cavitt, L.C.; Meullenet, J.F.; Owens, C.M. Comparison of Allo-Kramer, Warner-Bratzler and Razor Blade Shears for Predicting Sensory Tenderness of Broiler Breast Meat. J. Texture Stud. 2006, 37, 179–199. [Google Scholar] [CrossRef] [Scilit]
  55. Hong, J.C.; Steiner, T.; Aufy, A.; Lien, T.F. Effects of Supplemental Essential Oil on Growth Performance, Lipid Metabolites and Immunity, Intestinal Characteristics, Microbiota and Carcass Traits in Broilers. Livest. Sci. 2012, 144, 253–262. [Google Scholar] [CrossRef] [Scilit]
  56. Anetor, G.O.; Nwobi, N.L.; Igharo, G.O.; Sonuga, O.O.; Anetor, J.I. Environmental Pollutants and Oxidative Stress in Terrestrial and Aquatic Organisms: Examination of the Total Picture and Implications for Human Health. Front. Physiol. 2022, 13, 931386. [Google Scholar] [CrossRef] [Scilit]
  57. Yarmohammadi Barbarestani, S.; Jazi, V.; Mohebodini, H.; Ashayerizadeh, A.; Shabani, A.; Toghyani, M. Effects of Dietary Lavender Essential Oil on Growth Performance, Intestinal Function, and Antioxidant Status of Broiler Chickens. Livest. Sci. 2020, 233, 103958. [Google Scholar] [CrossRef] [Scilit]
  58. Gaweł, S.; Wardas, M.; Niedworok, E.; Wardas, P. Malondialdehyde (MDA) as a Lipid Peroxidation Marker. Wiadomosci Lek. Wars. Pol. 1960 2004, 57, 453–455. [Google Scholar]
  59. Ashour, E.A.; Aldhalmi, A.K.; Kamal, M.; Salem, S.S.; Mahgoub, S.A.; Alqhtani, A.H.; Madkour, M.; Elolimy, A.A.; Abd El-Hack, M.E.; Swelum, A.A. The Efficacy of Artichoke Leaf Extract Conjugated with Organic Zinc Nanoparticles on Growth, Carcass Traits and Blood Biochemical Parameters of Broilers. Poult. Sci. 2025, 104, 104521. [Google Scholar]
  60. El-Abbasy, M.M.; Aldhalmi, A.K.; Ashour, E.A.; Bassiony, S.S.; Kamal, M.; Alqhtani, A.H.; Abou-Kassem, D.E.; Elolimy, A.A.; Abd El-Hack, M.E.; Swelum, A.A. Enhancing Broiler Growth and Carcass Quality: Impact of Diets Enriched with Moringa Oleifera Leaf Powder Conjugated with Zinc Nanoparticles. Poult. Sci. 2025, 104, 104519. [Google Scholar]
  61. Rajput, S.A.; Zhang, C.; Feng, Y.; Wei, X.T.; Khalil, M.M.; Rajput, I.R.; Baloch, D.M.; Shaukat, A.; Rajput, N.; Qamar, H.; et al. Proanthocyanidins Alleviates AflatoxinB1-Induced Oxidative Stress and Apoptosis through Mitochondrial Pathway in the Bursa of Fabricius of Broilers. Toxins 2019, 11, 157. [Google Scholar] [CrossRef] [Scilit]
  62. Oppedisano, F.; Macrì, R.; Gliozzi, M.; Musolino, V.; Carresi, C.; Maiuolo, J.; Bosco, F.; Nucera, S.; Caterina Zito, M.; Guarnieri, L.; et al. The Anti-Inflammatory and Antioxidant Properties of n-3 PUFAs: Their Role in Cardiovascular Protection. Biomedicines 2020, 8, 306. [Google Scholar] [CrossRef] [Scilit]
  63. Kürekci, C.; Özsoy, B.; Hassan, E.; Özkan, H.; Gundoğdu, A.; Özsoy, Ş.Y.; Yakan, A. Effect of Essential Oil Supplementation to Diet on Meat Quality, Fatty Acid Composition, Performance Parameters and Intestinal Microbiota of Japanese Quails. J. Anim. Physiol. Anim. Nutr. 2021, 105, 927–937. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Verge-Mèrida, G.; Solà-Oriol, D.; Tres, A.; Verdú, M.; Farré, G.; Garcés-Narro, C.; Barroeta, A.C. Olive Pomace Oil and Acid Oil as Alternative Fat Sources in Growing-Finishing Broiler Chicken Diets. Poult. Sci. 2022, 101, 102079. [Google Scholar] [CrossRef] [Scilit]
  65. Yang, X.; Xin, H.; Yang, C.; Yang, X. Impact of Essential Oils and Organic Acids on the Growth Performance, Digestive Functions and Immunity of Broiler Chickens. Anim. Nutr. 2018, 4, 388–393. [Google Scholar] [CrossRef] [Scilit]
  66. Ye, Z.; Li, R.; Cao, C.; Xu, Y.J.; Cao, P.; Li, Q.; Liu, Y. Fatty Acid Profiles of Typical Dietary Lipids after Gastrointestinal Digestion and Absorbtion: A Combination Study between in-Vitro and in-Vivo. Food Chem. 2019, 280, 34–44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Hammad, S.; Pu, S.; Jones, P.J. Current Evidence Supporting the Link Between Dietary Fatty Acids and Cardiovascular Disease. Lipids 2016, 51, 507–517. [Google Scholar] [CrossRef] [Scilit]
  68. Mattioli, S.; Margarida, J.; Duarte, M.; Castellini, C.; Amato, R.D.; Regni, L.; Proietti, P.; Businelli, D.; Cotozzolo, E.; Rodrigues, M.; et al. Use of Olive Leaves (Whether or Not Forti Fi Ed with Sodium Selenate) in Rabbit Feeding: E Ff Ect on Performance, Carcass and Meat Characteristics, and Estimated Indexes of Fatty Acid Metabolism. Meat Sci. 2018, 143, 230–236. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  69. Minihane, A.M.; Vinoy, S.; Russell, W.R.; Baka, A.; Roche, H.M.; Tuohy, K.M.; Teeling, J.L.; Blaak, E.E.; Fenech, M.; Vauzour, D.; et al. Low-Grade Inflammation, Diet Composition and Health: Current Research Evidence and Its Translation. Br. J. Nutr. 2015, 114, 999–1012. [Google Scholar] [CrossRef] [Scilit]
  70. Fereidoon, S.; Ying, Z. Lipid Oxidation and Improving the Oxidative Stability. Chem. Soc. Rev. 2010, 39, 4067–4079. [Google Scholar] [CrossRef] [Scilit]
  71. Zula, A.T.; Desta, D.T. Fatty Acid-Related Health Lipid Index of Raw and Fried Nile Tilapia (Oreochromis niloticus) Fish Muscle. J. Food Qual. 2021, 2021, 6676528. [Google Scholar] [CrossRef] [Scilit]
  72. Wereńska, M.; Wołoszyn, J.; Okruszek, A.; Marcinkowska, W.; Haraf, G. The Effects of Sous-Vide, Microwave Cooking and Stewing of Goose Meat on Fatty Acid Profile and Lipid Indices. Poult. Sci. 2023, 102, 102337. [Google Scholar] [CrossRef] [Scilit]
  73. Gou, Z.Y.; Cui, X.Y.; Li, L.; Fan, Q.L.; Lin, X.J.; Wang, Y.B.; Jiang, Z.Y.; Jiang, S.Q. Effects of Dietary Incorporation of Linseed Oil with Soybean Isoflavone on Fatty Acid Profiles and Lipid Metabolism-Related Gene Expression in Breast Muscle of Chickens. Animal 2020, 14, 2414–2422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  74. Ferré, P.; Phan, F.; Foufelle, F. SREBP-1c and Lipogenesis in the Liver: An Update. Biochem. J. 2021, 478, 3723–3739. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  75. Kim, E.; Choi, Y.; Jang, J.; Park, T. Carvacrol Protects against Hepatic Steatosis in Mice Fed a High-Fat Diet by Enhancing SIRT1-AMPK Signaling. Evid. Based Complement. Alternat. Med. 2013, 2013, 290104. [Google Scholar] [CrossRef] [Scilit]
  76. Boughanem, H.; Cabrera-Mulero, A.; Millán-Gómez, M.; Garrido-Sánchez, L.; Cardona, F.; Tinahones, F.J.; Moreno-Santos, I.; Macías-González, M. Transcriptional Analysis of FOXO1, C/EBP-α and PPAR-Γ2 Genes and Their Association with Obesity-Related Insulin Resistance. Genes 2019, 10, 706. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  77. Zhu, R.; Liu, H.; Liu, C.; Wang, L.; Ma, R.; Chen, B.; Li, L.; Niu, J.; Fu, M.; Zhang, D.; et al. Cinnamaldehyde in Diabetes: A Review of Pharmacology, Pharmacokinetics and Safety. Pharmacol. Res. 2017, 122, 78–89. [Google Scholar] [CrossRef] [Scilit]
  78. Hu, P.; Li, K.; Peng, X.; Kan, Y.; Li, H.; Zhu, Y.; Wang, Z.; Li, Z.; Liu, H.-Y.; Cai, D. Nuclear Receptor PPARα as a Therapeutic Target in Diseases Associated with Lipid Metabolism Disorders. Nutrients 2023, 15, 4772. [Google Scholar] [CrossRef] [Scilit]
  79. Ali, S.; Ismail, A.; Abdel-Hafez, S.; El-Genaidy, H. The Protective Effect of Cinnamon against Thermally Oxidized Palm Oil in Broiler Chickens. Egypt. Acad. J. Biol. Sci. C Physiol. Mol. Biol. 2020, 12, 23–39. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Effects of essential oils blend on biochemical indices in the serum and liver of broilers. Results are expressed as means ± standard error of the mean (SEM). a–b Mean values above the column carrying various letters vary statistically (p < 0.05). (A1A4) the serum biochemical indices and (B1B4) the liver biochemical indices TG: triglyceride; TC: total cholesterol; LDL-C: low-density lipoprotein-cholesterol; HDL-C: high-density lipoprotein cholesterol. CON = control drinking water (without EOB); EOB150 = DW + 150 mg/L EOB; EOB250 = DW + 250 mg/L EOB; EOB350 = DW + 350 mg/L EOB.
Figure 1. Effects of essential oils blend on biochemical indices in the serum and liver of broilers. Results are expressed as means ± standard error of the mean (SEM). a–b Mean values above the column carrying various letters vary statistically (p < 0.05). (A1A4) the serum biochemical indices and (B1B4) the liver biochemical indices TG: triglyceride; TC: total cholesterol; LDL-C: low-density lipoprotein-cholesterol; HDL-C: high-density lipoprotein cholesterol. CON = control drinking water (without EOB); EOB150 = DW + 150 mg/L EOB; EOB250 = DW + 250 mg/L EOB; EOB350 = DW + 350 mg/L EOB.
Animals 15 00929 g001
Figure 2. Effects of essential oils blend on meat texture analysis of chicken breast muscle. Results are expressed as means ± standard error of the mean (SEM). a,b Mean values above the column carrying various letters vary statistically (p < 0.05). (A) Hardness, (B) Springiness, (C) Resilience, (D) Cohesiveness, (E) Gumminess, And (F) Chewiness CON = control drinking water (without EOB); EOB150 = DW + 150 mg/L EOB; EOB250 = DW + 250 mg/L EOB; EOB350 = DW + 350 mg/L EOB.
Figure 2. Effects of essential oils blend on meat texture analysis of chicken breast muscle. Results are expressed as means ± standard error of the mean (SEM). a,b Mean values above the column carrying various letters vary statistically (p < 0.05). (A) Hardness, (B) Springiness, (C) Resilience, (D) Cohesiveness, (E) Gumminess, And (F) Chewiness CON = control drinking water (without EOB); EOB150 = DW + 150 mg/L EOB; EOB250 = DW + 250 mg/L EOB; EOB350 = DW + 350 mg/L EOB.
Animals 15 00929 g002
Figure 3. Effects of essential oils blend on the antioxidant capacity of broilers. Results are expressed as means ± standard error of the mean (SEM). a,b Mean values above the column carrying various letters vary statistically (p < 0.05). (A1A5) Effect of the EOB on serum antioxidant enzyme activities. (B1B5) Effect of the EOB on liver antioxidant enzyme activities. (C1C5) Effect of the EOB on antioxidant enzyme activities. Abbreviations: T-AOC: total antioxidant capacity; CAT: catalase; T-SOD: total superoxide dismutase; GSH-Px: glutathione peroxidase; MDA: malondialdehyde. CON = control drinking water (without EOB); EOB150 = DW + 150 mg/L EOB; EOB250 = DW + 250 mg/L EOB; EOB350 = DW + 350 mg/L EOB.
Figure 3. Effects of essential oils blend on the antioxidant capacity of broilers. Results are expressed as means ± standard error of the mean (SEM). a,b Mean values above the column carrying various letters vary statistically (p < 0.05). (A1A5) Effect of the EOB on serum antioxidant enzyme activities. (B1B5) Effect of the EOB on liver antioxidant enzyme activities. (C1C5) Effect of the EOB on antioxidant enzyme activities. Abbreviations: T-AOC: total antioxidant capacity; CAT: catalase; T-SOD: total superoxide dismutase; GSH-Px: glutathione peroxidase; MDA: malondialdehyde. CON = control drinking water (without EOB); EOB150 = DW + 150 mg/L EOB; EOB250 = DW + 250 mg/L EOB; EOB350 = DW + 350 mg/L EOB.
Animals 15 00929 g003
Figure 4. The mRNA expression of antioxidant-related genes in the liver and breast muscle of the broilers. Results are expressed as means ± standard error of the mean (SEM). a,b Mean values above column carrying various letters vary statistically (p < 0.05). (A) liver antioxidant-related genes and (B) breast antioxidant-related genes. CON = control drinking water (without EOB); EOB150 = DW + 150 mg/L EOB; EOB250 = DW + 250 mg/L EOB; EOB350 = DW + 350 mg/L EOB.
Figure 4. The mRNA expression of antioxidant-related genes in the liver and breast muscle of the broilers. Results are expressed as means ± standard error of the mean (SEM). a,b Mean values above column carrying various letters vary statistically (p < 0.05). (A) liver antioxidant-related genes and (B) breast antioxidant-related genes. CON = control drinking water (without EOB); EOB150 = DW + 150 mg/L EOB; EOB250 = DW + 250 mg/L EOB; EOB350 = DW + 350 mg/L EOB.
Animals 15 00929 g004
Figure 5. The effect of essential oils blend on the mRNA expression levels of liver lipid metabolism-related genes in broilers. Results are expressed as means ± standard error of the mean (SEM). a,b Mean values above the column carrying various letters vary statistically (p < 0.05). (A) fatty acid synthesis and (B) fatty acid for catabolism and transporter. CON = control drinking water (without EOB); EOB150 = DW + 150 mg/L EOB; EOB250 = DW + 250 mg/L EOB; EOB350 = DW + 350 mg/L EOB.
Figure 5. The effect of essential oils blend on the mRNA expression levels of liver lipid metabolism-related genes in broilers. Results are expressed as means ± standard error of the mean (SEM). a,b Mean values above the column carrying various letters vary statistically (p < 0.05). (A) fatty acid synthesis and (B) fatty acid for catabolism and transporter. CON = control drinking water (without EOB); EOB150 = DW + 150 mg/L EOB; EOB250 = DW + 250 mg/L EOB; EOB350 = DW + 350 mg/L EOB.
Animals 15 00929 g005
Table 1. Ingredients and nutrient composition of basal diets.
Table 1. Ingredients and nutrient composition of basal diets.
Items1−21 d22−42 d
Ingredient (%)
Corn58.3664.22
Soybean meal31.2527.08
Soybean oil43
Corn gluten meal2.82.5
Limestone1.291.42
Dicalcium phosphate1.491.04
L-Lysine0.030.03
DL-Methionine0.230.16
Sodium chloride0.30.3
Premix 10.250.25
Total100100
Calculated composition
Metabolic energy MJ/kg12.6512.67
Crude protein, %2119
Crude ash, %68
Calcium, %0.91.1
Total phosphorus, %0.40.45
Methionine, %1.11.04
Lysine, %0.520.9
1 Premix provided per kilogram of diet: vitamin A (trans-retinyl acetate), 10,000 IU; vitamin D3 (cholecalciferol), 3000 IU; vitamin E (all-rac α-tocopherol), 30 IU; menadione, 1.3 mg; thiamin, 2.2 mg; riboflavin, 8 mg; nicotinamide, 40 mg; choline chloride, 600 mg; calcium pantothenate, 10 mg; pyridoxine. HCl, 4 mg; biotin, 0.04 mg; folicacid,1 mg; vitamin B12 (cobalamin), 0.013 mg; Fe (from ferrous sulfate), 80 mg; Cu (from copper sulfate), 8.0 mg; Mn (from manganese sulfate), 110 mg; Zn (from zinc oxide), 60 mg; I (from calcium iodate), 1.1 mg; Se (from sodium selenite), 0.3 mg.
Table 2. Primers used in the present study.
Table 2. Primers used in the present study.
GenePrimer Sequence (5′–3′)Accession No.
β-actinF: ACCGGACTGTTACCAACACCNM 205518.1
R: CCTGAGTCAAGCGCCAAAAG
CATF: GGTTCGGTGGGGTTGTCTTTNM_0,010,31215.1
R: CACCAGTGGTCAAGGCATCT
SODF: CCGGCTTGTCTGATGGAGATNM_205,064.1
R: TGCATCTTTTGGTCCACCGT
GSHF: GACCAACCCGCAGTACATCANM_0,012,77853.1
R: GAGGTGCGGGCTTTCCTTTA
NRF2F: GATGTCACCCTGCCCTTAGNM_205,117.1
R: CTGCCACCATGTTATTCC
SREBP-1cF: GCCCTCTGTGCCTTTGTCTTCXM_046927256.1
R: ACTCAGCCATGATGCTTCTTC
ACCF: TTGTGGCACAGAAGAGGGAANM_205505.1
R: GTTGGCACATGGAATGGCAG
FASF: AGAGGCTTTGAAGCTCGGACNM_205155.2
R: GGTGCCTGAATACTTGGGCT
FADS2F: AATTGAGCACCACCTGTTCCNM_001160428.2
R: TGGCACATAACGACTTCACC
SCDF: CATGGGCCATTCTGTGCTTNP_990221.2
R: GGCCATGGAGTTTGCAATAG
PPARγF: CCAAGGCAGCGGCAAAATAANM001001460
R: GTGCCCATAAATGATGGCCTAA
C/EBPαF: GACATCTGCGAGAACGAGCANM001031459
R: GCATGCCGTGGAAATCGAAA
PPARαF: AGTAAGCTCTCAGAAACTTTGTTGNM_001001464.1
R: AAGGTTGAAACAGAAGCCGC
ACOX1F: GCCAGGTGGACTTGGAAAGA NM_001012578
R: GCTGCCGTATAGGAACAATGAAG
CPT1F: ACAGCGAATGAAAGCAGGGTNM_0,010,31215.1
R: CACCAGTGGTCAAGGCATCT
LPLF: CCGATCCCGAAGCTGAGATGNM205282
R: ACATTCCTGTCACCGTCCAC
FABPF: AGAAGGCCAAGTGTATTGTTAACATNM_204192.3
R: GTGATGGTGTCTCCGTTGAGTTC
FATB1F: CTACACTTCGGGTACGACGGNM_001398142.1
R: GTAGAGCGGAAGGCAGTTGT
Table 3. Effects of essential oils blend on growth performance of broilers.
Table 3. Effects of essential oils blend on growth performance of broilers.
Items 1Essential Oils Blend (EOB mg/L)SEM 2p-Value
CONEOB150EOB250EOB350
D 1−21
IBW (g)46.1345.9146.4246.740.2350.647
ABW g/bird982.30976.35989.50998.258.1300.814
ADG g/bird/d44.5744.3044.9045.300.3870.832
ADFI g/bird/d59.1058.2858.1459.050.4000.779
FCR1.321.311.291.300.0110.833
D 22−42
ADG g/bird/d87.8188.0694.4190.791.3230.287
ADFI g/bird/d146.22153.22154.54155.891.6190.140
FCR1.671.741.641.720.0230.477
D 1−42
ABW g/bird2826.442825.662973.192904.930.8150.291
ADG g/bird/d66.1966.1869.6868.050.7320.294
ADFI g/bird/d102.66105.75106.42107.470.8730.235
FCR1.551.591.531.580.0150.480
1 IBW: initial weight; ABW: average body weight; ADG: average daily gain; ADFI: average daily feed intake; FCR: feed conversion ratio. 2 SEM: standard error of the mean; CON = control drinking water (without EOB); EOB150 = DW + 150 mg/L EOB; EOB250 = DW + 250 mg/L EOB; EOB350 = DW + 350 mg/L EOB.
Table 4. Effect of essential oils blend on the carcass characteristics of broilers.
Table 4. Effect of essential oils blend on the carcass characteristics of broilers.
ItemsEssential Oils Blend (EOB mg/L)SEM 1p-Value
CONEOB150EOB250EOB350
Liver index (%)1.971.922.042.130.0650.686
Spleen index (%)0.100.100.100.100.0040.909
Bursa of Fabricius index (%)0.120.130.120.130.0070.863
Breast index (%)22.38 b23.97 ab24.77 a23.73 ab0.3040.037
Abdominal fat index (%)1.471.341.331.340.0820.922
Semi-evisceration index (%)84.9786.2485.4188.530.6110.166
Fully-evisceration index (%)71.9072.9372.6472.650.2190.396
a,b Means in the same row with different superscripts are significantly different (p < 0.05). 1 SEM: standard error of the mean. CON = control drinking water (without EOB); EOB150 = DW + 150 mg/L EOB; EOB250 = DW + 250 mg/L EOB; EOB350 = DW + 350 mg/L EOB.
Table 5. Effect of essential oils blend on meat quality of chicken breast muscle.
Table 5. Effect of essential oils blend on meat quality of chicken breast muscle.
Items 1Essential Oils Blend (EOB mg/L)SEM 2p-Value
CONEOB150EOB250EOB350
pH value6.016.226.206.210.0940.846
WHC79.52 b81.99 a82.77 a82.39 a0.4500.037
Drip loss (%)1.97 a1.87 ab1.54 b1.53 b0.0700.027
Cooking loss (%)18.35 a16.49 ab16.39 ab15.07 b0.4200.042
Shear force21.8320.0119.7920.010.9800.888
L*38.3941.3639.4440.800.6300.346
a*1.021.341.381.250.1100.677
b*3.51 c3.88 bc5.08 a4.77 ab0.1870.004
ΔE54.7051.7853.7752.370.6280.355
Hue4.103.995.204.530.4790.822
Chroma3.67 c4.16 bc5.30 a4.95 ab0.1930.006
BI11.41 b12.06 b15.93 a14.35 ab0.6510.043
a–c Means in the same row with different superscripts are significantly different (p < 0.05). 1 WHC: water holding capacity; L*: lightness; a*: redness; b*: yellowness; ΔE: total color change; Hue: Hue angle; Chroma: saturation index; BI: browning index. 2 SEM: standard error of the mean. CON = control drinking water (without EOB); EOB150 = DW + 150 mg/L EOB; EOB250 = DW + 250 mg/L EOB; EOB350 = DW + 350 mg/L EOB.
Table 6. Effect of essential oils blend on fatty acid profile from breast muscle in broilers.
Table 6. Effect of essential oils blend on fatty acid profile from breast muscle in broilers.
Items 1Essential Oils Blend (EOB mg/L)SEM 2p-Value
CONEOB150EOB250EOB350
C12:00.03 a0.03 a0.023 b0.025 b0.0010.020
C14:00.720.700.690.690.0080.506
C16:024.9624.8123.5623.900.2740.196
C18:08.44 a7.51 ab7.10 b7.17 b0.1890.034
C16:13.964.284.624.200.1830.682
C18:1n939.3739.6342.0541.630.5070.138
C18:2n614.95 ab14.85 b15.94 a15.91 a0.1820.035
C18:3n32.21 b2.48 ab2.86 a2.89 a0.0880.007
C18:3n60.290.340.370.350.0120.166
C20:4n64.29 b4.62 ab5.20 a5.10 a0.1280.029
C20:5n30.210.22 0.25 0.26 0.0070.056
C22:4n60.68 b0.69 b0.77 a0.72 ab0.0100.004
C22:6n32.44 2.54 2.92 2.62 0.0670.053
SFA34.16 a33.06 ab31.38 b31.78 b0.3830.030
MUFA43.3443.9246.6745.840.6120.175
PUFA25.11 b25.75 b28.33 a27.87 a0.3250.001
n-6 PUFA20.24 b20.51 b22.28 a22.10 a0.2570.001
n-3 PUFA4.87 c5.24 bc6.05 a5.77 ab0.1310.001
a–c Means in the same row with different superscripts are significantly different (p < 0.05). 1 Lauric acid (C12:0); Myristic acid (C14:0); Palmitic acid (C16:0); Stearic acid (C18:0); Palmitoleic acid (C16:1); Oleic acid (C18:1n9); Linoleic acid (LA, C18:2n6c); α-Linolenic acid (ALA, C18:3n3); γ-linoleic acid (C18:3n6); Arachidonic acid (AA, C20:4n6); Eicosapentaenoic acid (EPA, C20:5n3); Docosatetraenoic acid (C22:4n6); Docosahexaenoic acid (DHA, C22:6n3); SFA: Saturated fatty acid; MUFA: Monounsaturated fatty acid; PUFA: Polyunsaturated fatty acid. SFA percentage is the sum of C12:0, C14:0, C16:0, and C18:0; MUFA percentage was calculated as the sum of C16:1and C18:1n-9; PUFA percentage was calculated as the sum of C18:2n6c, C18:3n3, C18:3n6, C20:4n6, C20:5n3, C22:4n6, and C22:6n3. 2 SEM: standard error of the mean. CON = control drinking water (without EOB); EOB150 = DW + 150 mg/L EOB; EOB250 = DW + 250 mg/L EOB; EOB350 = DW + 350 mg/L EOB.
Table 7. Impact of essential oils blend on lipid quality indexes in breast muscle.
Table 7. Impact of essential oils blend on lipid quality indexes in breast muscle.
Items 1Essential Oils Blend (EOB mg/L)SEM 2p-Value
CONEOB150EOB250EOB350
Qualitative
n-6/n-34.173.953.723.830.0870.303
PUFA/SFA0.73 b0.78 b0.90 a0.87 a0.0180.001
LA/ALA6.78 6.04 5.73 5.550.1770.059
EPA + DHA2.65 b2.76 b3.18 a2.88 ab0.0700.036
UI116.47 b119.74 b131.02 a127.79 a1.4090.001
Nutritional
NVI1.911.902.092.040.0290.051
TI0.73 a0.68 a0.59 b0.61 b0.0150.001
IA0.40 a0.39 a0.35 b0.36 b0.0060.002
h/H2.50 b2.56 b2.91 a2.82 a0.0480.001
HPI2.45 b2.52 b2.85 a2.76 a0.0480.002
FLQ7.78 b8.42 b10.18 a9.10 ab0.2760.007
PI61.84 b64.55 b72.45 a69.45 a1.0370.001
IB19.7720.8120.2019.780.6340.941
DFA76.90 b77.20 b82.12 a80.88 a0.6700.003
NR0.47 a0.47 a0.41 b0.42 b0.0070.008
Metabolic
Elongase33.9330.3430.1530.060.7410.187
Thioesterase3444.083553.363392.013453.9444.5440.662
∆9-Desaturase (16)13.6414.6616.3514.960.5800.449
∆9-Desaturase (18)82.28 b83.96 ab85.54 a85.30 a0.4580.033
∆9-Desaturase(16 + 18)56.43 b57.52 ab60.34 a59.60 a0.5390.025
Activity index2.192.112.142.010.0350.312
a,b Means in the same row with different superscripts are significantly different (p < 0.05). 1 PUFA/SFA: Σ Polyunsaturated Fatty Acid/Σ Saturated Fatty Acid; LA/ALA: Linoleic Acid/α-Linolenic Acid; EPA + DHA: Eicosapentaenoic Acid and Docosahexaenoic Acid; UI: Unsaturation index; NVI: Nutrition Value Index; TI: thrombosis index; IA: Index of Atherogenicity; h/H: Hypocholesterolemic/Hypercholesterolemic; HPI: Health-Promoting Index; FLQ: Flesh Lipid Quality; PI: Peroxidation trend index; IB: Inflammatory Biomarker; DFA: Dietary fatty acids; NR: Nutritional ratio; 2 SEM: standard error of the mean. CON = control drinking water (without EOB); EOB150 = DW + 150 mg/L EOB; EOB250 = DW + 250 mg/L EOB; EOB350 = DW + 350 mg/L EOB.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kahiel, M.; Wang, K.; Xu, H.; Du, J.; Li, S.; Shen, D.; Li, C. Effect of Supplemental Essential Oils Blend on Broiler Meat Quality, Fatty Acid Profile, and Lipid Quality. Animals 2025, 15, 929. https://doi.org/10.3390/ani15070929

AMA Style

Kahiel M, Wang K, Xu H, Du J, Li S, Shen D, Li C. Effect of Supplemental Essential Oils Blend on Broiler Meat Quality, Fatty Acid Profile, and Lipid Quality. Animals. 2025; 15(7):929. https://doi.org/10.3390/ani15070929

Chicago/Turabian Style

Kahiel, Mohamed, Kai Wang, Haocong Xu, Jian Du, Sheng Li, Dan Shen, and Chunmei Li. 2025. "Effect of Supplemental Essential Oils Blend on Broiler Meat Quality, Fatty Acid Profile, and Lipid Quality" Animals 15, no. 7: 929. https://doi.org/10.3390/ani15070929

APA Style

Kahiel, M., Wang, K., Xu, H., Du, J., Li, S., Shen, D., & Li, C. (2025). Effect of Supplemental Essential Oils Blend on Broiler Meat Quality, Fatty Acid Profile, and Lipid Quality. Animals, 15(7), 929. https://doi.org/10.3390/ani15070929

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop