Next Article in Journal
A Positive-Reinforcement Training Regimen for Refined Sample Collection in Laboratory Pigs
Previous Article in Journal
Comparative Analysis of Health, Inflammatory Markers, and Rumen Microbiota Between Mildly Lame and Healthy Cows
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Divergent Photoperiodic Responses in Hypothalamic Dio3 Expression and Gonadal Activity Between Offspring and Paternal Brandt’s Voles

1
State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100193, China
2
Western Agricultural Research Center, Chinese Academy of Agricultural Sciences, Changji 831100, China
3
Key Laboratory of Biohazard Monitoring and Green Prevention and Control in Artificial Grassland, Ministry of Agriculture and Rural Affairs, Institute of Grassland Research, Chinese Academy of Agricultural Sciences, Hohhot 010010, China
*
Authors to whom correspondence should be addressed.
Animals 2025, 15(4), 469; https://doi.org/10.3390/ani15040469
Submission received: 9 January 2025 / Revised: 26 January 2025 / Accepted: 6 February 2025 / Published: 7 February 2025
(This article belongs to the Section Animal Physiology)

Simple Summary

This study investigated an age-dependent photoperiod sensitivity mechanism in male Brandt’s voles, a small rodent species. We examined the gonadal development and expression profiles of reproductive-related genes in the hypothalamus of male offspring born under three different photoperiod conditions, as well as in their fathers. The results showed that both artificial and natural increasing long photoperiod treatments led to similar phenotypes and gene expression characteristics in male offspring, specifically a significantly higher level of gonadal development and a notably lower expression of hypothalamic Dio3 compared to the decreasing short photoperiod group. However, paternal voles did not exhibit any significant response to the applied photoperiod. These results suggest divergent photoperiodic responses between the two ages and highlight the crucial role of hypothalamic Dio3 in interpreting photoperiodic signals and regulating gonadal development in Brandt’s voles.

Abstract

The postnatal development of gonadal glands in seasonal breeders, particularly small rodent species, is influenced by photoperiodic patterns. However, little research has been conducted on the effects of pattern similarity and age differentiation especially in molecular features. This study compares the postnatal development of gonadal glands and the expression of hypothalamic genes related to reproductive regulation in male offspring of Brandt’s voles (Lasiopodomys brandtii) born under three types of changing photoperiodic patterns: increasing long photoperiod (ILP, 12 h + 3 min/day), natural increasing long photoperiods (NLPs), and decreasing short photoperiods (DSPs, 12 h − 3 min/day), as well as in their paternal voles exposed to these patterns at the same period. Results indicate that over the course of 12 postnatal weeks, gonadal development, including organ masses and serum testosterone levels, exhibited similar profiles between the ILP and NLP groups, which were significantly higher than those observed in DSP offspring. Hypothalamic type 3 iodothyronine deiodinase (Dio3) exhibited significantly higher expression in the DSP group from postnatal week 4 to 8 compared to the other two groups. These physiological and molecular differences gradually decreased with age in offspring, but were never observed in the paternal voles, indicating divergent photoperiodic responses between the two ages. The synchronous profiles observed between hypothalamic Dio3 expression and gonadal activities underscore its crucial role in interpreting photoperiodic signals and regulating gonadal development in Brandt’s voles.

1. Introduction

Seasonal breeding is an adaptive strategy observed in over 4000 mammal species, especially those inhabiting middle and high-latitude regions [1]. These animals have evolved the ability to synchronize their reproductive physiology with the external annual day length cycle, known as the photoperiod, through internal seasonal clocks [2,3]. Adult animals undergo spontaneous activation and regression of their gonadal glands in the breeding and non-breeding seasons, respectively [4], a process that can also be influenced by artificially manipulated photoperiods, such as stable or gradually changing photoperiods [5,6]. However, the regulation of reproductive development in juvenile animals, particularly in some small rodent species, is more complex. For instance, newborns may need to accelerate the maturation of their gonadal glands within a few weeks if born in the early period of the breeding season, or delay puberty until the following spring if born in the late stage of the breeding season [7]. The mechanisms governing these postnatal developmental trajectories remain largely unknown.
Developmental plasticity reflects genetic variability influenced by early-life events, such as the prenatal and early postnatal periods [8]. Research has indicated that in certain hamster and vole species, the fetus can perceive seasonal photoperiodic cues from maternal melatonin in uterus [9,10]. Melatonin, secreted by the pineal gland during the night, conveys information about seasonal day length, coordinating gonadal activity with seasonal shifts in adult mammals. Previous studies have shown that pineal gland removal prevents gonadal atrophy in hamsters exposed to short photoperiods (SPs, day length < 12 h/day), while exogenous melatonin inhibits gonadal function under long photoperiods (LPs, day length > 12 h/day) [11]. These seasonal signals of the photoperiod and melatonin can be transmitted to fetuses during pregnancy or to juveniles during lactation through their dams. For example, an intermediate photoperiod (14 h) suppressed testicular development in juveniles born under LP (16 h), while promoting testicular growth in those born under SP (8 h) by the age of 50 days [10]. Furthermore, administering melatonin to dams from pregnancy through lactation reduced the testicular weight of juveniles by day 28 [9]. Despite the clear transmission of photoperiod signals from mother to offspring, the molecular mechanisms underlying the response to the photoperiod and its regulation of gonadal development in juveniles remain unknown.
The Pars tuberalis (PT) in the pituitary gland and tanycytes in the hypothalamus are recognized as key regulators of seasonal changes. PT cells, rich in melatonin receptor 1 (MT1), secrete thyroid-stimulating hormone (TSH) in adult rodents [12,13,14]. The expression of TSHβ, the beta subunit of TSH, is influenced by the duration of melatonin secretion, with high expression under LP conditions and low expression under SP exposure [15,16,17]. TSH binds to receptors on tanycytes in the third ventricle, regulating local triiodothyronine (T3) levels by modulating iodothyronine deiodinases, specifically type 2 (DIO2) and type 3 (DIO3), which respectively activate and deactivate T3 [18]. Research conducted in both an artificial setting [6,14,19,20] and the natural environment [21] shows that LP conditions upregulate Dio2 and downregulate Dio3 in the rodent hypothalamus, while SP conditions reverse this pattern. Hypothalamic Dio3 exhibits a more pronounced response to changes in the photoperiod compared to Dio2 across different species, suggesting its conserved role in seasonal adaptations [6,19,22]. Additionally, neuropeptides Kisspeptin (encoded by Kiss1) and RFamide-related peptide 3 (encoded by Rfrp3, also known as gonadotropin inhibitory hormone, GnIH) modulate gonadotropin-releasing hormone (GnRH) neuronal activity in rodents [23,24,25,26]. These peptides are thought to connect the TSH-deiodinase pathway with the hypothalamic–pituitary–gonadal (HPG) axis, exhibiting a significant response to photoperiod variations, thyroid hormones, and gonadal hormones [27,28]. Existing literature has predominantly focused on adult rodents, with a few exceptions [22,29,30].
Juvenile rodents may not consistently exhibit the same photoperiodic response as adults. Adult Siberian (Phodopus sungorus) and Syrian hamsters (Mesocricetus auratus) exhibited significant reproductive inhibition under SP compared to LP conditions, as did juvenile Siberian hamsters [31,32]. However, juvenile Syrian hamsters did not show the same reproductive inhibition under SP conditions [33]. Turkish hamsters (Mesocricetus brandti) demonstrated a photoperiodic response similar to Siberian hamsters [34], while Djungarian dwarf hamsters (Phodopus campbelli) only partially suppressed reproductive functions under SP conditions [35]. The molecular mechanisms underlying these photoperiodic responses in juvenile rodents, and their distinctions from those of adults, remain unclear.
Brandt’s voles (Lasiopodomys brandtii), a small herbivorous rodent species with a lifespan of less than 14 months and no hibernation habits, inhabit the steppes of the Mongolian plateau in China, the Republic of Mongolia, and the Baikal Lake region of Russia [36,37,38,39,40]. They breed exclusively from spring (early March) to autumn (late August) in their natural environment [36,37,41,42]. Male voles experience a significant reduction in testes mass of 20–100 times during the non-breeding season compared to the breeding season [21,43]. However, gonadal activity does not synchronize across different age groups: adult males maintain functional testicular activity until late summer, while most newborn males delay puberty until the following spring, except for a few born early in spring [44]. Overwintered males, the primary contributors to the breeding season, do not survive the second winter [21,43]. Previous studies have shown synchronous seasonal changes between photoperiodic genes (Dio2&3) in the hypothalamus with the photoperiod and testes mass in wild voles [21]. Additionally, the higher expression of hypothalamic Dio3 occurs under decreasing SP conditions following inhibited gonadal development compared to increasing LP exposure [45]. However, it is still unclear whether adult male voles respond to photoperiodic changes in the same way as juveniles, and the exact role of hypothalamic genes in this process remains to be elucidated.
In this study, we hypothesized that the photoperiod is the primary factor influencing the seasonal breeding of Brandt’s voles, affecting both somatic and gonadal development in offspring born under LP and SP conditions, and leading to distinct expression patterns of major genes regulating seasonal breeding in the hypothalamus. Additionally, we predicted variations in photoperiodic responses between adult and juvenile voles. To test these hypotheses, voles were exposed to three photoperiodic patterns: two groups subjected to 12 h + 3 min/day and 12 h − 3 min/day, as outlined in Qiao et al. (2024), and one group exposed to the natural spring sinusoidal photoperiod in Beijing (~40° N). The 3 min daily change aligns with the maximum rate observed in the annual photoperiodic cycle in Inner Mongolia (~45° N). Gonadal development and hypothalamic gene expression were compared in offspring and paternal voles exposed to the three photoperiodic treatments to investigate (1) similarities in gonadal development and hypothalamic gene expression in offspring under comparable photoperiodic patterns; (2) potential differential photoperiodic responses between older and younger voles; and (3) synchronous changes in key hypothalamic genes with gonadal development, particularly regarding the seasonal breeding of Brandt’s voles.

2. Materials and Methods

2.1. Animals and Housing Conditions

Voles have been selectively bred in our laboratory in Beijing (40°1′ N, 116°17′ E) for over 20 generations since 2007. They are housed in plastic cages (29 × 17.5 × 13 cm) containing wood shavings, with 3–5 voles per cage to encourage social interaction. The holding room is kept at a constant temperature of approximately 20 °C and follows a natural photoperiod. The bedding material is replaced weekly to uphold cleanliness and minimize stress. Voles have ad libitum access to standard rabbit chow and purified water. Daily health checks are conducted, and any signs of distress or illness are promptly addressed. All procedures follow the institutional guidelines for animal use and care of the Institute of Plant Protection at the Chinese Academy of Agricultural Sciences (Protocol No. Ipp-201606R010).

2.2. Experiment Design

To detect the effects of photoperiod on juvenile and paternal voles, pregnant female voles and their male counterparts were subjected to varying day lengths. Around 6-month-old voles from our laboratory breeding colony, raised under natural photoperiod conditions, were randomly selected. A total of 60 parent pairs were bred one week prior to the spring equinox in Beijing (11 h 53′27″, 7 March) under natural photoperiod conditions. After a week of pairing, the parent pairs were individually housed and divided into three groups for varied photoperiod treatments. One group was maintained under a natural increasing long photoperiod (NLP, with day length starting from 12 h 12′ on 21 March). The other two groups experienced a daily increase or decrease of 3 min in day length starting from the same day, labeled as the increasing long photoperiod (ILP) and decreasing short photoperiod (DSP) groups, respectively. The 3 min interval corresponded to the maximum annual day length change in the voles’ natural habitat (3′15″). The lighting-up time was set at 6:15 a.m. to coincide with the local sunrise. For simplicity, adjustments were made only to the daily turn-off time (See Figure 1). The NLP group was housed in rooms with transparent windows to allow natural light exposure, ensuring a photoperiod that closely mirrored external sunlight. In contrast, the ILP and DSP groups were kept in completely dark rooms, with lighting controlled by automatic timers and no external light sources.
After being exposed to three different photoperiod treatments, offspring were born about two weeks later, with each group consisting of 14 to 18 cohorts. The average litter size was consistent across groups (6.5–6.6), with litter sizes ranging from 3 to 11, 3 to 9, and 4 to 10 in the NLP, ILP, and DSP groups, respectively. To minimize litter effects, male offspring from the same litter were randomly allocated to different timepoints for sampling at postnatal week 4, 6, 8, and 12. This approach generally ensured that male offspring sacrificed at the same timepoint originated from different litters. To avoid disturbing the lactating females, which could lead to infanticide and compromise subsequent sampling, sampling points were set after the offspring were weaned at postnatal week 4. Due to the limited sampling size (18–20 in each group), paternal voles were sampled only at three of these timepoints (postnatal week 4, 8, 12). The specific sampling numbers for each group at each timepoint are detailed in Table 1.

2.3. Hypothalamus and Physiological Parameter Collection

A total of 110 male offspring voles and 54 paternal voles were sacrificed and dissected at different sampling times as mentioned above. The voles were anesthetized with ether, weighed, and then decapitated for trunk blood collection. Hypothalamic tissue was harvested, and the mass of testes and seminal vesicles were measured.
Hypothalamus sampling was restricted to the morning hours between 9:00 and 12:00 to mitigate the influence of daily fluctuations on gene expression. After decapitation, vole brains were expeditiously excised and the hypothalamus was dissected following the protocol outlined by Prendergast et al. (2013) [22], with demarcations at the optic chiasm anteriorly, the mammillary bodies posteriorly, and the hypothalamic sulci laterally. Following dissection, hypothalamus samples were frozen on dry ice and maintained at −80 °C for subsequent RNA isolation.
Trunk blood samples were centrifuged at 10,000 rpm for 3 min. Serum aliquots were then stored in polypropylene microcentrifuge tubes at −20 °C for testosterone radioimmunoassay. Testosterone levels in all serum samples were quantified using a single radioimmunoassay (RIA) by 125I RIA kits (Kemei Institute of Biotechnology, Beijing, China). The human antiserum used is highly specific for hormones, with cross-reactivity with other steroid hormones being <0.01% and intra-assay variability being <10% for all samples.

2.4. RNA Isolation, cDNA Transcription, and Gene Expression Measurement

Total RNA was isolated using the Direct-zolTM RNA MiniPrep kit (Zymo Research, Los Angeles, CA, USA) and its concentration was quantified with the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Carlsbad, NM, USA). The RNA samples exhibited satisfactory 260/280 ratios falling within the range of 1.8 to 2.0. RNA integrity was confirmed by 1.2% agarose gel electrophoresis, showing distinct bands in appropriate proportions. Subsequently, 400 ng of RNA was utilized to synthesize cDNA in a 20 μL reaction volume employing the One-Step gDNA Removal and cDNA Synthesis SuperMix kit (TransGen Biotech, Beijing, China).
Gene expression was measured following the methodology outlined in a previous study [21]. Primers for quantitative real-time PCR (qRT-PCR) were designed based on either fragments or full-length sequences of genes specific to Brandt’s vole, including γ-actin (OQ599899), Dio2 (KX856007), Dio3 (KX889114), Kiss1 (KX833248), Rfrp3 (KY038930), and GnRH (KY038929) (See Table 2). γ-actin was selected as the reference gene for its consistent expression across various photoperiod treatments and postnatal developmental stages.
Dio2, Kiss1, Rfrp3, and GnRH gene expressions were evaluated using the BioMark HD System (Fluidigm Sciences Inc., Sunnyvale, CA, USA). Initially, pooled primers at 50 nM concentrations were used for pre-amplification of cDNA with 14 cycles in a 5 μL volume, employing TaqMan PreAmp Master Mix (Applied Biosystems, Foster City, CA, USA). Subsequently, Exonuclease I was utilized for primer cleanup to eliminate unincorporated primers. A 1:14 dilution of the final products was prepared for qPCR reactions. Samples and assays were then loaded into the Dynamic Array IFC (Fluidigm Sciences Inc., Sunnyvale, CA, USA), and gene expression was quantified using SsoFast EvaGreen Supermix (Bio-Rad Laboratories, Inc., Hercules, CA, USA) with the Fluidigm Biomark HD system. For Dio3, which was undetectable in the BioMark HD System, relative expression was determined using SYBR Green PCR mix (Applied Biosystems, Foster City, CA, USA) on an Applied Biosystems 7500 (Applied Biosystems, Foster City, CA, USA). The thermal cycler protocol included an initial step at 94 °C for 5 min, followed by 40 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 40 s. Three replicates were performed for each gene sample. Gene expression levels were normalized to γ-actin and analyzed using the 2–ΔΔCT method.

2.5. Statistical Analysis

Two-way ANOVA was employed to assess the main effects of the photoperiod and postnatal week, as well as their interaction, on physiological parameters and gene expression. One-way ANOVA was utilized to evaluate differences among treatments at each time point. The effect size was reported using partial η2. Additionally, Fisher’s Least Significant Difference (LSD) test was conducted to determine the significance between pairs of groups at the same timepoint or between different time points within the same treatment group. To control for Type I errors due to multiple comparisons, the Benjamini and Hochberg False Discovery Rate (FDR) correction was applied to adjust the significance threshold. FDR correction was performed using the p.adjust() function in R. Statistical analyses were conducted using SPSS 19.0, and figures were generated using GraphPad Prism 9.0. The significance level was set at α = 0.05.

3. Results

3.1. Physiology

3.1.1. Male Offspring

A two-way ANOVA for body mass revealed significant main effects of the photoperiod (F(2,98) = 6.192, p = 0.003, η2 = 0.112) and postnatal week (F(3,98) = 71.437, p < 0.001, η2 = 0.686), without an interaction between these factors (F(6,98) = 1.679, p = 0.134). At postnatal week 12, significant differences in body mass were found among the three groups (one-way ANOVA, F(2,23) = 3.803, p = 0.037, η2 = 0.248; Figure 2A). Post hoc analysis indicated that males in the NLP group had higher body mass compared to the DSP group (FDR = 0.036, 95% CI [−22.5087, −3.1424]; Figure 2A). Moreover, body mass increased significantly over time for males in all photoperiod groups: ILP (one-way ANOVA, F(3,29) = 32.020, p < 0.001, η2 = 0.768), DSP (F(3,34) = 16.179, p < 0.001, η2 = 0.588), and NLP (F(3,35) = 28.181, p < 0.001, η2 = 0.707).
Regarding testes mass, the analysis showed significant main effects of the photoperiod (F(2,98) = 45.908, p < 0.001, η2 = 0.484) and postnatal week (F(3,98) = 68.689, p < 0.001, η2 = 0.678), along with a significant interaction (F(6,98) = 4.993, p < 0.001, η2 = 0.234). Testes mass varied significantly across the three groups at postnatal week 4 (one-way ANOVA, F(2,27) = 10.982, p < 0.001, η2 = 0.449), 6 (F(2,24) = 10.312, p < 0.001, η2 = 0.462), 8 (F(2,24) = 14.193, p < 0.001, η2 = 0.542), and 12 (F(2,23) = 16.789, p < 0.001, η2 = 0.593; Figure 2B). Post hoc analysis showed that ILP males had higher testes mass than DSP males at postnatal week 4 (FDR < 0.001, 95% CI [0.0748, 0.2054]), 6 (FDR < 0.001, 95% CI [0.1939, 0.5257]), 8 (FDR < 0.001, 95% CI [0.2526, 0.6799]), and 12 (FDR < 0.001, 95% CI [−0.8275, −0.3606]). Additionally, NLP males exhibited greater testes mass than DSP males at postnatal week 6 (FDR = 0.012, 95% CI [−0.3763, −0.0626]), 8 (FDR < 0.001, 95% CI [−0.6632, −0.2591]), and 12 (FDR < 0.001, 95% CI [0.2939, 0.7947]). ILP males also had heavier testes than NLP males at postnatal week 4 (FDR = 0.002, 95% CI [0.049, 0.1796]). Testes mass increased significantly over time for males in all photoperiod groups: ILP (one-way ANOVA, F(3,29) = 45.631, p < 0.001, η2 = 0.825), DSP (F(3,34) = 3.313, p = 0.031, η2 = 0.226), and NLP (F(3,35) = 90.999, p < 0.001, η2 = 0.886).
For seminal vesicle mass, a two-way ANOVA indicated significant main effects of the photoperiod (F(2,97) = 36.307, p < 0.001, η2 = 0.428) and postnatal week (F(3,97) = 87.323, p < 0.001, η2 = 0.730), with a significant interaction (F(6,97) = 10.221, p < 0.001, η2 = 0.387). Significant differences were found at postnatal week 4 (one-way ANOVA, F(2,27) = 4.559, p = 0.020, η2 = 0.252), 6 (F(2,24) = 6.600, p = 0.005, η2 = 0.355), 8 (F(2,24) = 12.421, p < 0.001, η2 = 0.509) and 12 (F(2,22) = 17.096, p < 0.001, η2 = 0.608; Figure 2C). Post hoc analysis indicated that ILP males had higher seminal vesicles mass than DSP males at postnatal week 4 (FDR = 0.029, 95% CI [0.0011, 0.0079]), 6 (FDR = 0.004, 95% CI [0.0270, 0.0980]), 8 (FDR < 0.001, 95% CI [0.1406, 0.3830]), and 12 (FDR < 0.001, 95% CI [0.2057, 0.5345]), while NLP males had greater seminal vesicle mass than DSP males at postnatal week 8 (FDR < 0.001, 95% CI [−0.3451, −0.1159]) and 12 (FDR < 0.001, 95% CI [−0.5464, −0.2389]). Notably, ILP males had heavier seminal vesicles than NLP males at postnatal week 4 (FDR = 0.029, 95% CI [0.0007, 0.0075]). Additionally, seminal vesicle mass increased significantly over time for males in all groups: ILP (one-way ANOVA, F(3,29) = 40.950, p < 0.001, η2 = 0.809), DSP (F(3,33) = 3.931, p = 0.017, η2 = 0.263), and NLP (F(3,35) = 55.665, p < 0.001, η2 = 0.827).
For serum testosterone concentrations, a two-way ANOVA revealed significant main effects of the photoperiod (F(2,93) = 7.280, p = 0.001, η2 = 0.135) and postnatal week (F(3,93) = 13.538, p < 0.001, η2 = 0.304). At postnatal week 12, significant differences were observed among the three groups (one-way ANOVA, F(2,22) = 6.456, p = 0.006, η2 = 0.370; Figure 2D). Post hoc analysis indicated that ILP males had higher testosterone levels than DSP males (FDR = 0.009, 95% CI [0.1330, 0.5747]), and NLP males had higher testosterone levels than DSP males (FDR = 0.022, 95% CI [−0.4466, −0.0537]). Furthermore, testosterone levels varied significantly over time in all photoperiod groups: ILP (one-way ANOVA, F(3,28) = 5.005, p = 0.007, η2 = 0.349), DSP (F(3,30) = 3.681, p = 0.023, η2 = 0.269), and NLP (F(3,35) = 6.510, p = 0.001, η2 = 0.358).

3.1.2. Paternal Voles

A significant main effect of the postnatal week was observed for body mass (two-way ANOVA, F(2,45) = 14.150, p < 0.001, η2 = 0.386). Paternal voles in both the ILP and NLP groups exhibited a significant increase in their body mass over time (one-way ANOVA, ILP: F(2,13) = 12.564, p = 0.001, η2 = 0.659; NLP: F(2,16) = 5.679, p = 0.014, η2 = 0.415; Figure 3A).
For testes mass, a significant main effect of the postnatal week was found (two-way ANOVA, F(2,45) = 5.025, p = 0.011, η2 = 0.183). However, no significant differences were observed among the three groups at any time point, nor were there significant developmental changes over time within each group (Figure 3B).
Significant main effects of the postnatal week were observed for seminal vesical mass (two-way ANOVA, F(2,45) = 4.845, p = 0.012, η2 = 0.177), with a significant interaction between the photoperiod and postnatal week (F(4,45) = 2.984, p = 0.029, η2 = 0.210). At postnatal week 4, significant differences were observed among the three groups (one-way ANOVA, F(2,15) = 4.258, p = 0.034, η2 = 0.362; Figure 3C). Post hoc analysis indicated that ILP males had heavier seminal vesicles than NLP males (FDR = 0.037, 95% CI [0.0846, 0.5904]). Furthermore, seminal vesicle mass increased significantly over time in the NLP condition (F(2,16) = 13.593, p < 0.001, η2 = 0.630).
No significant differences in serum testosterone levels were found based on either two-way or one-way ANOVA (Figure 3D).

3.2. Hypothalamic Gene Expression

3.2.1. Dio2

Two-way ANOVA did not reveal any main effects of the photoperiod or postnatal week, nor an interaction between the two, on hypothalamic Dio2 expression in offspring and paternal voles. Developmental changes were not evident in either the offspring or paternal groups (Figure 4A,B).

3.2.2. Dio3

A significant main effect of the photoperiod on hypothalamic Dio3 expression in male offspring was observed (two-way ANOVA, F(2,78) = 7.763, p = 0.001, η2 = 0.166). Significant variations were found across groups at postnatal week 4 (one-way ANOVA, F(2,18) = 3.558, p = 0.050, η2 = 0.283) and 8 (F(2,21) = 11.337, p < 0.001, η2 = 0.519). At postnatal week 4 and 6, DSP male offspring showed a near-significant increase compared to both NLP and ILP groups (FDR = 0.064 and FDR = 0.086, respectively). At postnatal week 8, DSP strongly stimulated Dio3 expression in male offspring compared to the ILP group (FDR < 0.001, 95% CI [−8.838364, −3.014871]; Figure 4C) and NLP group (FDR < 0.001, 95% CI [−8.519607, −2.696113]; Figure 4C). No photoperiodic and developmental effect was detected in the paternal groups (Figure 4D).

3.2.3. Kiss1

A significant main effect of the postnatal week on hypothalamic Kiss1 expression was observed in both male offspring (two-way ANOVA, F(3,76) = 8.989, p < 0.001, η2 = 0.262) and paternal voles (F(2,38) = 13.738, p < 0.001, η2 = 0.420). With the development, significant decreases in expression were found in the two LP male offspring groups (one-way ANOVA, NLP: F(3,25) = 4.073, p = 0.017, η2 = 0.328; ILP: F(3,25) = 6.181, p = 0.003, η2 = 0.426; Figure 4E), as well as in the NLP (F(2,12) = 6.887, p = 0.010, η2 = 0.534) and DSP (F(2,14) = 6.438, p = 0.010, η2 = 0.479) paternal groups (Figure 4F). No photoperiodic treatment effect was detected in any of the groups.

3.2.4. Rfrp3

A significant main effect of the postnatal week on hypothalamic Rfrp3 expression was observed in male offspring (two-way ANOVA, F(3,77) = 7.594, p < 0.001, η2 = 0.228). Developmental changes indicated notable increases in expression in the ILP male offspring group (one-way ANOVA, F(3,26) = 6.073, p = 0.003, η2 = 0.412). No photoperiodic treatment effect was evident in any of the groups (Figure 4G,H).

3.2.5. GnRH

No photoperiodic or developmental effects were found in either the male offspring or paternal groups (Figure 4I,J).

4. Discussion

4.1. More Similar Photoperiodic Pattern Produced Closer Physiological and Molecular Responses

This study reveals that male offspring in the NLP and ILP groups exhibited similar physiological development and gene expression patterns compared to those in the DSP group. Specifically, the NLP and ILP groups demonstrated increased body and gonadal masses, decreased hypothalamic Dio3 expression, and elevated testosterone levels. These results indicate that both the artificial photoperiod schedule (increasing light duration by 3 min per day) and the natural, gradually increasing photoperiod yield comparable outcomes in gonadal development and gene expression in Brandt’s voles.
Reports on the effects of varying photoperiod lengths have been documented. For instance, field voles (Microtus agrestis) showed minimal growth rate under 13 h of light, while 13.5 h or more led to progressively heavier testes [46]. Siberian hamsters exhibited rapid gonadal development before 6 weeks post-summer solstice, which slowed thereafter [47]. Common voles (Microtus arvalis) display a gradient change in testicular activity and hypothalamic Dio2 and Dio3 expression from 16L:8D to 6L:18D in two-hour intervals [48]. Despite only using two patterns of LP, similarities were observed between the two groups, with significant differences from the DSP group. This study is the first to compare photoperiodic responses across various gradually changing patterns. Notably, differences were found between ILP and NLP at postnatal week 4, particularly in testes and seminal vesicle mass of male offspring, indicating sensitivity to subtle photoperiod changes near weaning. These findings highlight the importance of considering early subtle photoperiod differences in developmental responses. This insight is valuable for designing future study photoperiod settings.

4.2. Divergent Photoperiodic Responses Between Male Offspring and Paternal Voles

An intriguing finding of our study is that male offspring exhibited distinct gonadal activity and hypothalamic Dio3 expression under LP and SP conditions, while paternal voles did not show a significant response to these treatments. Additionally, our field research demonstrated that adult male voles, in comparison to newborn juveniles, exhibited continuous gonadal development and elevated testosterone levels in early autumn after overwintering, whereas newborn males experienced complete gonadal suppression [21]. Monitoring fecal testosterone levels in semi-natural enclosures, indicated that gonadal inhibition commenced around the summer solstice [44].
Despite being exposed to DSP, male offspring still exhibited a significant development of gonad glands during the 12-week treatment, indicating a reduced inhibitory effect of SP on gonadal gland development. This phenomenon may be linked to photorefractoriness, as seen in hamsters exposed to SP for over 10 weeks [49,50]. The hypothalamic Dio3 gene likely plays a pivotal role in this process. Previous studies in Syrian or Siberian hamsters demonstrated that gonadal glands that were initially suppressed under SP exposure began to reactivate after 12 or 16 weeks, respectively. Additionally, the expression of hypothalamic Dio3 decreased significantly compared to Dio2 gene expression [6]. Data also revealed a notable decrease in hypothalamic Dio3 expression in 12-week-old male offspring exposed to DSP compared to those at 4 weeks of age. These findings suggest that maintaining high levels of hypothalamic Dio3 expression is essential for responding to SP.
Our study provides initial evidence on the comparison of hypothalamic Dio2 and Dio3 expression levels in old and young rodents. In male offspring exposed to the DSP condition, a significant decrease in hypothalamic Dio3 expression was observed, while in paternal voles, no significant difference was found in gonadal mass or hypothalamic Dio2 and Dio3 expression. These results support the presence of photoperiodism in juvenile Brandt’s voles, partially explaining the inability of the SP condition to inhibit gonadal activity in wild voles as noted in our previous study [21].
In terms of ecological significance, paternal voles display reduced sensitivity to photoperiodic changes, possibly attributed to their short lifespan in the wild, typically lasting only several months. Surviving overwintered males resume gonadal function before the breeding season begins, playing a crucial role in driving breeding efforts throughout the reproductive season. Given their short lifespan, often not exceeding a second winter, it is essential for these males to maximize reproductive output to ensure species survival.

4.3. Hypothalamic Dio3 Probably Plays an Important Role in Regulating the Seasonal Breeding of Brandt’s Vole

Compared to the NLP and ILP groups, DSP treatment significantly inhibited somatic and gonadal development in male offspring, accompanied by markedly increased hypothalamic Dio3 expression, particularly in early stages, while showing only a slight inhibitory effect on Dio2 expression. These findings indicate a potentially pivotal role of Dio3 in regulating local T3 levels in the hypothalamus, thereby transmitting photoperiodic signals to modulate seasonal responses in young Brandt’s voles. The modulation of local T3 concentration stimulates GnRH activity in the hypothalamus, facilitating gonadal growth in avian and rodent species [27,51,52,53]. Previous studies have identified hypothalamic Dio2 as the key photoperiodic gene involved in seasonal transitions in Japanese quail (Coturnix coturnix japonica) [51], Siberian hamster [54], and Syrian hamster [55]. Subsequently, the Dio3 gene was discovered, exhibiting an opposing photoperiodic response to Dio2 [22,56]. In this study, Dio3 exhibited higher expression in DSP offspring at postnatal week 4. While data prior to postnatal week 4 were not available, hindering the determination of expression patterns before this age, previous research using in situ hybridization in Siberian hamsters revealed that hypothalamic Dio2 displayed elevated expression under LP condition at birth, whereas Dio3 showed no difference at birth but exhibited higher expression under SP condition at postnatal day 15, when Dio2 expression no longer differed significantly [10]. Whether Brandt’s voles exhibit similar expression patterns during early postnatal development warrants further investigation.
However, in line with our findings, previous studies have indicated a relatively weaker photoperiodic sensitivity of the Dio2 gene compared to the Dio3 gene. For example, research on Siberian hamsters demonstrated that changes in Dio3 expression, rather than Dio2, were notably affected by various photoperiodic and T3 treatments. These changes were observed through semiquantitative in situ hybridization in adult hamsters [52] and quantitative qPCR in juvenile hamsters [22]. Shifting photoperiod treatments between LP and SP conditions resulted in significant alterations in hypothalamic Dio3 expression in both male and female hamsters, whereas changes in Dio2 expression were only observed in males [57]. Notably, under SP conditions and melatonin treatment, only hypothalamic Dio3 expression showed a significant increase, with no corresponding change in Dio2 expression [58]. Furthermore, our field study on Brandt’s voles revealed that the seasonal fluctuation of hypothalamic Dio2 expression was less pronounced compared to Dio3 expression [21]. Additionally, Dio3 expression consistently decreased with gonadal development in male offspring, suggesting a weakening of its inhibitory effects on the gonadal gland. These findings collectively suggest that the hypothalamic Dio3 gene likely plays a more pivotal role in regulating local T3 concentration during seasonal transitions in newborn Brandt’s voles. This conclusion is reinforced by a study on tundra voles (Microtus oeconomus) and common voles, which highlighted the significant influence of the photoperiod on Dio2 and Dio3 expression in the developing hypothalamus of both species [59]. Additionally, Dio2 expression was found to be highly responsive to changes in ambient temperature, particularly in the spring-programmed tundra voles, while Dio3 expression exhibited greater sensitivity to variations in the photoperiod [60].
Surprisingly, Kiss1 and Rfrp3 were found to be essential for puberty onset and reproductive activation in mammals [23,25,61,62,63], as well as for responding to the photoperiod and melatonin [25,28,64]. However, our current data contradict these established roles, as we did not observe any photoperiodic differences in the expression of these genes, consistent with another study [45]. It is possible that the expression patterns of these genes have a complex temporal dynamic during the development of young rodents [65,66]. Taken together, these findings highlight the significant role of Dio3 in mediating seasonal physiological adaptations influenced by the photoperiod.
This study was limited by the absence of sampling before postnatal week 4, preventing the assessment of early developmental changes and gene expression patterns. The existence and significance of early differences in gene expression remain unclear. This limitation may have led to an overemphasis on Dio3’s role, potentially overlooking early-stage effects of other genes. Additionally, the lack of continuity in tracking individuals from juvenile to adult stages hindered the observation of longitudinal changes within subjects. The random sampling of different individuals at each time point may have introduced individual variations, complicating the interpretation of changes in gonadal responses to age-related photoperiodic changes. Future studies could explore these limitations by incorporating earlier timepoint samples and monitoring individual development across various life stages.

5. Conclusions

In summary, we found that exposure to DSP impeded the gonadal development of juvenile Brandt’s voles and led to a distinct difference in hypothalamic Dio3 expression compared to ILP- and NLP-exposed voles. Adult male voles exhibited decreased sensitivity to short photoperiods, as indicated by alterations in the gonadal gland and hypothalamic Dio3 expression. These findings imply that hypothalamic Dio3 likely plays a pivotal role in modulating local T3 concentration to regulate the developmental trajectory of the gonadal gland in Brandt’s voles.

Author Contributions

Conceptualization, D.W. and N.L.; methodology, L.W. and Z.L.; software, L.W.; validation, L.W., Z.L., and N.L.; formal analysis, L.W., N.L. and X.-H.L.; writing—original draft preparation, D.W. and L.W. and N.L.; writing—review and editing, D.W., L.W., Y.S., and N.L.; visualization, L.W.; supervision, X.-H.L.; project administration, X.-H.L. and D.W.; funding acquisition, D.W. and X.-H.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (grant number 32372571, 32090022, 31972284), the Project of Northern Agriculture and Livestock Husbandry Technical Innovation Center, Chinese Academy of Agricultural Sciences (BFGJ2022007), and the Xinjiang Tian-Chi Talents Introduction Program.

Institutional Review Board Statement

All animal experiments were approved by the animal ethics and welfare committee of the Institute of Plant Protection, Chinese Academy of Agricultural Sciences (protocol code IPP-201606R010).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Acknowledgments

This work was supported by the National Nature Science Foundation of China (32372571, 32090022, 31972284), the Foundation of Chinese Academy of Agricultural Sciences (BFGJ2022007), and the Xinjiang Tian-Chi Talents Introduction Program. Ethical clearance for the study was granted by the Chinese Academy of Agricultural Sciences. We are grateful to Hongjie Liang, Lanju Zhou, and Yuanzhao Geng for their assistance in laboratory work.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Bronson, F.H. Climate Change and Seasonal Reproduction in Mammals. Philos. Trans. R. Soc. B Biol. Sci. 2009, 364, 3331–3340. [Google Scholar] [CrossRef] [PubMed]
  2. Nakane, Y.; Yoshimura, T. Photoperiodic Regulation of Reproduction in Vertebrates. Annu. Rev. Anim. Biosci. 2019, 7, 173–194. [Google Scholar] [CrossRef] [PubMed]
  3. Wood, S.H.; Hindle, M.M.; Mizoro, Y.; Cheng, Y.; Saer, B.R.C.; Miedzinska, K.; Christian, H.C.; Begley, N.; McNeilly, J.; McNeilly, A.S.; et al. Circadian Clock Mechanism Driving Mammalian Photoperiodism. Nat. Commun. 2020, 11, 4291. [Google Scholar] [CrossRef] [PubMed]
  4. Stevenson, T.J.; Ball, G.F. Information Theory and the Neuropeptidergic Regulation of Seasonal Reproduction in Mammals and Birds. Proc. R. Soc. B Biol. Sci. 2011, 278, 2477–2485. [Google Scholar] [CrossRef] [PubMed]
  5. Gorman, M.R. Seasonal Adaptations of Siberian Hamsters. I. Accelerated Gonadal and Somatic Development in Increasing Versus Static Long Day Lengths1. Biol. Reprod. 1995, 53, 110–115. [Google Scholar] [CrossRef] [PubMed]
  6. Milesi, S.; Simonneaux, V.; Klosen, P. Downregulation of Deiodinase 3 Is the Earliest Event in Photoperiodic and Photorefractory Activation of the Gonadotropic Axis in Seasonal Hamsters. Sci. Rep. 2017, 7, 17739. [Google Scholar] [CrossRef]
  7. Negus, N.C.; Berger, P.J.; Brown, B.W. Microtine Population Dynamics in a Predictable Environment. Can. J. Zool. 1986, 64, 785–792. [Google Scholar] [CrossRef]
  8. Horton, T.H. Fetal Origins of Developmental Plasticity: Animal Models of Induced Life History Variation. Am. J. Hum. Biol. 2005, 17, 34–43. [Google Scholar] [CrossRef]
  9. Horton, T.H.; Ray, S.L.; Stetson, M.H. Maternal Transfer of Photoperiodic Information in Siberian Hamsters. III. Melatonin Injections Program Postnatal Reproductive Development Expressed in Constant Light. Biol. Reprod. 1989, 41, 34–39. [Google Scholar] [CrossRef] [PubMed]
  10. Sáenz de Miera, C.; Bothorel, B.; Jaeger, C.; Simonneaux, V.; Hazlerigg, D. Maternal Photoperiod Programs Hypothalamic Thyroid Status via the Fetal Pituitary Gland. Proc. Natl. Acad. Sci. USA 2017, 114, 8408–8413. [Google Scholar] [CrossRef]
  11. Pévet, P. The Role of the Pineal Gland in the Photoperiodic Control of Reproduction in Different Hamster Species. Reprod. Nutr. Développement 1988, 28, 443–458. [Google Scholar] [CrossRef]
  12. Dardente, H.; Klosen, P.; Pévet, P.; Masson-Pévet, M. MT1 Melatonin Receptor MRNA Expressing Cells in the Pars Tuberalis of the European Hamster: Effect of Photoperiod. J. Neuroendocrinol. 2003, 15, 778–786. [Google Scholar] [CrossRef]
  13. Klosen, P.; Bienvenu, C.; Demarteau, O.; Dardente, H.; Guerrero, H.; Pévet, P.; Masson-Pévet, M. The Mt1 Melatonin Receptor and RORβ Receptor Are Co-Localized in Specific TSH-Immunoreactive Cells in the Pars Tuberalis of the Rat Pituitary. J. Histochem. Cytochem. 2002, 50, 1647–1657. [Google Scholar] [CrossRef]
  14. Ono, H.; Hoshino, Y.; Yasuo, S.; Watanabe, M.; Nakane, Y.; Murai, A.; Ebihara, S.; Korf, H.-W.; Yoshimura, T. Involvement of Thyrotropin in Photoperiodic Signal Transduction in Mice. Proc. Natl. Acad. Sci. USA 2008, 105, 18238–18242. [Google Scholar] [CrossRef] [PubMed]
  15. Böckers, T.M.; Niklowitz, P.; Bockmann, J.; Fauteck, J.-D.; Wittkowski, W.; Kreutz, M.R. Daily Melatonin Injections Induce Cytological Changes in Pars Tuberalis-Specific Cells Similar to Short Photoperiod. J. Neuroendocrinol. 1995, 7, 607–613. [Google Scholar] [CrossRef] [PubMed]
  16. Bockmann, J.; Böckers, T.M.; Vennemann, B.; Niklowitz, P.; Müller, J.; Wittkowski, W.; Sabel, B.; Kreutz, M.R. Short Photoperiod-Dependent down-Regulation of Thyrotropin-Alpha and -Beta in Hamster Pars Tuberalis-Specific Cells Is Prevented by Pinealectomy. Endocrinology 1996, 137, 1804–1813. [Google Scholar] [CrossRef] [PubMed]
  17. Hanon, E.A.; Routledge, K.; Dardente, H.; Masson-Pévet, M.; Morgan, P.J.; Hazlerigg, D.G. Effect of Photoperiod on the Thyroid-Stimulating Hormone Neuroendocrine System in the European Hamster (Cricetus cricetus). J. Neuroendocrinol. 2010, 22, 51–55. [Google Scholar] [CrossRef] [PubMed]
  18. Bianco, A.C.; Salvatore, D.; Gereben, B.; Berry, M.J.; Larsen, P.R. Biochemistry, Cellular and Molecular Biology, and Physiological Roles of the Iodothyronine Selenodeiodinases. Endocr. Rev. 2002, 23, 38–89. [Google Scholar] [CrossRef] [PubMed]
  19. Stevenson, T.J. Circannual and Circadian Rhythms of Hypothalamic DNA Methyltransferase and Histone Deacetylase Expression in Male Siberian Hamsters (Phodopus sungorus). Gen. Comp. Endocrinol. 2017, 243, 130–137. [Google Scholar] [CrossRef] [PubMed]
  20. Król, E.; Douglas, A.; Dardente, H.; Birnie, M.J.; van der Vinne, V.; Eijer, W.G.; Gerkema, M.P.; Hazlerigg, D.G.; Hut, R.A. Strong Pituitary and Hypothalamic Responses to Photoperiod but Not to 6-Methoxy-2-Benzoxazolinone in Female Common Voles (Microtus arvalis). Gen. Comp. Endocrinol. 2012, 179, 289–295. [Google Scholar] [CrossRef]
  21. Wang, D.; Li, N.; Tian, L.; Ren, F.; Li, Z.; Chen, Y.; Liu, L.; Hu, X.; Zhang, X.; Song, Y.; et al. Dynamic Expressions of Hypothalamic Genes Regulate Seasonal Breeding in a Natural Rodent Population. Mol. Ecol. 2019, 28, 3508–3522. [Google Scholar] [CrossRef] [PubMed]
  22. Prendergast, B.J.; Pyter, L.M.; Kampf-Lassin, A.; Patel, P.N.; Stevenson, T.J. Rapid Induction of Hypothalamic Iodothyronine Deiodinase Expression by Photoperiod and Melatonin in Juvenile Siberian Hamsters (Phodopus sungorus). Endocrinology 2013, 154, 831–841. [Google Scholar] [CrossRef] [PubMed]
  23. Irwig, M.S.; Fraley, G.S.; Smith, J.T.; Acohido, B.V.; Popa, S.M.; Cunningham, M.J.; Gottsch, M.L.; Clifton, D.K.; Steiner, R.A. Kisspeptin Activation of Gonadotropin Releasing Hormone Neurons and Regulation of KiSS-1 MRNA in the Male Rat. Neuroendocrinology 2004, 80, 264–272. [Google Scholar] [CrossRef] [PubMed]
  24. Rizwan, M.Z.; Poling, M.C.; Corr, M.; Cornes, P.A.; Augustine, R.A.; Quennell, J.H.; Kauffman, A.S.; Anderson, G.M. RFamide-Related Peptide-3 Receptor Gene Expression in GnRH and Kisspeptin Neurons and GnRH-Dependent Mechanism of Action. Endocrinology 2012, 153, 3770–3779. [Google Scholar] [CrossRef] [PubMed]
  25. Ubuka, T.; Inoue, K.; Fukuda, Y.; Mizuno, T.; Ukena, K.; Kriegsfeld, L.J.; Tsutsui, K. Identification, Expression, and Physiological Functions of Siberian Hamster Gonadotropin-Inhibitory Hormone. Endocrinology 2012, 153, 373–385. [Google Scholar] [CrossRef]
  26. Henningsen, J.B.; Gauer, F.; Simonneaux, V. RFRP Neurons—The Doorway to Understanding Seasonal Reproduction in Mammals. Front. Endocrinol. 2016, 7, 36. [Google Scholar] [CrossRef]
  27. Henson, J.R.; Carter, S.N.; Freeman, D.A. Exogenous T3 Elicits Long Day–Like Alterations in Testis Size and the RFamides Kisspeptin and Gonadotropin-Inhibitory Hormone in Short-Day Siberian Hamsters. J. Biol. Rhythm. 2013, 28, 193–200. [Google Scholar] [CrossRef]
  28. Rasri-Klosen, K.; Simonneaux, V.; Klosen, P. Differential Response Patterns of Kisspeptin and RFamide-related Peptide to Photoperiod and Sex Steroid Feedback in the Djungarian Hamster (Phodopus sungorus). J. Neuroendocrinol. 2017, 29, e12529. [Google Scholar] [CrossRef]
  29. Kampf-Lassin, A.; Prendergast, B.J. Photoperiod History-Dependent Responses to Intermediate Day Lengths Engage Hypothalamic Iodothyronine Deiodinase Type III MRNA Expression. Am. J. Physiol. Integr. Comp. Physiol. 2013, 304, R628–R635. [Google Scholar] [CrossRef] [PubMed]
  30. Sáenz de Miera, C. Maternal Photoperiodic Programming Enlightens the Internal Regulation of Thyroid-Hormone Deiodinases in Tanycytes. J. Neuroendocrinol. 2019, 31, e12679. [Google Scholar] [CrossRef] [PubMed]
  31. Hoffmann, K. Effects of Short Photoperiods on Puberty, Growth and Moult in the Djungarian Hamster (Phodopus sungorus). Reproduction 1978, 54, 29–35. [Google Scholar] [CrossRef] [PubMed]
  32. Yellon, S.M.; Goldman, B.D. Photoperiod Control of Reproductive Development in the Male Djungarian Hamster (Phodopus sungorus). Endocrinology 1984, 114, 664–670. [Google Scholar] [CrossRef] [PubMed]
  33. Darrow, J.M.; Davis, F.C.; Elliott, J.A.; Stetson, M.H.; Turek, F.W.; Menaker, M. Influence of Photoperiod on Reproductive Development in the Golden Hamster. Biol. Reprod. 1980, 22, 443–450. [Google Scholar] [CrossRef]
  34. Gündüz, B.; Stetson, M.H. The Impact of Photoperiods and Melatonin on Gonadal Development in Juvenile Turkish Hamsters (Mesocricetus brandti). J. Pineal Res. 1998, 25, 193–200. [Google Scholar] [CrossRef] [PubMed]
  35. Timonin, M.E.; Place, N.J.; Wanderi, E.; Wynne-Edwards, K.E. Phodopus Campbelli Detect Reduced Photoperiod during Development but, Unlike Phodopus sungorus, Retain Functional Reproductive Physiology. Reproduction 2006, 132, 661–670. [Google Scholar] [CrossRef]
  36. Zhong, W.; Wang, M.; Wan, X. Ecological Management of Brandt’s Vole (Microtus brandti) in Inner Mongolia, China. Ecol. Rodent Manag. 1999, 199–214. [Google Scholar]
  37. Zhong, W.; Wang, G.; Zhou, Q.; Wang, G. Communal Food Caches and Social Groups of Brandt’s Voles in the Typical Steppes of Inner Mongolia, China. J. Arid Environ. 2007, 68, 398–407. [Google Scholar] [CrossRef]
  38. Yue, L.F.; Wang, D.W.; Huang, B.H.; Liu, X.H. Characterization of Nine Novel Microsatellite Markers from Brandt’s Vole (Lasiopodomys brandtii). Mol. Ecol. Resour. 2009, 9, 1194–1196. [Google Scholar] [CrossRef]
  39. Wang, D.; Li, N.; Liu, M.; Huang, B.; Liu, Q.; Liu, X. Behavioral Evaluation of Quinestrol as a Sterilant in Male Brandt’s Voles. Physiol. Behav. 2011, 104, 1024–1030. [Google Scholar] [CrossRef]
  40. Liu, X.H.; Yue, L.F.; Wang, D.W.; Li, N.; Cong, L. Inbreeding Avoidance Drives Consistent Variation of Fine-Scale Genetic Structure Caused by Dispersal in the Seasonal Mating System of Brandt’s Voles. PLoS ONE 2013, 8, e58101. [Google Scholar] [CrossRef]
  41. Li, G.; Hou, X.; Wan, X.; Zhang, Z. Sheep Grazing Causes Shift in Sex Ratio and Cohort Structure of Brandt’s Vole: Implication of Their Adaptation to Food Shortage. Integr. Zool. 2016, 11, 76–84. [Google Scholar] [CrossRef] [PubMed]
  42. Li, G.; Yin, B.; Wan, X.; Wei, W.; Wang, G.; Krebs, C.J.; Zhang, Z. Successive Sheep Grazing Reduces Population Density of Brandt’s Voles in Steppe Grassland by Altering Food Resources: A Large Manipulative Experiment. Oecologia 2016, 180, 149–159. [Google Scholar] [CrossRef]
  43. Liu, Z.; Sun, R. Study on Physiological Age Structure of Brandt’s Voles (Microtus brandti). Acta Theriol. Sin. 1993, 13, 50–60. [Google Scholar] [CrossRef]
  44. Chen, Y.; Wang, D.W.; Li, N.; Hu, X.F.; Ren, F.; Hao, W.L.; Song, Y.; Liu, X.H. Kinship Analysis Reveals Reproductive Success Skewed toward Overwintered Brandt’s Voles in Semi-Natural Enclosures. Integr. Zool. 2019, 14, 435–445. [Google Scholar] [CrossRef] [PubMed]
  45. Qiao, Y.; Li, N.; Song, Y.; Liu, X.; Wang, D. Short Photoperiod Inhibited Gonadal Growth and Elevated Hypothalamic Dio3 Expression Unrelated to Promoter DNA Methylation in Young Brandt’s Voles. Integr. Zool. 2024, 1–14. [Google Scholar] [CrossRef] [PubMed]
  46. Grocock, C.A. Effect of Different Photoperiods on Testicular Weight Changes in the Vole, Microtus Agrestis. J. Reprod. Fertil. 1981, 62, 25–32. [Google Scholar] [CrossRef] [PubMed]
  47. Butler, M.P.; Turner, K.W.; Jin, H.P.; Butler, J.P.; Trumbull, J.J.; Dunn, S.P.; Villa, P.; Zucker, I. Simulated Natural Day Lengths Synchronize Seasonal Rhythms of Asynchronously Born Male Siberian Hamsters. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 2007, 293, R402–R412. [Google Scholar] [CrossRef] [PubMed]
  48. van Rosmalen, L.; van Dalum, J.; Appenroth, D.; Roodenrijs, R.T.M.; de Wit, L.; Hazlerigg, D.G.; Hut, R.A. Mechanisms of Temperature Modulation in Mammalian Seasonal Timing. FASEB J. 2021, 35, e21605. [Google Scholar] [CrossRef] [PubMed]
  49. Reiter, R.J. Evidence for Refractoriness of the Pituitary-gonadal Axis to the Pineal Gland in Golden Hamsters and Its Possible Implications in Annual Reproductive Rhythms. Anat. Rec. 1972, 173, 365–371. [Google Scholar] [CrossRef] [PubMed]
  50. Prendergast, B.J.; Wynne-Edwards, K.E.; Yellon, S.M.; Nelson, R.J. Photorefractoriness of Immune Function in Male Siberian Hamsters (Phodopus sungorus). J. Neuroendocrinol. 2002, 14, 318–329. [Google Scholar] [CrossRef] [PubMed]
  51. Yoshimura, T.; Yasuo, S.; Watanabe, M.; Iigo, M.; Yamamura, T.; Hirunagi, K.; Ebihara, S. Light-Induced Hormone Conversion of T4 to T3 Regulates Photoperiodic Response of Gonads in Birds. Nature 2003, 426, 178–181. [Google Scholar] [CrossRef] [PubMed]
  52. Barrett, P.; Ebling, F.J.P.; Schuhler, S.; Wilson, D.; Ross, A.W.; Warner, A.; Jethwa, P.; Boelen, A.; Visser, T.J.; Ozanne, D.M.; et al. Hypothalamic Thyroid Hormone Catabolism Acts as a Gatekeeper for the Seasonal Control of Body Weight and Reproduction. Endocrinology 2007, 148, 3608–3617. [Google Scholar] [CrossRef] [PubMed]
  53. Freeman, D.A.; Teubner, B.J.W.; Smith, C.D.; Prendergast, B.J. Exogenous T3 Mimics Long Day Lengths in Siberian Hamsters. Am. J. Physiol. Integr. Comp. Physiol. 2007, 292, R2368–R2372. [Google Scholar] [CrossRef]
  54. Watanabe, M.; Yasuo, S.; Watanabe, T.; Yamamura, T.; Nakao, N.; Ebihara, S.; Yoshimura, T. Photoperiodic Regulation of Type 2 Deiodinase Gene in Djungarian Hamster: Possible Homologies between Avian and Mammalian Photoperiodic Regulation of Reproduction. Endocrinology 2004, 145, 1546–1549. [Google Scholar] [CrossRef] [PubMed][Green Version]
  55. Revel, F.G.; Saboureau, M.; Pévet, P.; Mikkelsen, J.D.; Simonneaux, V. Melatonin Regulates Type 2 Deiodinase Gene Expression in the Syrian Hamster. Endocrinology 2006, 147, 4680–4687. [Google Scholar] [CrossRef] [PubMed]
  56. Watanabe, T.; Yamamura, T.; Watanabe, M.; Yasuo, S.; Nakao, N.; Dawson, A.; Ebihara, S.; Yoshimura, T. Hypothalamic Expression of Thyroid Hormone-Activating and -Inactivating Enzyme Genes in Relation to Photorefractoriness in Birds and Mammals. Am. J. Physiol. Integr. Comp. Physiol. 2007, 292, R568–R572. [Google Scholar] [CrossRef] [PubMed]
  57. Kampf-Lassin, A.; Prendergast, B.J. Acute Downregulation of Type II and Type III Iodothyronine Deiodinases by Photoperiod in Peripubertal Male and Female Siberian Hamsters. Gen. Comp. Endocrinol. 2013, 193, 72–78. [Google Scholar] [CrossRef]
  58. Stevenson, T.J.; Prendergast, B.J. Reversible DNA Methylation Regulates Seasonal Photoperiodic Time Measurement. Proc. Natl. Acad. Sci. USA 2013, 110, 16651–16656. [Google Scholar] [CrossRef]
  59. Van Rosmalen, L.; Van Dalum, J.; Hazlerigg, D.G.; Hut, R.A. Gonads or Body? Differences in Gonadal and Somatic Photoperiodic Growth Response in Two Vole Species. J. Exp. Biol. 2020, 223, jeb230987. [Google Scholar] [CrossRef] [PubMed]
  60. van Dalum, M.J.; van Rosmalen, L.; Appenroth, D.; Cazarez Marquez, F.; Roodenrijs, R.T.M.; de Wit, L.; Hut, R.A.; Hazlerigg, D.G. Ambient Temperature Effects on the Spring and Autumn Somatic Growth Trajectory Show Plasticity in the Photoneuroendocrine Response Pathway in the Tundra Vole. J. Biol. Rhythm. 2023, 38, 586–600. [Google Scholar] [CrossRef] [PubMed]
  61. Ancel, C.; Bentsen, A.H.; Sébert, M.E.; Tena-Sempere, M.; Mikkelsen, J.D.; Simonneaux, V. Stimulatory Effect of RFRP-3 on the Gonadotrophic Axis in the Male Syrian Hamster: The Exception Proves the Rule. Endocrinology 2012, 153, 1352–1363. [Google Scholar] [CrossRef] [PubMed]
  62. Quennell, J.H.; Rizwan, M.Z.; Relf, H.-L.; Anderson, G.M. Developmental and Steroidogenic Effects on the Gene Expression of RFamide Related Peptides and Their Receptor in the Rat Brain and Pituitary Gland. J. Neuroendocrinol. 2010, 22, 309–316. [Google Scholar] [CrossRef] [PubMed]
  63. Poling, M.C.; Kauffman, A.S. Regulation and Function of RFRP-3 (GnIH) Neurons during Postnatal Development. Front. Endocrinol. 2015, 6, 150. [Google Scholar] [CrossRef] [PubMed]
  64. Revel, F.G.; Saboureau, M.; Pévet, P.; Simonneaux, V.; Mikkelsen, J.D. RFamide-Related Peptide Gene Is a Melatonin-Driven Photoperiodic Gene. Endocrinology 2008, 149, 902–912. [Google Scholar] [CrossRef]
  65. Poling, M.C.; Kim, J.; Dhamija, S.; Kauffman, A.S. Development, Sex Steroid Regulation, and Phenotypic Characterization of RFamide-Related Peptide (Rfrp) Gene Expression and RFamide Receptors in the Mouse Hypothalamus. Endocrinology 2012, 153, 1827–1840. [Google Scholar] [CrossRef]
  66. Walker, D.M.; Kirson, D.; Perez, L.F.; Gore, A.C. Molecular Profiling of Postnatal Development of the Hypothalamus in Female and Male Rats. Biol. Reprod. 2012, 87, 1–12. [Google Scholar] [CrossRef]
Figure 1. Photoperiod paradigm. The horizontal axis shows the critical timepoints, including paired, treated, and sampling, while the line represents the day length of three photoperiod treatments. Solid and dotted lines differentiate between natural and simulated photoperiods, with red indicating increasing and blue indicating decreasing day lengths. The initial natural day lengths are denoted above the simulated timings in brackets on the left, while the terminal day lengths are indicated at the right end of the lines. ILP: increasing long photoperiod; DSP: declining short photoperiod; NLP: natural spring long photoperiod; w: postnatal weeks.
Figure 1. Photoperiod paradigm. The horizontal axis shows the critical timepoints, including paired, treated, and sampling, while the line represents the day length of three photoperiod treatments. Solid and dotted lines differentiate between natural and simulated photoperiods, with red indicating increasing and blue indicating decreasing day lengths. The initial natural day lengths are denoted above the simulated timings in brackets on the left, while the terminal day lengths are indicated at the right end of the lines. ILP: increasing long photoperiod; DSP: declining short photoperiod; NLP: natural spring long photoperiod; w: postnatal weeks.
Animals 15 00469 g001
Figure 2. Physiological parameters of offspring voles under natural spring long photoperiod (NLP), increasing long photoperiod (ILP), and decreasing short photoperiod (DSP) during postnatal 12 weeks: (A) Body mass, (B) testis mass, (C) seminal vesicle mass, (D) serum testosterone levels of male offspring. Asterisks represent significant differences among the three groups; *: p < 0.05, **: p < 0.01, ***: p < 0.001. Above each timepoint, different signs indicate the significance among the three groups. Different letters indicate significant differences between groups: a, between NLP and ILP; b, between NLP and DSP; c, between ILP and DSP.
Figure 2. Physiological parameters of offspring voles under natural spring long photoperiod (NLP), increasing long photoperiod (ILP), and decreasing short photoperiod (DSP) during postnatal 12 weeks: (A) Body mass, (B) testis mass, (C) seminal vesicle mass, (D) serum testosterone levels of male offspring. Asterisks represent significant differences among the three groups; *: p < 0.05, **: p < 0.01, ***: p < 0.001. Above each timepoint, different signs indicate the significance among the three groups. Different letters indicate significant differences between groups: a, between NLP and ILP; b, between NLP and DSP; c, between ILP and DSP.
Animals 15 00469 g002
Figure 3. Physiological parameters of paternal voles under natural spring long photoperiod (NLP), increasing long photoperiod (ILP), and decreasing short photoperiod (DSP) during 12 weeks from offspring birth: (A) Body mass, (B) testis mass, (C) seminal vesicle mass, (D) serum testosterone levels of paternal voles. Asterisks represent significant differences among the three groups; *: p < 0.05. Above each timepoint, different signs indicate the significance among the three groups. Different letters indicate significant differences between groups: a, between NLP and ILP.
Figure 3. Physiological parameters of paternal voles under natural spring long photoperiod (NLP), increasing long photoperiod (ILP), and decreasing short photoperiod (DSP) during 12 weeks from offspring birth: (A) Body mass, (B) testis mass, (C) seminal vesicle mass, (D) serum testosterone levels of paternal voles. Asterisks represent significant differences among the three groups; *: p < 0.05. Above each timepoint, different signs indicate the significance among the three groups. Different letters indicate significant differences between groups: a, between NLP and ILP.
Animals 15 00469 g003
Figure 4. Hypothalamic gene expression of offspring and paternal voles under natural spring long photoperiod (NLP), increasing long photoperiod (ILP), and decreasing short photoperiod (DSP) during 12 weeks from offspring birth. Relative expression of (A,B) Dio2, (C,D) Dio3, (E,F) Kiss1, (G,H) Rfrp3, (I,J) GnRH in the hypothalamus from male offspring and paternal voles, respectively. Asterisks represent significant differences among the three groups; *: p ≤ 0.05, **: p < 0.01. Above each timepoint, different signs indicate the significance among the three groups. Different letters indicate significant differences between groups: b, between NLP and DSP; c, between ILP and DSP.
Figure 4. Hypothalamic gene expression of offspring and paternal voles under natural spring long photoperiod (NLP), increasing long photoperiod (ILP), and decreasing short photoperiod (DSP) during 12 weeks from offspring birth. Relative expression of (A,B) Dio2, (C,D) Dio3, (E,F) Kiss1, (G,H) Rfrp3, (I,J) GnRH in the hypothalamus from male offspring and paternal voles, respectively. Asterisks represent significant differences among the three groups; *: p ≤ 0.05, **: p < 0.01. Above each timepoint, different signs indicate the significance among the three groups. Different letters indicate significant differences between groups: b, between NLP and DSP; c, between ILP and DSP.
Animals 15 00469 g004
Table 1. Sampling numbers for each group across different postnatal timepoints.
Table 1. Sampling numbers for each group across different postnatal timepoints.
Postnatal Week Male Offspring (Number)Paternal Voles (Number)
ILPDSPNLPILPDSPNLP
4 weeks101010666
6 weeks8910---
8 weeks8910666
12 weeks7109774
Note: ILP, increasing long photoperiod; DSP, decreasing short photoperiod; NLP, natural increasing long photoperiod.
Table 2. Primers sequences of Brandt’s vole genes.
Table 2. Primers sequences of Brandt’s vole genes.
GenesLengthAnnealing TemperaturePrimer Sequence
γ-actin113 bp62 °CF: GCTCTCTTCCAGCCTTCCTTCCTG
R: GTGTTGGCGTACAGGTCCTTGCGG
Dio2103 bp62 °CF: TGCCTACAAACAGGTTAAATTGGGT
R: GGCTGTCTTCTTCAAGGCATAA
Dio3136 bp62 °CF: TCAACAGTGAAGGCGAGGAGGT
R: TCGTGGGCCTGCTTGAAGAAAT
GnRH124 bp62 °CF: CGATTCTTTCCAAGAGATGGG
R: CATCAGACTTTCCAGAGCTCCT
Kiss1143 bp62 °CF: CACTGGCTTCTTGGCAGCTACTG
R: GCCCTTTTCCCAGGCATTGA
Rfrp3112 bp62 °CF: GACAAATATCTCCAGCCTAGAGG
R: GGGCTGGACTCATCTTAATAACAT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, L.; Li, Z.; Song, Y.; Li, N.; Liu, X.-H.; Wang, D. Divergent Photoperiodic Responses in Hypothalamic Dio3 Expression and Gonadal Activity Between Offspring and Paternal Brandt’s Voles. Animals 2025, 15, 469. https://doi.org/10.3390/ani15040469

AMA Style

Wang L, Li Z, Song Y, Li N, Liu X-H, Wang D. Divergent Photoperiodic Responses in Hypothalamic Dio3 Expression and Gonadal Activity Between Offspring and Paternal Brandt’s Voles. Animals. 2025; 15(4):469. https://doi.org/10.3390/ani15040469

Chicago/Turabian Style

Wang, Lewen, Zhengguang Li, Ying Song, Ning Li, Xiao-Hui Liu, and Dawei Wang. 2025. "Divergent Photoperiodic Responses in Hypothalamic Dio3 Expression and Gonadal Activity Between Offspring and Paternal Brandt’s Voles" Animals 15, no. 4: 469. https://doi.org/10.3390/ani15040469

APA Style

Wang, L., Li, Z., Song, Y., Li, N., Liu, X.-H., & Wang, D. (2025). Divergent Photoperiodic Responses in Hypothalamic Dio3 Expression and Gonadal Activity Between Offspring and Paternal Brandt’s Voles. Animals, 15(4), 469. https://doi.org/10.3390/ani15040469

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop