Genome-Wide Analysis Reveals Expansion and Positive Selection of Monocarboxylate Transporter Genes Linked to Enhanced Salinity and Ammonia Tolerance in Sinonovacula constricta
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Identification of Monocarboxylate Transporter Genes in S. constricta
2.2. Chromosome Location and Synteny Analysis of ScSMCTs and ScMCTs
2.3. Alignment and Phylogenetic Analysis of ScSMCTs and ScMCTs
2.4. Adaptive Evolution Analysis
2.5. The Expression Profiles of ScSMCT and ScMCT Genes Based on Transcriptome Data
2.6. Stress Treatment and qRT-PCR Analysis
3. Results
3.1. Expansion Analysis of ScMCT and ScSMCT Genes from Representative Vertebrates and Invertebrates
3.2. Chromosomal Location, Synteny, and Phylogenetic Evolution of ScSMCT and ScMCT Gene Families
3.3. Transcriptome Analysis Links Multiple ScSMCTs and ScMCTs to Salinity and Ammonia Nitrogen Stress in the Gill Tissue
3.4. Expression Patterns of ScMCT and ScSMCT Genes in Response to Abnormal Salinity, High Ammonia Nitrogen, and Thermal Stimulation in the Gill Tissue
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Iwanaga, T.; Kishimoto, A. Cellular distributions of monocarboxylate transporters: A review. Biomed. Res. 2015, 36, 279–301. [Google Scholar] [CrossRef] [Scilit]
- Halestrap, A.P. Monocarboxylic acid transport. Compr. Physiol. 2013, 3, 1611–1643. [Google Scholar]
- Denton, R.M.; Halestrap, A.P. Regulation of pyruvate metabolism in mammalian tissues. Essays Biochem. 1979, 15, 37–77. [Google Scholar]
- Halestrap, A.P.; Wilson, M.C. The monocarboxylate transporter family-Role and regulation. Iubmb Life 2012, 64, 109–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deuticke, B. Monocarboxylate transport in erythrocytes. J. Membr. Biol. 1982, 70, 89–103. [Google Scholar] [CrossRef] [Scilit]
- Poole, R.C.; Halestrap, A.P. Transport of lactate and other monocarboxylates across mammalian plasma membranes. Am. J. Physiol. 1993, 264, C761–C782. [Google Scholar] [CrossRef] [Scilit]
- Garcia, C.K.; Goldstein, J.L.; Pathak, R.K.; Anderson, R.G.; Brown, M.S. Molecular characterization of a membrane transporter for lactate, pyruvate, and other monocarboxylates: Implications for the Cori cycle. Cell 1994, 76, 865–873. [Google Scholar] [CrossRef] [Scilit]
- Poole, R.C.; Halestrap, A.P. Identification and partial purification of the erythrocyte L-lactate transporter. Biochem. J. 1992, 283, 855–862. [Google Scholar] [CrossRef] [Scilit]
- Poole, R.C.; Halestrap, A.P. N-terminal protein sequence analysis of the rabbit erythrocyte lactate transporter suggests identity with the cloned monocarboxylate transport protein MCT1. Biochem. J. 1994, 303, 755–759. [Google Scholar] [CrossRef] [Scilit]
- Halestrap, A.P.; Meredith, D. The SLC16 gene family-from monocarboxylate transporters (MCTs) to aromatic amino acid transporters and beyond. Pflug. Arch. 2004, 447, 619–628. [Google Scholar] [CrossRef] [Scilit]
- Bonen, A.; Tonouchi, M.; Miskovic, D.; Heddle, C.; Heikkila, J.J.; Halestrap, A.P. Isoform-specific regulation of the lactate transporters MCT1 and MCT4 by contractile activity. Am. J. Physiol. Endocrinol. Metab. 2000, 279, E1131–E1138. [Google Scholar] [CrossRef] [Scilit]
- Visser, W.E.; Friesema, E.C.; Visser, T.J. Minireview: Thyroid hormone transporters: The knowns and the unknowns. Mol. Endocrinol. 2011, 25, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.K.; Kanai, Y.; Chairoungdua, A.; Matsuo, H.; Cha, S.H.; Endou, H. Expression cloning of a Na+-independent aromatic amino acid transporter with structural similarity to H+/monocarboxylate transporters. J. Biol. Chem. 2001, 276, 17221–17228. [Google Scholar] [CrossRef] [Scilit]
- Coady, M.J.; Wallendorff, B.; Bourgeois, F.; Charron, F.; Lapointe, J.-Y. Establishing a Definitive Stoichiometry for the Na+/Monocarboxylate Cotransporter SMCT1. Biophys. J. 2007, 93, 2325–2331. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Myeroff, L.; Smiraglia, D.; Romero, M.F.; Pretlow, T.P.; Kasturi, L.; Lutterbaugh, J.; Rerko, R.M.; Casey, G.; Issa, J.-P.; et al. SLC5A8, a sodium transporter, is a tumor suppressor gene silenced by methylation in human colon aberrant crypt foci and cancers. Proc. Natl. Acad. Sci. USA 2003, 100, 8412–8417. [Google Scholar] [CrossRef] [Scilit]
- Srinivas, S.R.; Gopal, E.; Zhuang, L.; Itagaki, S.; Martin, P.M.; Fei, Y.-J.; Ganapathy, V.; Prasad, P.D. Cloning and functional identification of slc5a12 as a sodium-coupled low-affinity transporter for monocarboxylates (SMCT2). Biochem. J. 2005, 392, 655–664. [Google Scholar] [CrossRef] [Scilit]
- Wright, E.M. Glucose transport families SLC5 and SLC50. Mol. Asp. Med. 2013, 34, 183–196. [Google Scholar] [CrossRef] [Scilit]
- Halestrap, A.P. The SLC16 gene family—Structure, role and regulation in health and disease. Mol. Asp. Med. 2013, 34, 337–349. [Google Scholar] [CrossRef] [Scilit]
- Cuff, M.A.; Lambert, D.W.; Shirazi-Beechey, S.P. Substrate-induced regulation of the human colonic monocarboxylate transporter, MCT1. J. Physiol. 2002, 539, 361–371. [Google Scholar] [CrossRef] [Scilit]
- Cresci, G.A.; Thangaraju, M.; Mellinger, J.D.; Liu, K.; Ganapathy, V. Colonic gene expression in conventional and germ-free mice with a focus on the butyrate receptor GPR109A and the butyrate transporter SLC5A8. J. Gastrointest. Surg. 2010, 14, 449–461. [Google Scholar] [CrossRef] [Scilit]
- Daly, K.; Shirazi-Beechey, S.P. Microarray analysis of butyrate regulated genes in colonic epithelial cells. DNA Cell Biol. 2006, 25, 49–62. [Google Scholar] [CrossRef] [Scilit]
- Bergman, E.N. Energy contributions of volatile fatty acids from the gastrointestinal tract in various species. Physiol. Rev. 1990, 70, 567–590. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Halestrap, A.P.; Price, N.T. The proton-linked monocarboxylate transporter (MCT) family: Structure, function and regulation. Biochem. J. 1999, 343, 281–299. [Google Scholar] [CrossRef] [PubMed]
- Kirat, D.; Inoue, H.; Iwano, H.; Yokota, H.; Taniyama, H.; Kato, S. Monocarboxylate transporter 1 (MCT1) in the liver of pre-ruminant and adult bovines. Vet. J. 2007, 173, 124–130. [Google Scholar] [CrossRef] [Scilit]
- Metzler-Zebeli, B.U.; Hollmann, M.; Sabitzer, S.; Podstatzky-Lichtenstein, L.; Klein, D.; Zebeli, Q. Epithelial response to high-grain diets involves alteration in nutrient transporters and Na+/K+-ATPase mRNA expression in rumen and colon of goats. J. Anim. Sci. 2013, 91, 4256–4266. [Google Scholar] [CrossRef] [Scilit]
- Plata, C.; Sussman, C.R.; Sindic, A.; Liang, J.O.; Mount, D.B.; Josephs, Z.M.; Chang, M.H.; Romero, M.F. Zebrafish Slc5a12 encodes an electroneutral sodium monocarboxylate transporter (SMCTn). A comparison with the electrogenic SMCT (SMCTe/Slc5a8). J. Biol. Chem. 2007, 282, 11996–12009. [Google Scholar] [CrossRef] [Scilit]
- McDermott, B.M.; Baucom, J.M.; Hudspeth, A.J. Analysis and functional evaluation of the hair-cell transcriptome. Proc. Natl. Acad. Sci. USA 2007, 104, 11820–11825. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.; Kemadjou, J.R.; Zinsmeister, C.; Bauer, M.; Legradi, J.; Müller, F.; Pankratz, M.; Jäkel, J.; Strähle, U. Transcriptional profiling reveals barcode-like toxicogenomic responses in the zebrafish embryo. Genome Biol. 2007, 8, R227. [Google Scholar] [CrossRef] [Scilit]
- Ngan, A.K.; Wang, Y.S. Tissue-specific transcriptional regulation of monocarboxylate transporters (MCTs) during short-term hypoxia in zebrafish (Danio rerio). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2009, 154, 396–405. [Google Scholar] [CrossRef] [Scilit]
- Schneebauer, G.; Drechsel, V.; Dirks, R.; Faserl, K.; Sarg, B.; Pelster, B. Expression of transport proteins in the rete mirabile of european silver and yellow eel. BMC Genom. 2021, 22, 1–15. [Google Scholar] [CrossRef] [Scilit]
- Yang, S.; Wu, H.; He, K.; Yan, T.; Zhou, J.; Zhao, L.L.; Sun, J.L.; Lian, W.Q.; Zhang, D.M.; Du, Z.J.; et al. Response of AMP-activated protein kinase and lactate metabolism of largemouth bass (Micropterus salmoides) under acute hypoxic stress. Sci. Total Environ. 2019, 666, 1071–1079. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, C.; Song, H.; Feng, J.; Hu, Z.; Yu, Z.-L.; Yang, M.-J.; Shi, P.; Li, Y.-R.; Guo, Y.-J.; Zhang, T. RNA-Seq analysis and WGCNA reveal dynamic molecular responses to air exposure in the hard clam Mercenaria mercenaria. Genomics 2021, 113, 2847–2859. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, C.-H.; Zhou, X.-W.; Wang, Y.-C.; Lee, T.-H. Differential effects of hypothermal stress on lactate metabolism in fresh water- and seawater-acclimated milkfish, Chanos chanos. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2020, 248, 110744. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, W.; Chen, J.; Yu, C.; Pan, C.; Lin, Z.; Chen, J. WSV056-mediated downregulation of PvSMCT1 contributes to immune evasion of white spot syndrome virus in the infection of Penaeus vannamei. Aquaculture 2023, 563, 739010. [Google Scholar] [CrossRef] [Scilit]
- Omlin, T.; Weber, J.M. Exhausting exercise and tissue-specific expression of monocarboxylate transporters in rainbow trout. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2013, 304, R1036–R1043. [Google Scholar] [CrossRef] [Scilit]
- Umezawa, T.; Kato, A.; Ogoshi, M.; Ookata, K.; Munakata, K.; Yamamoto, Y.; Islam, Z.; Doi, H.; Romero, M.F.; Hirose, S. O2-filled swimbladder employs monocarboxylate transporters for the generation of O2 by lactate-induced root effect hemoglobin. PLoS ONE 2012, 7, e34579. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Hou, J.; Liu, H.; Zhu, H.; Xu, G.; Xu, J. Adaptive evolution of low-salinity tolerance and hypoosmotic regulation in a euryhaline teleost, Takifugu obscurus. Mar. Biol. 2020, 167, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Huang, S.; Cao, X.; Tian, X. Transcriptomic analysis of compromise between air-breathing and nutrient uptake of uosterior intestine in loach (Misgurnus anguillicaudatus), an air-breathing fish. Mar. Biotechnol. 2016, 18, 521–533. [Google Scholar] [CrossRef] [Scilit]
- Mohindra, V.; Chowdhury, L.M.; Chauhan, N.; Paul, A.; Singh, R.K.; Kushwaha, B.; Maurya, R.K.; Lal, K.K.; Jena, J.K. Transcriptome analysis revealed osmoregulation related regulatory networks and hub genes in the gills of Hilsa shad, Tenualosa ilisha, during the migratory osmotic stress. Mar. Biotechnol. 2023, 25, 161–173. [Google Scholar] [CrossRef] [Scilit]
- Xun, X.; Cheng, J.; Wang, J.; Li, Y.; Li, X.; Li, M.; Lou, J.; Kong, Y.; Bao, Z.; Hu, X. Solute carriers in scallop genome: Gene expansion and expression regulation after exposure to toxic dinoflagellate. Chemosphere 2020, 241, 124968. [Google Scholar] [CrossRef] [Scilit]
- Muzzio, A.M.; Noyes, P.D.; Stapleton, H.M.; Lema, S.C. Tissue distribution and thyroid hormone effects on mRNA abundance for membrane transporters Mct8, Mct10, and organic anion-transporting polypeptides (Oatps) in a teleost fish. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2014, 167, 77–89. [Google Scholar] [CrossRef] [Scilit]
- Barnes, D.K.A. High diversity of tropical intertidal zone sponges in temperature, salinity and current extremes. Afr. J. Ecol. 1999, 37, 424–434. [Google Scholar] [CrossRef] [Scilit]
- Ma, B.; Ran, Z.; Xu, X.; Xu, J.; Liao, K.; Cao, J.; Yan, X. Comparative transcriptome analyses provide insights into the adaptation mechanisms to acute salt stresses in juvenile Sinonovacula constricta. Genes Genom. 2019, 41, 599–612. [Google Scholar] [CrossRef] [Scilit]
- Cao, W.; Bi, S.; Chi, C.; Dong, Y.; Xia, S.; Liu, Z.; Zhou, L.; Sun, X.; Geng, Y.; Wu, B. Effects of high salinity stress on the survival, gill tissue, enzyme activity and free amino acid content in razor clam Sinonovacula constricta. Front. Mar. Sci. 2022, 9, 839614. [Google Scholar] [CrossRef] [Scilit]
- Ruan, W.; Dong, Y.; Lin, Z.; He, L. Molecular characterization of aquaporins genes from the razor clam Sinonovacula constricta and their potential role in salinity tolerance. Fishes 2022, 7, 69. [Google Scholar] [CrossRef] [Scilit]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [Scilit]
- Gao, F.; Chen, C.; Arab, D.A.; Du, Z.; He, Y.; Ho, S.Y.W. EasyCodeML: A visual tool for analysis of selection using CodeML. Ecol. Evol. 2019, 9, 3891–3898. [Google Scholar] [CrossRef] [Scilit]
- Dong, Y.; Zeng, Q.; Ren, J.; Yao, H.; Lv, L.; He, L.; Ruan, W.; Xue, Q.; Bao, Z.; Wang, S.; et al. The chromosome-level genome assembly and comprehensive transcriptomes of the razor clam (Sinonovacula constricta). Front. Genet. 2020, 11, 664. [Google Scholar] [CrossRef] [Scilit]
- Bergersen, L.H. Is lactate food for neurons? Comparison of monocarboxylate transporter subtypes in brain and muscle. Neuroscience 2007, 145, 11–19. [Google Scholar] [CrossRef] [Scilit]
- Shpilka, T.; Weidberg, H.; Pietrokovski, S.; Elazar, Z. Atg8: An autophagy-related ubiquitin-like protein family. Genome Biol. 2011, 12, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Marques, A.C.; Vinckenbosch, N.; Brawand, D.; Kaessmann, H. Functional diversification of duplicate genes through subcellular adaptation of encoded proteins. Genome Biol. 2008, 9, R54. [Google Scholar] [CrossRef] [Scilit]
- Dayhoff, M.O. The origin and evolution of protein superfamilies. Fed. Proc. 1976, 35, 2132–2138. [Google Scholar] [PubMed]
- Demuth, J.P.; Hahn, M.W. The life and death of gene families. Bioessays 2009, 31, 29–39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jordan, I.K.; Makarova, K.S.; Spouge, J.L.; Wolf, Y.I.; Koonin, E.V. Lineage-specific gene expansions in bacterial and archaeal genomes. Genome Res. 2001, 11, 555–565. [Google Scholar] [CrossRef] [Scilit]
- Lespinet, O.; Wolf, Y.I.; Koonin, E.V.; Aravind, L. The role of lineage-specific gene family expansion in the evolution of eukaryotes. Genome Res. 2002, 12, 1048–1059. [Google Scholar] [CrossRef] [Scilit]
- Fu, H.; Jiao, Z.; Li, Y.; Tian, J.; Ren, L.; Zhang, F.; Li, Q.; Liu, S. Transient receptor potential (TRP) channels in the Pacific oyster (Crassostrea gigas): Genome-wide identification and expression profiling after heat stress between C. gigas and C. angulata. Int. J. Mol. Sci. 2021, 22, 3222. [Google Scholar] [CrossRef] [Scilit]
- Zhang, G.; Fang, X.; Guo, X.; Li, L.; Luo, R.; Xu, F.; Yang, P.; Zhang, L.; Wang, X.; Qi, H. The oyster genome reveals stress adaptation and complexity of shell formation. Nature 2012, 490, 49–54. [Google Scholar] [CrossRef] [Scilit]
- Meyer, A.; Van de Peer, Y. From 2R to 3R: Evidence for a fish-specific genome duplication (FSGD). Bioessays 2005, 27, 937–945. [Google Scholar] [CrossRef] [Scilit]
- Glasauer, S.M.; Neuhauss, S.C. Whole-genome duplication in teleost fishes and its evolutionary consequences. Mol. Genet. Genom. 2014, 289, 1045–1060. [Google Scholar] [CrossRef] [Scilit]
- Yuan, J.; Zhang, X.; Liu, C.; Duan, H.; Li, F.; Xiang, J. Convergent evolution of the osmoregulation system in decapod shrimps. Mar. Biotechnol. 2017, 19, 76–88. [Google Scholar] [CrossRef] [Scilit]
- Lin, C.H.; Yeh, P.L.; Lee, T.H. Time-course changes in the regulation of ions and amino acids in the hard clam Meretrix lusoria upon lower salinity challenge. J. Exp. Zool. A Ecol. Integr. Physiol. 2021, 335, 602–613. [Google Scholar] [CrossRef] [Scilit]
- Cong, M.; Wu, H.; Cao, T.; Ji, C.; Lv, J. Effects of ammonia nitrogen on gill mitochondria in clam Ruditapes philippinarum. Environ. Toxicol. Pharmacol. 2019, 65, 46–52. [Google Scholar] [CrossRef] [Scilit]
- Hu, Z.; Feng, J.; Song, H.; Zhou, C.; Yang, M.-J.; Shi, P.; Yu, Z.-L.; Guo, Y.-J.; Li, Y.-R.; Zhang, T. Metabolic response of Mercenaria mercenaria under heat and hypoxia stress by widely targeted metabolomic approach. Sci. Total Environ. 2022, 809, 151172. [Google Scholar] [CrossRef] [Scilit]
- Meng, X.; Jayasundara, N.; Zhang, J.; Ren, X.; Gao, B.; Li, J.; Liu, P. Integrated physiological, transcriptome and metabolome analyses of the hepatopancreas of the female swimming crab Portunus trituberculatus under ammonia exposure. Ecotoxicol. Environ. Saf. 2021, 228, 113026. [Google Scholar] [CrossRef] [Scilit]
- Tang, D.; Wu, Y.; Wu, L.; Bai, Y.; Zhou, Y.; Wang, Z. The effects of ammonia stress exposure on protein degradation, immune response, degradation of nitrogen-containing compounds and energy metabolism of Chinese mitten crab. Mol. Biol. Rep. 2022, 49, 6053–6061. [Google Scholar] [CrossRef] [Scilit]
- Racotta, I.S.; Hernández-Herrera, R. Metabolic responses of the white shrimp, Penaeus vannamei, to ambient ammonia. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2000, 125, 437–443. [Google Scholar] [CrossRef] [Scilit]
- Miron, D.d.S.; Moraes, B.; Becker, A.G.; Crestani, M.; Spanevello, R.; Loro, V.L.; Baldisserotto, B. Ammonia and pH effects on some metabolic parameters and gill histology of silver catfish, Rhamdia quelen (Heptapteridae). Aquaculture 2008, 277, 192–196. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.; Zhang, H.; Shi, H.; Li, Z.; Xue, C. Application of multi-omics combined with bioinformatics techniques to assess salinity stress response and tolerance mechanisms of Pacific oyster (Crassostrea gigas) during depuration. Fish Shellfish Immunol. 2023, 137, 108779. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Niu, D.; Wu, Y.; Dong, Z.; Li, J. Integrated analysis of transcriptomic and metabolomic data to evaluate responses to hypersalinity stress in the gill of the razor clam (Sinonovacula constricta). Comp. Biochem. Physiol. D Genom. Proteom. 2021, 38, 100793. [Google Scholar] [CrossRef] [Scilit]
- Liang, P.; Saqib, H.S.A.; Lin, Z.; Zheng, R.; Qiu, Y.; Xie, Y.; Ma, D.; Shen, Y. RNA-seq analyses of Marine Medaka (Oryzias melastigma) reveals salinity responsive transcriptomes in the gills and livers. Aquat. Toxicol. 2021, 240, 105970. [Google Scholar]
- Li, A.; Dai, H.; Guo, X.; Zhang, Z.; Zhang, K.; Wang, C.; Wang, X.; Wang, W.; Chen, H.; Li, X.; et al. Genome of the estuarine oyster provides insights into climate impact and adaptive plasticity. Commun. Biol. 2021, 4, 1287. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.-C.; Nan, F.-H. Effects of ammonia on oxygen consumption and ammonia-n excretion of Penaeus chinensis after prolonged exposure to ammonia. Bull. Environ. Contam. Toxicol. 1993, 51, 122–129. [Google Scholar] [CrossRef] [Scilit]




| Primer Name | Sequence (5′-3′) |
|---|---|
| ScMCT1_2F | GCTCACATCACCGAAGGTCAAAT |
| ScMCT_2R | TCGTCACATCTTGATCCTGCT |
| ScMCT2_3F | AGGAGAGCGATGTTTACTGGTG |
| ScMCT2_3R | GCTGAATGGAACCTGGGAGT |
| ScMCT12_1F | TTTGCTCCTATTATGACGACT |
| ScMCT12_1R | TTGGCCTCATTAAAGATCCAC |
| ScMCT12_5F | AGGAAGGAGCCTCACCTACAC |
| ScMCT12_5R | GTTGCTATGCCAACAGCCA |
| ScMCT13_1F | ACATTCTCAGTGTCTTCGCAAC |
| ScMCT13_1R | GACGGTAGAAACACCATCCCAA |
| ScMCT14_16F | ACATCACCTAAAGGCAGCTGT |
| ScMCT14_16R | AGGTACTCATCTGCACACGTT |
| ScSMCT1_1F | CGGATAATCGTGCCCCTCA |
| ScSMCT1_1R | GGTCCAAATAGTACAACACCCAT |
| ScSMCT1_2F | GCCATTACCAACAACCGGAT |
| ScSMCT1_2R | CAGTCGACCCAGATAAATAAGAGC |
| RS9F | TGAAGTCTGGCGTGTCAAGT |
| RS9R | CGTCTCAAAAGGGCATTACC |
| Name of Gene Family | Number of Copies | LRT p-Value (Number of Positive Sites Pr > 95%) | ||
|---|---|---|---|---|
| M0 vs. M3 | M1a vs. M2a | M7 vs. M8 | ||
| SMCT | 16 | 0.0000 | 1.0000 (0) | 0.0014 (0) |
| MCT | 54 | 0.0000 | 1.0000 (0) | 0.0000 (3) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Meng, Y.; Lv, L.; Yao, H.; Lin, Z.; Dong, Y. Genome-Wide Analysis Reveals Expansion and Positive Selection of Monocarboxylate Transporter Genes Linked to Enhanced Salinity and Ammonia Tolerance in Sinonovacula constricta. Animals 2025, 15, 795. https://doi.org/10.3390/ani15060795
Meng Y, Lv L, Yao H, Lin Z, Dong Y. Genome-Wide Analysis Reveals Expansion and Positive Selection of Monocarboxylate Transporter Genes Linked to Enhanced Salinity and Ammonia Tolerance in Sinonovacula constricta. Animals. 2025; 15(6):795. https://doi.org/10.3390/ani15060795
Chicago/Turabian StyleMeng, Yiping, Liyuan Lv, Hanhan Yao, Zhihua Lin, and Yinghui Dong. 2025. "Genome-Wide Analysis Reveals Expansion and Positive Selection of Monocarboxylate Transporter Genes Linked to Enhanced Salinity and Ammonia Tolerance in Sinonovacula constricta" Animals 15, no. 6: 795. https://doi.org/10.3390/ani15060795
APA StyleMeng, Y., Lv, L., Yao, H., Lin, Z., & Dong, Y. (2025). Genome-Wide Analysis Reveals Expansion and Positive Selection of Monocarboxylate Transporter Genes Linked to Enhanced Salinity and Ammonia Tolerance in Sinonovacula constricta. Animals, 15(6), 795. https://doi.org/10.3390/ani15060795

