Divergent Photoperiodic Responses in Hypothalamic Dio3 Expression and Gonadal Activity Between Offspring and Paternal Brandt’s Voles
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Housing Conditions
2.2. Experiment Design
2.3. Hypothalamus and Physiological Parameter Collection
2.4. RNA Isolation, cDNA Transcription, and Gene Expression Measurement
2.5. Statistical Analysis
3. Results
3.1. Physiology
3.1.1. Male Offspring
3.1.2. Paternal Voles
3.2. Hypothalamic Gene Expression
3.2.1. Dio2
3.2.2. Dio3
3.2.3. Kiss1
3.2.4. Rfrp3
3.2.5. GnRH
4. Discussion
4.1. More Similar Photoperiodic Pattern Produced Closer Physiological and Molecular Responses
4.2. Divergent Photoperiodic Responses Between Male Offspring and Paternal Voles
4.3. Hypothalamic Dio3 Probably Plays an Important Role in Regulating the Seasonal Breeding of Brandt’s Vole
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bronson, F.H. Climate Change and Seasonal Reproduction in Mammals. Philos. Trans. R. Soc. B Biol. Sci. 2009, 364, 3331–3340. [Google Scholar] [CrossRef] [PubMed]
- Nakane, Y.; Yoshimura, T. Photoperiodic Regulation of Reproduction in Vertebrates. Annu. Rev. Anim. Biosci. 2019, 7, 173–194. [Google Scholar] [CrossRef] [PubMed]
- Wood, S.H.; Hindle, M.M.; Mizoro, Y.; Cheng, Y.; Saer, B.R.C.; Miedzinska, K.; Christian, H.C.; Begley, N.; McNeilly, J.; McNeilly, A.S.; et al. Circadian Clock Mechanism Driving Mammalian Photoperiodism. Nat. Commun. 2020, 11, 4291. [Google Scholar] [CrossRef] [PubMed]
- Stevenson, T.J.; Ball, G.F. Information Theory and the Neuropeptidergic Regulation of Seasonal Reproduction in Mammals and Birds. Proc. R. Soc. B Biol. Sci. 2011, 278, 2477–2485. [Google Scholar] [CrossRef] [PubMed]
- Gorman, M.R. Seasonal Adaptations of Siberian Hamsters. I. Accelerated Gonadal and Somatic Development in Increasing Versus Static Long Day Lengths1. Biol. Reprod. 1995, 53, 110–115. [Google Scholar] [CrossRef] [PubMed]
- Milesi, S.; Simonneaux, V.; Klosen, P. Downregulation of Deiodinase 3 Is the Earliest Event in Photoperiodic and Photorefractory Activation of the Gonadotropic Axis in Seasonal Hamsters. Sci. Rep. 2017, 7, 17739. [Google Scholar] [CrossRef]
- Negus, N.C.; Berger, P.J.; Brown, B.W. Microtine Population Dynamics in a Predictable Environment. Can. J. Zool. 1986, 64, 785–792. [Google Scholar] [CrossRef]
- Horton, T.H. Fetal Origins of Developmental Plasticity: Animal Models of Induced Life History Variation. Am. J. Hum. Biol. 2005, 17, 34–43. [Google Scholar] [CrossRef]
- Horton, T.H.; Ray, S.L.; Stetson, M.H. Maternal Transfer of Photoperiodic Information in Siberian Hamsters. III. Melatonin Injections Program Postnatal Reproductive Development Expressed in Constant Light. Biol. Reprod. 1989, 41, 34–39. [Google Scholar] [CrossRef] [PubMed]
- Sáenz de Miera, C.; Bothorel, B.; Jaeger, C.; Simonneaux, V.; Hazlerigg, D. Maternal Photoperiod Programs Hypothalamic Thyroid Status via the Fetal Pituitary Gland. Proc. Natl. Acad. Sci. USA 2017, 114, 8408–8413. [Google Scholar] [CrossRef]
- Pévet, P. The Role of the Pineal Gland in the Photoperiodic Control of Reproduction in Different Hamster Species. Reprod. Nutr. Développement 1988, 28, 443–458. [Google Scholar] [CrossRef]
- Dardente, H.; Klosen, P.; Pévet, P.; Masson-Pévet, M. MT1 Melatonin Receptor MRNA Expressing Cells in the Pars Tuberalis of the European Hamster: Effect of Photoperiod. J. Neuroendocrinol. 2003, 15, 778–786. [Google Scholar] [CrossRef]
- Klosen, P.; Bienvenu, C.; Demarteau, O.; Dardente, H.; Guerrero, H.; Pévet, P.; Masson-Pévet, M. The Mt1 Melatonin Receptor and RORβ Receptor Are Co-Localized in Specific TSH-Immunoreactive Cells in the Pars Tuberalis of the Rat Pituitary. J. Histochem. Cytochem. 2002, 50, 1647–1657. [Google Scholar] [CrossRef]
- Ono, H.; Hoshino, Y.; Yasuo, S.; Watanabe, M.; Nakane, Y.; Murai, A.; Ebihara, S.; Korf, H.-W.; Yoshimura, T. Involvement of Thyrotropin in Photoperiodic Signal Transduction in Mice. Proc. Natl. Acad. Sci. USA 2008, 105, 18238–18242. [Google Scholar] [CrossRef] [PubMed]
- Böckers, T.M.; Niklowitz, P.; Bockmann, J.; Fauteck, J.-D.; Wittkowski, W.; Kreutz, M.R. Daily Melatonin Injections Induce Cytological Changes in Pars Tuberalis-Specific Cells Similar to Short Photoperiod. J. Neuroendocrinol. 1995, 7, 607–613. [Google Scholar] [CrossRef] [PubMed]
- Bockmann, J.; Böckers, T.M.; Vennemann, B.; Niklowitz, P.; Müller, J.; Wittkowski, W.; Sabel, B.; Kreutz, M.R. Short Photoperiod-Dependent down-Regulation of Thyrotropin-Alpha and -Beta in Hamster Pars Tuberalis-Specific Cells Is Prevented by Pinealectomy. Endocrinology 1996, 137, 1804–1813. [Google Scholar] [CrossRef] [PubMed]
- Hanon, E.A.; Routledge, K.; Dardente, H.; Masson-Pévet, M.; Morgan, P.J.; Hazlerigg, D.G. Effect of Photoperiod on the Thyroid-Stimulating Hormone Neuroendocrine System in the European Hamster (Cricetus cricetus). J. Neuroendocrinol. 2010, 22, 51–55. [Google Scholar] [CrossRef] [PubMed]
- Bianco, A.C.; Salvatore, D.; Gereben, B.; Berry, M.J.; Larsen, P.R. Biochemistry, Cellular and Molecular Biology, and Physiological Roles of the Iodothyronine Selenodeiodinases. Endocr. Rev. 2002, 23, 38–89. [Google Scholar] [CrossRef] [PubMed]
- Stevenson, T.J. Circannual and Circadian Rhythms of Hypothalamic DNA Methyltransferase and Histone Deacetylase Expression in Male Siberian Hamsters (Phodopus sungorus). Gen. Comp. Endocrinol. 2017, 243, 130–137. [Google Scholar] [CrossRef] [PubMed]
- Król, E.; Douglas, A.; Dardente, H.; Birnie, M.J.; van der Vinne, V.; Eijer, W.G.; Gerkema, M.P.; Hazlerigg, D.G.; Hut, R.A. Strong Pituitary and Hypothalamic Responses to Photoperiod but Not to 6-Methoxy-2-Benzoxazolinone in Female Common Voles (Microtus arvalis). Gen. Comp. Endocrinol. 2012, 179, 289–295. [Google Scholar] [CrossRef]
- Wang, D.; Li, N.; Tian, L.; Ren, F.; Li, Z.; Chen, Y.; Liu, L.; Hu, X.; Zhang, X.; Song, Y.; et al. Dynamic Expressions of Hypothalamic Genes Regulate Seasonal Breeding in a Natural Rodent Population. Mol. Ecol. 2019, 28, 3508–3522. [Google Scholar] [CrossRef] [PubMed]
- Prendergast, B.J.; Pyter, L.M.; Kampf-Lassin, A.; Patel, P.N.; Stevenson, T.J. Rapid Induction of Hypothalamic Iodothyronine Deiodinase Expression by Photoperiod and Melatonin in Juvenile Siberian Hamsters (Phodopus sungorus). Endocrinology 2013, 154, 831–841. [Google Scholar] [CrossRef] [PubMed]
- Irwig, M.S.; Fraley, G.S.; Smith, J.T.; Acohido, B.V.; Popa, S.M.; Cunningham, M.J.; Gottsch, M.L.; Clifton, D.K.; Steiner, R.A. Kisspeptin Activation of Gonadotropin Releasing Hormone Neurons and Regulation of KiSS-1 MRNA in the Male Rat. Neuroendocrinology 2004, 80, 264–272. [Google Scholar] [CrossRef] [PubMed]
- Rizwan, M.Z.; Poling, M.C.; Corr, M.; Cornes, P.A.; Augustine, R.A.; Quennell, J.H.; Kauffman, A.S.; Anderson, G.M. RFamide-Related Peptide-3 Receptor Gene Expression in GnRH and Kisspeptin Neurons and GnRH-Dependent Mechanism of Action. Endocrinology 2012, 153, 3770–3779. [Google Scholar] [CrossRef] [PubMed]
- Ubuka, T.; Inoue, K.; Fukuda, Y.; Mizuno, T.; Ukena, K.; Kriegsfeld, L.J.; Tsutsui, K. Identification, Expression, and Physiological Functions of Siberian Hamster Gonadotropin-Inhibitory Hormone. Endocrinology 2012, 153, 373–385. [Google Scholar] [CrossRef]
- Henningsen, J.B.; Gauer, F.; Simonneaux, V. RFRP Neurons—The Doorway to Understanding Seasonal Reproduction in Mammals. Front. Endocrinol. 2016, 7, 36. [Google Scholar] [CrossRef]
- Henson, J.R.; Carter, S.N.; Freeman, D.A. Exogenous T3 Elicits Long Day–Like Alterations in Testis Size and the RFamides Kisspeptin and Gonadotropin-Inhibitory Hormone in Short-Day Siberian Hamsters. J. Biol. Rhythm. 2013, 28, 193–200. [Google Scholar] [CrossRef]
- Rasri-Klosen, K.; Simonneaux, V.; Klosen, P. Differential Response Patterns of Kisspeptin and RFamide-related Peptide to Photoperiod and Sex Steroid Feedback in the Djungarian Hamster (Phodopus sungorus). J. Neuroendocrinol. 2017, 29, e12529. [Google Scholar] [CrossRef]
- Kampf-Lassin, A.; Prendergast, B.J. Photoperiod History-Dependent Responses to Intermediate Day Lengths Engage Hypothalamic Iodothyronine Deiodinase Type III MRNA Expression. Am. J. Physiol. Integr. Comp. Physiol. 2013, 304, R628–R635. [Google Scholar] [CrossRef] [PubMed]
- Sáenz de Miera, C. Maternal Photoperiodic Programming Enlightens the Internal Regulation of Thyroid-Hormone Deiodinases in Tanycytes. J. Neuroendocrinol. 2019, 31, e12679. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, K. Effects of Short Photoperiods on Puberty, Growth and Moult in the Djungarian Hamster (Phodopus sungorus). Reproduction 1978, 54, 29–35. [Google Scholar] [CrossRef] [PubMed]
- Yellon, S.M.; Goldman, B.D. Photoperiod Control of Reproductive Development in the Male Djungarian Hamster (Phodopus sungorus). Endocrinology 1984, 114, 664–670. [Google Scholar] [CrossRef] [PubMed]
- Darrow, J.M.; Davis, F.C.; Elliott, J.A.; Stetson, M.H.; Turek, F.W.; Menaker, M. Influence of Photoperiod on Reproductive Development in the Golden Hamster. Biol. Reprod. 1980, 22, 443–450. [Google Scholar] [CrossRef]
- Gündüz, B.; Stetson, M.H. The Impact of Photoperiods and Melatonin on Gonadal Development in Juvenile Turkish Hamsters (Mesocricetus brandti). J. Pineal Res. 1998, 25, 193–200. [Google Scholar] [CrossRef] [PubMed]
- Timonin, M.E.; Place, N.J.; Wanderi, E.; Wynne-Edwards, K.E. Phodopus Campbelli Detect Reduced Photoperiod during Development but, Unlike Phodopus sungorus, Retain Functional Reproductive Physiology. Reproduction 2006, 132, 661–670. [Google Scholar] [CrossRef]
- Zhong, W.; Wang, M.; Wan, X. Ecological Management of Brandt’s Vole (Microtus brandti) in Inner Mongolia, China. Ecol. Rodent Manag. 1999, 199–214. [Google Scholar]
- Zhong, W.; Wang, G.; Zhou, Q.; Wang, G. Communal Food Caches and Social Groups of Brandt’s Voles in the Typical Steppes of Inner Mongolia, China. J. Arid Environ. 2007, 68, 398–407. [Google Scholar] [CrossRef]
- Yue, L.F.; Wang, D.W.; Huang, B.H.; Liu, X.H. Characterization of Nine Novel Microsatellite Markers from Brandt’s Vole (Lasiopodomys brandtii). Mol. Ecol. Resour. 2009, 9, 1194–1196. [Google Scholar] [CrossRef]
- Wang, D.; Li, N.; Liu, M.; Huang, B.; Liu, Q.; Liu, X. Behavioral Evaluation of Quinestrol as a Sterilant in Male Brandt’s Voles. Physiol. Behav. 2011, 104, 1024–1030. [Google Scholar] [CrossRef]
- Liu, X.H.; Yue, L.F.; Wang, D.W.; Li, N.; Cong, L. Inbreeding Avoidance Drives Consistent Variation of Fine-Scale Genetic Structure Caused by Dispersal in the Seasonal Mating System of Brandt’s Voles. PLoS ONE 2013, 8, e58101. [Google Scholar] [CrossRef]
- Li, G.; Hou, X.; Wan, X.; Zhang, Z. Sheep Grazing Causes Shift in Sex Ratio and Cohort Structure of Brandt’s Vole: Implication of Their Adaptation to Food Shortage. Integr. Zool. 2016, 11, 76–84. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Yin, B.; Wan, X.; Wei, W.; Wang, G.; Krebs, C.J.; Zhang, Z. Successive Sheep Grazing Reduces Population Density of Brandt’s Voles in Steppe Grassland by Altering Food Resources: A Large Manipulative Experiment. Oecologia 2016, 180, 149–159. [Google Scholar] [CrossRef]
- Liu, Z.; Sun, R. Study on Physiological Age Structure of Brandt’s Voles (Microtus brandti). Acta Theriol. Sin. 1993, 13, 50–60. [Google Scholar] [CrossRef]
- Chen, Y.; Wang, D.W.; Li, N.; Hu, X.F.; Ren, F.; Hao, W.L.; Song, Y.; Liu, X.H. Kinship Analysis Reveals Reproductive Success Skewed toward Overwintered Brandt’s Voles in Semi-Natural Enclosures. Integr. Zool. 2019, 14, 435–445. [Google Scholar] [CrossRef] [PubMed]
- Qiao, Y.; Li, N.; Song, Y.; Liu, X.; Wang, D. Short Photoperiod Inhibited Gonadal Growth and Elevated Hypothalamic Dio3 Expression Unrelated to Promoter DNA Methylation in Young Brandt’s Voles. Integr. Zool. 2024, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Grocock, C.A. Effect of Different Photoperiods on Testicular Weight Changes in the Vole, Microtus Agrestis. J. Reprod. Fertil. 1981, 62, 25–32. [Google Scholar] [CrossRef] [PubMed]
- Butler, M.P.; Turner, K.W.; Jin, H.P.; Butler, J.P.; Trumbull, J.J.; Dunn, S.P.; Villa, P.; Zucker, I. Simulated Natural Day Lengths Synchronize Seasonal Rhythms of Asynchronously Born Male Siberian Hamsters. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 2007, 293, R402–R412. [Google Scholar] [CrossRef] [PubMed]
- van Rosmalen, L.; van Dalum, J.; Appenroth, D.; Roodenrijs, R.T.M.; de Wit, L.; Hazlerigg, D.G.; Hut, R.A. Mechanisms of Temperature Modulation in Mammalian Seasonal Timing. FASEB J. 2021, 35, e21605. [Google Scholar] [CrossRef] [PubMed]
- Reiter, R.J. Evidence for Refractoriness of the Pituitary-gonadal Axis to the Pineal Gland in Golden Hamsters and Its Possible Implications in Annual Reproductive Rhythms. Anat. Rec. 1972, 173, 365–371. [Google Scholar] [CrossRef] [PubMed]
- Prendergast, B.J.; Wynne-Edwards, K.E.; Yellon, S.M.; Nelson, R.J. Photorefractoriness of Immune Function in Male Siberian Hamsters (Phodopus sungorus). J. Neuroendocrinol. 2002, 14, 318–329. [Google Scholar] [CrossRef] [PubMed]
- Yoshimura, T.; Yasuo, S.; Watanabe, M.; Iigo, M.; Yamamura, T.; Hirunagi, K.; Ebihara, S. Light-Induced Hormone Conversion of T4 to T3 Regulates Photoperiodic Response of Gonads in Birds. Nature 2003, 426, 178–181. [Google Scholar] [CrossRef] [PubMed]
- Barrett, P.; Ebling, F.J.P.; Schuhler, S.; Wilson, D.; Ross, A.W.; Warner, A.; Jethwa, P.; Boelen, A.; Visser, T.J.; Ozanne, D.M.; et al. Hypothalamic Thyroid Hormone Catabolism Acts as a Gatekeeper for the Seasonal Control of Body Weight and Reproduction. Endocrinology 2007, 148, 3608–3617. [Google Scholar] [CrossRef] [PubMed]
- Freeman, D.A.; Teubner, B.J.W.; Smith, C.D.; Prendergast, B.J. Exogenous T3 Mimics Long Day Lengths in Siberian Hamsters. Am. J. Physiol. Integr. Comp. Physiol. 2007, 292, R2368–R2372. [Google Scholar] [CrossRef]
- Watanabe, M.; Yasuo, S.; Watanabe, T.; Yamamura, T.; Nakao, N.; Ebihara, S.; Yoshimura, T. Photoperiodic Regulation of Type 2 Deiodinase Gene in Djungarian Hamster: Possible Homologies between Avian and Mammalian Photoperiodic Regulation of Reproduction. Endocrinology 2004, 145, 1546–1549. [Google Scholar] [CrossRef] [PubMed]
- Revel, F.G.; Saboureau, M.; Pévet, P.; Mikkelsen, J.D.; Simonneaux, V. Melatonin Regulates Type 2 Deiodinase Gene Expression in the Syrian Hamster. Endocrinology 2006, 147, 4680–4687. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, T.; Yamamura, T.; Watanabe, M.; Yasuo, S.; Nakao, N.; Dawson, A.; Ebihara, S.; Yoshimura, T. Hypothalamic Expression of Thyroid Hormone-Activating and -Inactivating Enzyme Genes in Relation to Photorefractoriness in Birds and Mammals. Am. J. Physiol. Integr. Comp. Physiol. 2007, 292, R568–R572. [Google Scholar] [CrossRef] [PubMed]
- Kampf-Lassin, A.; Prendergast, B.J. Acute Downregulation of Type II and Type III Iodothyronine Deiodinases by Photoperiod in Peripubertal Male and Female Siberian Hamsters. Gen. Comp. Endocrinol. 2013, 193, 72–78. [Google Scholar] [CrossRef]
- Stevenson, T.J.; Prendergast, B.J. Reversible DNA Methylation Regulates Seasonal Photoperiodic Time Measurement. Proc. Natl. Acad. Sci. USA 2013, 110, 16651–16656. [Google Scholar] [CrossRef]
- Van Rosmalen, L.; Van Dalum, J.; Hazlerigg, D.G.; Hut, R.A. Gonads or Body? Differences in Gonadal and Somatic Photoperiodic Growth Response in Two Vole Species. J. Exp. Biol. 2020, 223, jeb230987. [Google Scholar] [CrossRef] [PubMed]
- van Dalum, M.J.; van Rosmalen, L.; Appenroth, D.; Cazarez Marquez, F.; Roodenrijs, R.T.M.; de Wit, L.; Hut, R.A.; Hazlerigg, D.G. Ambient Temperature Effects on the Spring and Autumn Somatic Growth Trajectory Show Plasticity in the Photoneuroendocrine Response Pathway in the Tundra Vole. J. Biol. Rhythm. 2023, 38, 586–600. [Google Scholar] [CrossRef] [PubMed]
- Ancel, C.; Bentsen, A.H.; Sébert, M.E.; Tena-Sempere, M.; Mikkelsen, J.D.; Simonneaux, V. Stimulatory Effect of RFRP-3 on the Gonadotrophic Axis in the Male Syrian Hamster: The Exception Proves the Rule. Endocrinology 2012, 153, 1352–1363. [Google Scholar] [CrossRef] [PubMed]
- Quennell, J.H.; Rizwan, M.Z.; Relf, H.-L.; Anderson, G.M. Developmental and Steroidogenic Effects on the Gene Expression of RFamide Related Peptides and Their Receptor in the Rat Brain and Pituitary Gland. J. Neuroendocrinol. 2010, 22, 309–316. [Google Scholar] [CrossRef] [PubMed]
- Poling, M.C.; Kauffman, A.S. Regulation and Function of RFRP-3 (GnIH) Neurons during Postnatal Development. Front. Endocrinol. 2015, 6, 150. [Google Scholar] [CrossRef] [PubMed]
- Revel, F.G.; Saboureau, M.; Pévet, P.; Simonneaux, V.; Mikkelsen, J.D. RFamide-Related Peptide Gene Is a Melatonin-Driven Photoperiodic Gene. Endocrinology 2008, 149, 902–912. [Google Scholar] [CrossRef]
- Poling, M.C.; Kim, J.; Dhamija, S.; Kauffman, A.S. Development, Sex Steroid Regulation, and Phenotypic Characterization of RFamide-Related Peptide (Rfrp) Gene Expression and RFamide Receptors in the Mouse Hypothalamus. Endocrinology 2012, 153, 1827–1840. [Google Scholar] [CrossRef]
- Walker, D.M.; Kirson, D.; Perez, L.F.; Gore, A.C. Molecular Profiling of Postnatal Development of the Hypothalamus in Female and Male Rats. Biol. Reprod. 2012, 87, 1–12. [Google Scholar] [CrossRef]
Postnatal Week | Male Offspring (Number) | Paternal Voles (Number) | ||||
---|---|---|---|---|---|---|
ILP | DSP | NLP | ILP | DSP | NLP | |
4 weeks | 10 | 10 | 10 | 6 | 6 | 6 |
6 weeks | 8 | 9 | 10 | - | - | - |
8 weeks | 8 | 9 | 10 | 6 | 6 | 6 |
12 weeks | 7 | 10 | 9 | 7 | 7 | 4 |
Genes | Length | Annealing Temperature | Primer Sequence |
---|---|---|---|
γ-actin | 113 bp | 62 °C | F: GCTCTCTTCCAGCCTTCCTTCCTG R: GTGTTGGCGTACAGGTCCTTGCGG |
Dio2 | 103 bp | 62 °C | F: TGCCTACAAACAGGTTAAATTGGGT R: GGCTGTCTTCTTCAAGGCATAA |
Dio3 | 136 bp | 62 °C | F: TCAACAGTGAAGGCGAGGAGGT R: TCGTGGGCCTGCTTGAAGAAAT |
GnRH | 124 bp | 62 °C | F: CGATTCTTTCCAAGAGATGGG R: CATCAGACTTTCCAGAGCTCCT |
Kiss1 | 143 bp | 62 °C | F: CACTGGCTTCTTGGCAGCTACTG R: GCCCTTTTCCCAGGCATTGA |
Rfrp3 | 112 bp | 62 °C | F: GACAAATATCTCCAGCCTAGAGG R: GGGCTGGACTCATCTTAATAACAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, L.; Li, Z.; Song, Y.; Li, N.; Liu, X.-H.; Wang, D. Divergent Photoperiodic Responses in Hypothalamic Dio3 Expression and Gonadal Activity Between Offspring and Paternal Brandt’s Voles. Animals 2025, 15, 469. https://doi.org/10.3390/ani15040469
Wang L, Li Z, Song Y, Li N, Liu X-H, Wang D. Divergent Photoperiodic Responses in Hypothalamic Dio3 Expression and Gonadal Activity Between Offspring and Paternal Brandt’s Voles. Animals. 2025; 15(4):469. https://doi.org/10.3390/ani15040469
Chicago/Turabian StyleWang, Lewen, Zhengguang Li, Ying Song, Ning Li, Xiao-Hui Liu, and Dawei Wang. 2025. "Divergent Photoperiodic Responses in Hypothalamic Dio3 Expression and Gonadal Activity Between Offspring and Paternal Brandt’s Voles" Animals 15, no. 4: 469. https://doi.org/10.3390/ani15040469
APA StyleWang, L., Li, Z., Song, Y., Li, N., Liu, X.-H., & Wang, D. (2025). Divergent Photoperiodic Responses in Hypothalamic Dio3 Expression and Gonadal Activity Between Offspring and Paternal Brandt’s Voles. Animals, 15(4), 469. https://doi.org/10.3390/ani15040469