Establishment and Biological Characteristics Analysis of a Hybrid Culter Lineage from Megalobrama amblycephala (♀) and Culter alburnus (♂)

Simple Summary

The topmouth culter and blunt snout bream are two economically important fish species for aquaculture. Crossing different fish species is an effective way to develop improved varieties, and we previously created a fertile hybrid named BTBTF₁ by crossing these two species. In this study, we produced a new hybrid lineage (BTBTF₁-F₂) through the self-mating of BTBTF₁ and analyzed their biological characteristics. We found that BTBTF₁-F₂ has the same 48 chromosomes as its parents, with morphological traits that are intermediate between the two but more similar to the topmouth culter in some aspects. It inherited genes from both parents and maintained stable genetics across generations, with lower overall genetic methylation than its parents. This stable new hybrid culter lineage benefits aquaculture and helps us understand genetic inheritance in hybrid fish.

Abstract

Culter alburnus (topmouth culter, TC) is extensively distributed in various rivers and lakes in China. As a widely adaptive fish species, they have significant economic value and special ecological roles. Intergeneric hybridization is a pivotal strategy for generating novel hybrid lineages and species. In a previous study, we obtained an improved bisexual hybrid culter, BTBTF₁, derived from the hybrid lineage of Megalobrama amblycephala (blunt snout bream, BSB, 2n = 48, ♀) × Culter alburnus (2n = 48, ♂). In this study, we established an improved hybrid culter lineage by the self-crossing of BTBTF₁ and evaluated the biological characteristics regarding cytology, morphology, and genetics. DNA content and chromosome analyses confirmed that BTBTF₁-F₂ was a diploid lineage (2n = 48), with morphological traits exhibiting intermediate values between parental species, except for significantly TC-biased full-length-to-body length (FL/BL) and body length-to-head length (BL/HL) ratios (p < 0.05). ITS sequencing analysis revealed that BTBTF₁-F₂ inherited ITS1 sequences from BSB and TC. The global methylation level in BTBTF₁-F₂ was substantially reduced compared to progenitors, characterized by elevated full and diminished hemimethylation states. Transcriptomic analysis identified 7877 differentially expressed genes (DEGs), displaying 9.05%/8.30% maternal (BSB)-dominant and 17.01%/18.95% paternal (TC)-dominant expression patterns in BTBTF₁ and F₂. Remarkable intergenerational similarity in phenotypic and molecular profiles, coupled with bidirectional inheritance of progenitor characteristics, confirmed BTBTF₁-F₂ as a genetically stable allodiploid lineage. Remarkably, methylation patterns, and DEG expression collectively demonstrated significant TC-oriented bias (p < 0.05). This study reports a novel stabilized allodiploid culter lineage after a comprehensive assessment at cytology, morphology, and genetic levels, and provides new insights into genetic bias in hybrid progeny.

1. Introduction

Topmouth culter (Culter alburnus, TC) is a type of fierce, carnivorous Cyprinidae species [1] living in the middle and upper layers of water. It is distributed in almost every river and lake in China [2]. As is well-known, TC has high economic value and special ecological roles [3,4], which have motivated the extensive research interests of ichthyologists. Distant hybridization, defined as crosses between distinct species or higher taxa [5], facilitates the integration of divergent genomes and generates profound phenotypic and genotypic alterations in hybrid offspring [6]. The hybrid progeny obtained are typically superior to their parents for a few characteristics, including growth rate [7] and meat quality [8], known as the hybrid vigor or heterosis [9], which is beneficial for breeding and production. Distant hybridization has been extensively used to prepare novel and improved fish types [10]. When hybridization yields fertile progeny, subsequent generations may be propagated through self-fertilization, thereby enabling the inheritance of heterosis. For instance, an improved triploid crucian carp with rapid growth rate and sterility was produced by crossing male allotetraploid lineages with female red crucian carp. This hybrid demonstrated significant economic value for aquaculture and played a crucial role in protecting wild fish resources due to its inability to mate with wild fish [11].

45S rDNA is a highly conserved housekeeping gene in eukaryotes. It serves as an effective molecular marker for analyzing the evolutionary relationships and mechanisms of species [12]. Its repeat unit consists of three rDNA transcription regions (18S, 5.8S, and 28S rDNA), two internal transcribed spacers (ITS1, ITS2), and an intergenic spacer region (IGS) [13]. ITS1 and ITS2 are minimally influenced by external factors and evolve rapidly. Most variations were independent point mutations with distinct interspecific differences. Consequently, ITS sequences are valuable molecular markers for species identification [14]. Its utility is validated in international studies on hybrid fish systematics [15].

Methylation-sensitive amplification polymorphism (MSAP), exploiting differences in the sensitivity of MspI and HpaII restriction enzymes to cytosine methylation for genome-wide methylation detection, has been confirmed to be feasible in numerous studies in plants [16,17] and animals [18]. RNA sequencing, established based on next-generation sequencing, performs high-throughput sequencing of all transcribed RNAs in tissue cells and is widely used in aquaculture and fisheries to study the inheritance and variation in gene expression in species [19].

In previous studies, a fertile allodiploid lineage derived from blunt snout bream (BSB, ♀) × topmouth culter (TC, ♂), known as BTF₁-F₆ [20], was identified. During spawning season (May–July) in 2017–2019, the new type of hybrid culter (BTBTF₁) was successfully obtained by two rounds of back-crossing of BTF₁, and was confirmed to be bisexual and fertile [21]. In this study, we established the hybrid lineage of BTBTF₁-F₂ by self-crossing of BTBTF₁, surveying the biological characteristics of morphology, DNA content, and chromosome number, and evaluating the genetic stability of the hybrid lineage at genomic, epigenetic, and transcriptomic levels using BSB and TC as controls. The results provide important insights into the heredity and variation in the process of hybrid lineage formation or speciation.

2. Materials and Methods

2.1. Ethics Statement

The guidelines established by the Administration of Affairs Concerning Animal Experimentation state that approval from the Science and Technology Bureau of China and the Department of Wildlife Administration is not necessary when the fish in question are neither rare nor endangered (first- or second-class state protection levels). The fish involved in this experiment were approved by the Biomedical Research Ethics Committee of Hunan Normal University (approval number: 2023 No. (610)). The fish were strongly anesthetized with 100 mg/L MS-222 (Sigma-Aldrich, St. Louis, MO, USA) before dissection. Fish caretakers and experimenters were certified under a professional training course for laboratory animal practitioners held by the Institute of Experimental Animals, Hunan Province, China.

2.2. Hybrid Lineage Establishment and Sample Collection

The fish specimens used in this study were obtained from the State Key Laboratory of Developmental Biology of Freshwater Fish, Hunan Normal University. During the spawning season (May–July) of 2022, 20 sexually mature female and male BTBTF₁ individuals were randomly selected. Female fish were injected with luteinizing hormone-releasing hormone analog (LHRH-A) and human chorionic gonadotropin (HCG) at doses of 9.5 μg/kg and 550 IU/kg, respectively. Subsequently, male fish were injected with the same type of oxytocic agent but at half the dosage. Afterwards, artificial insemination and subsequent rearing were conducted in accordance with the method described in [21]. Once they could swim freely, the hatched BTBTF₂ fries were transferred to a pre-fertilized pool enriched with soybean milk for cultivation. The preparation process of BTBTF₁-F₂ is illustrated in Figure 1.

2.3. Measurement of DNA Content and Preparation of Chromosomal Metaphase Spreads

To determine the ploidy levels of BTBTF₁-F₂, 50 samples each of BSB, TC, BTBTF_1, and BTBTF₂ were selected for DNA content analysis and chromosome preparation. Venous blood (0.2 mL) was collected from the dorsal vein of each fish and preserved in ACD (Acid–Citrate–Dextrose Solution). Following a previously defined protocol [21], blood samples were stained with 4′6-diamidino-2-phenylindole, and the average DNA content of each sample was measured using a flow cytometer (Cell Counter Analyzer, Partec, North Rhine-Westphalia, Germany). This method aligns with the FAO’s Genomic Characterization of Animal Genetic Resources: Practical Guide [22]. Compared to the average DNA contents of BSB and TC, the deviation of the ratio of DNA content of BTBTF₁-F₂ to the sum of that of BSB and TC from the expected ratio was detected through χ² tests with Yates’ correction. Based on this, BSB, TC, BTBTF_1, and BTBTF₂ individuals, exhibiting no difference in DNA content, were selected for preparing kidney chromosomes following a previously described method [23]. Ten individuals from each fish species were selected for chromosome preparation. Chromosomes in samples that met the following criteria were counted under an optical microscope: clear with distinguishable arm boundaries, clearly visible centromeres, uniform dispersion, no obvious structural aberrations (such as breakage, deletion, and translocation), and the ability to be independently presented., Ten metaphase spreads were observed in each sample, resulting in 100 metaphase spreads recorded for each fish species.

2.4. Analysis of Morphological Traits

At the age of 24 months, 30 fish each from BSB, TC, BTBTF₁, and BTBTF₂ were selected for morphological trait examination. The full-length-to-body length (FL/BL), body length-to-body height (BL/BH), body length-to-head length (BL/HL), head length-to-head height (HL/HH), body height-to-head height (BH/HH), and caudal peduncle length-to-caudal peduncle height (CPL/CPH) ratios were measured and calculated. For countable traits, the number of scales in lateral, lower lateral, and upper lateral lines, and the number of rays in abdominal, dorsal, and anal fins were counted. The data were averaged and analyzed by analysis of variance and pairwise comparisons using the Statistical Package for the Social Sciences software (version 17.0; SPSS; Chicago, IL, USA).

2.5. DNA Extraction, Amplification, and Sequencing of ITS

Genomic DNA from the whole genome was extracted from 20 mg of prepared liver tissue. Liver tissues were obtained from three fish each of BSB, TC, BTBTF₁, and BTBTF₂. MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 (Takara, Beijing, China) was used for the extraction, following the manufacturer’s instructions. DNA quality was evaluated by agarose gel electrophoresis. Once DNA extraction yielded satisfactory results, the distinct differences in ITS region sequences of 45S rDNA between the original parental species BSB and TC were used to identify the specific genetic composition and variations in BTBTF₁ and BTBTF₂ generations. Degenerate primers designed by Xiao Jun [24] for the ITS1 region of BSB and TC were employed. The forward and reverse primers were 5′-AGTCGTAACAAGGTTTCCGTAG-3′, and 5′-ATC(A/G)ATGTGTCCTGCAATTCAC-3′, respectively. The total volume of the PCR reaction was 10 μL, consisting of 1 μL of DNA template, 3 μL of ultrapure water, 0.5 μL of reverse primer, 0.5 μL of forward primer, and 5 μL of LA PCR Master Mix (TaKaRa, Beijing, China). The PCR program was as follows: pre-denaturation at 94 °C for 5 min; 35 cycles of 95 °C for 30 s, 52.6 °C for 30 s, and 72 °C for 30 s; termination at 72 °C for 7 min; storage at 4 °C. Subsequently, agarose gel electrophoresis was performed for detection. The correct ITS target fragments of BSB, TC, BTBTF₁, and F₂ were recovered using a gel extraction kit (Sangon Biotech, Shanghai, China) for ligation. The ligation mixture employed the pMD18-T vector (TaKaRa, Beijing, China) and contained 2.5 μL of gel-extracted product, 2 μL of solution buffer, and 0.5 μL of pMD18-T vector. The ligation product was sent to Tsingke Biotechnology (Beijing, China) for sequencing, followed by sequence alignment analysis using BioEdit software v7.2.5.

2.6. MSAP Analysis

To investigate the inheritance and variation in cytosine methylation between BTBTF₁-F₂, BSB, and TC, MSAP analysis was performed as previously described [25]. A total of 500 ng of DNA extracted from each sample was subjected to double-restriction with EcoRI/MspI and EcoRI/HpaII. Digested DNA was ligated into adaptors (

Table 1. Adaptor and primer sequences used in MSAP.

Adaptor/Primer Name	Sequence (5′-3′)
EcoRI-adaptor 1	CTCGTAGACTGCGTACC
EcoRI-adaptor 2	AATTGGTACGCAGTCTAC
MspI/HpaII-adaptor 1	GACGATGAGTCTAGAA
MspI/HpaII-adaptor 2	CGTTCTAGACTCATC
EcoRI- preselective primer	GACTGCGTACCAATTCA
MspI/HpaII- preselective primer	GATGAGTCTAGAACGGT
EcoRI-selective primer 1	GACTGCGTACCAATTCAAT
EcoRI-selective primer 2	GACTGCGTACCAATTCAGA
EcoRI-selective primer 3	GACTGCGTACCAATTCAGC
EcoRI-selective primer 4	GACTGCGTACCAATTCAGT
EcoRI-selective primer 5	GACTGCGTACCAATTCACA
MspI/HpaII-selective primer 1	GATGAGTCTAGAACGGTAG
MspI/HpaII-selective primer 2	GATGAGTCTAGAACGGTAC
MspI/HpaII-selective primer 3	GATGAGTCTAGAACGGTAT
MspI/HpaII-selective primer 4	GATGAGTCTAGAACGGTGA
MSPI/HPAII-selective primer 5	GATGAGTCTAGAACGGTGC
MSPI/HPAII-selective primer 6	GATGAGTCTAGAACGGTGT
MSPI/HPAII-selective primer 7	GATGAGTCTAGAACGGTCA
MSPI/HPAII-selective primer 8	GATGAGTCTAGAACGGTCG

) using T4 DNA ligase. Subsequently, preselective and selective amplification reactions were performed using primers listed in Table 1. Denaturing polyacrylamide gels (8%) were used to isolate selective amplification products, which were visualized by silver staining. Clear bands were captured for statistical analysis.

MspI and HpaII are a pair of isoschizomers that digest CCGG sites; HpaII is sensitive to cytosine methylation, whereas MspI is not. Consequently, CCGG sites with different methylation statuses produce bands of different sizes after double digestion with EcoRI/MspI (abbreviated as M) and EcoRI/HpaII (abbreviated as H). Polyacrylamide electrophoresis produced four results corresponding to the methylation pattern. Type 1: nonmethylated (bands in M and H lanes); Type 2: fully methylated (bands in M lane but not in H lane); Type 3: hemimethylated (bands in H lane but not in M lane); Type 4: hypermethylated or lacking CCGG sites (no bands in either lane). Type 4 was excluded from analysis because the absence of CCGG sites may introduce errors in statistical interpretations.

2.7. Transcriptome Analysis

The transcriptome of liver tissue from three fish each of BSB, TC, BTBTF_1, and BTBTF₂ was isolated, as previously described [26], and sequenced to analyze homologous gene expression patterns in BTBTF₁-F₂. RNA quality was tested using an Agilent 2100 (Agilent Technologies, Santa Clara, CA, USA). Qualified RNA was sequenced using the second-generation sequencing platform (Illumina HiSeq 2500, Illumina Inc., SanDiego, CA, USA). Paired-end de novo was performed to obtain transcripts and unigenes. The CD-HIT software v4.8.1 (threshold = 95%) was used for clustering and de-redundancy to obtain a final set of unigenes. The clean readings of each sample were mapped to unigenes, and FPKM values of unigenes were calculated. The differentially expressed genes (DEGs) of BTBT₁ and BTBTF₂ were screened in the homologous gene set using DESeq2, with |Log2 (Fold change) | > 1 and FDR < 0.05. DEG expressions in BTBTF₁ and BTBTF₂ were analyzed and compared to those in BSB and TC. The expression patterns of DEGs were classified into five types based on the comparison results: upregulation, in which expression level in BTBTF₁-F₂ was higher than in BSB and TC; ELD-BSB, in which expression level in BTBTF₁-F₂ was biased towards BSB and was significantly different from TC; ELD-TC, in which expression level in BTBTF₁-F₂ was biased towards TC and was significantly different from BSB; downregulation, in which expression level in BTBTF₁-F₂ was lower than in BSB and TC; and additivity, in which expression level in BTBTF₁-F₂ was intermediate between BSB and TC. DEGs expressed in BTBTF₁-F₂ according to the above expression patterns were counted. To verify the homologous gene expression patterns, two representative genes were screened for each expression pattern using real-time quantitative fluorescence PCR (RT-PCR). Primers (

Table 2. Real-time fluorescence quantitative PCR primers.

Pattern Gene Primers	Primer Sequence (5′-3′)
vmo1-X1-F	GTGACGAATGGAATGGAGCAG
vmo1-X1-R	CCACCTTCAAACGAAACCCT
vmo1-F	ATGCGTCGCCTCCTTTCC
vmo1-R	TGTGCTCCACTCATCTGGTCTTAC
vti1a-F	CCTGGAGGTTCGTGAGATTC
vti1a-R	CTGTCCCACTTGCTCGGTTT
slc25a39-F	TTTCAGCCCTTTACTGGTTT
slc25a39-R	CTGGATTTGCCTGCGTGTT
cnot7-F	CCTCAGCATCAGGCAGGGTC
cnot7-R	CGCAATACTTGGCATCATCG
tmem243b-F	TCTTCCCTTCACTGCCTCCC
tmem243b-R	TCGCCCTGCCTATACCAAAA
mau2-F	TTGCTGTTGATGGAGCGTAAG
mau2-R	TGGGAAGCCAGTGGAAGAGG
rorca-F	CTGGATGACATAACCACGCTACC
rorca-R	GGAGAACTTTGGGAGGACGAA
znf462-F	ACAACGGGATTGAAGGGTCAG
znf462-R	TACGGACGAGGTCGGCATT
mfsd8-F	GAGTCCATCCTCGTCTTCCTG
mfsd8-R	GAATGTCTGCCCACTGTATTGTAG

) were designed via Primer Premier 5 software.

3. Results

3.1. Hybrid Lineage Establishment

In the present study, the BTBTF₁-F₂ lineage was successfully prepared by self-mating of bisexual fertile BTBTF₁ individuals.

3.2. DNA Content and Chromosome Number

Based on establishing the new hybrid Culter lineage, the mean DNA content was measured using a flow cytometer, and the results are illustrated in Figure 2 and

Table 3. Mean DNA contents of BSB, TC and BTBTF₁-F₂.

Fish Type	Mean DNA Content	Observed	Expected
BSB	45.98
TC	46.28
BTBTF1	48.05	BTBTF1/BSB = 1.05 a	1
		BTBTF1/TC = 1.04 a	1
BTBTF2	47.23	BTBTF2/BSB = 1.03 a	1
		BTBTF2/TC = 1.02 a	1
		BTBTF2/BTBTF1 = 0.98 a	1

^a: no significant difference between the observed and expected values (p > 0.05).

. The mean relative fluorescence intensities of BSB, TC, BTBTF_1, and BTBTF₂ were 45.98, 46.28, 48.05, and 47.23, respectively. The ratios of BTBTF₁/BSB, BTBTF₁/TC, BTBTF₂/BSB, BTBTF₂/TC, and BTBTF₂/BTBTF₁ were 1.05, 1.04, 1.03, 1.02, and 0.98, respectively. Comparative analysis revealed no significant differences in the DNA content of BSB, TC, BTBTF_1, and BTBTF₂ (p > 0.05), indicating that their DNA contents were comparable. Chromosomal distributions are demonstrated in Figure 3 and

Table 4. Examination of chromosome number of BSB, TC and BTBTF₁-F₂.

Fish Type	Distribution of Chromosome Number			Proportion of Phases with 48 Chromosomes
	<48	48	>48
BSB	6	90	4	90%
TC	8	87	5	87%
BTBTF1	6	92	2	92%
BTBTF2	11	88	1	88%

. In total, 100 micrographs of mitotic metaphase chromosomes exhibited that 90% of BSB and 87% of TC had 48 chromosomes, and that the percentages of chromosomes of BTBTF₁-F₂ blood cells in mitotic metaphase were 92% and 88%, respectively. Those results showed that BTBTF₁-F₂ was examined as a diploid lineage with 48 chromosomes.

3.3. Morphological Traits

The specific data for measurable and countable BTBTF₁ and BTBTF₂ traits are presented in

Table 5. The measurable traits of BSB, TC and BTBTF₁-F₂.

	Fish Type	FL/BL	BL/BH	BL/HL	HL/HH	BH/HH	CPL/CPH
Mean ± Standard Deviation	BSB	1.17 ± 0.03	2.36 ± 0.04	4.52 ± 0.21	1.21 ± 0.12	2.10 ± 0.21	1.07 ± 0.10
	TC	1.16 ± 0.02	4.02 ± 0.23	5.11 ± 0.25	2.05 ± 0.25	2.37 ± 0.12	1.24 ± 0.12
	BTBTF1	1.18 ± 0.03	3.80 ± 0.15	4.48 ± 0.19	1.80 ± 0.11	2.11 ± 0.06	1.13 ± 0.05
	BTBTF2	1.18 ± 0.02	3.71 ± 0.11	4.58 ± 0.21	1.81 ± 0.24	2.16 ± 0.08	1.15 ± 0.07
p value	BSB vs. TC	>0.05	<0.01	<0.01	<0.01	<0.01	<0.01
	BSB vs. BTBTF1	>0.05	<0.01	>0.05	<0.01	>0.05	0.02
	BSB vs. BTBTF2	0.03	<0.01	>0.05	<0.01	>0.05	<0.01
	TC vs. BTBTF1	>0.05	<0.01	<0.01	<0.01	<0.01	<0.01
	TC vs. BTBTF2	<0.01	<0.01	<0.01	<0.01	<0.01	<0.01
	BTBTF1 vs. BTBTF2	>0.05	0.02	>0.05	>0.05	0.02	>0.05

and

Table 6. The countable traits of BSB, TC and BTBTF₁-F₂.

	Fish Type	Lateral Scales	Upper Lateral Scales	Lower Lateral Scales	Dorsal Fin rays	Abdominal Fin Rays	Anal Fin Rays
Range of countable traits	BSB	49–53	9–11	9–12	III + 8–9	8–10	III + 24–27
	TC	82–91	16–18	6–7	III + 7	9	III + 21–23
	BTBTF1	66–71	12–15	9–11	III + 8–9	9	III + 23–26
	BTBTF2	64–68	14–16	10–11	III + 8–9	9	III + 23–25
p value	BSB vs. TC	<0.01	<0.01	<0.01	<0.01	>0.05	<0.01
	BSB vs. BTBTF1	<0.01	<0.01	<0.01	>0.05	>0.05	>0.05
	BSB vs. BTBTF2	<0.01	<0.01	>0.05	>0.05	>0.05	<0.01
	TC vs. BTBTF1	<0.01	<0.01	<0.01	<0.01	>0.05	<0.01
	TC vs. BTBTF2	<0.01	<0.01	<0.01	<0.01	>0.05	<0.01
	BTBTF1 vs. BTBTF2	<0.01	<0.01	<0.01	>0.05	>0.05	>0.05

, respectively. Except for BL/BH and BH/HH, all measurable traits of BTBTF₂ were not significantly different from those of BTBTF₁ (p > 0.05). BL/BH, HL/HH, BH/HH, and CPL/CPH ratios of BTBTF₁ and BTBTF₂ were between those of BSB and TC. Additionally, BTBTF₁ and BTBTF₂ were more inclined towards BSB in some measurable traits, such as BL/HL and BH/HH ratios, and showed a significant difference (p < 0.01) compared to TC. All countable traits of BTBTF₁ and BTBTF₂ were intermediate between those of BSB and TC, and the numbers of dorsal, abdominal, and anal fin rays of BTBTF₂ were not significantly different (p > 0.05) from those of BTBTF₁. Additionally, BTBTF₁ and BTBTF₂ were more inclined towards BSB in dorsal fin rays, and showed a significant difference (p < 0.01) compared to TC.

3.4. ITS Sequence Sequencing Results and Analysis

ITS1 sequences of BTBTF₁, BTBTF₂, and their parents (BSB and TC) were amplified and sequenced using designed primers, with sequences analyzed via BioEdit software v7.2.5. Key results are presented in Figure 4. Partial 18S rDNA (45 bp) and 5.8S rDNA (89 bp) sequences of BTBTF₁ and F₂ were consistent with those of BSB and TC. Meanwhile, parental ITS1 sequences differed significantly: BSB exhibited a 322 bp ITS1 sequence, but TC displayed a 366 bp ITS1 sequence. Two parental-derived ITS1 types were identified in both BTBTF₁ and F₂—designated as BTBTF₁-B/T and BTBTF₂-B/T, respectively—with one exhibiting high similarity (≥99%) to the maternal “BSB-type” ITS1 and the other demonstrating high similarity (≥98.5%) to the paternal “TC-type” ITS1. Additionally, ITS1 sequences of BTBTF₁ and F₂ were highly conserved, exhibiting no more than three site-specific differences. This result confirmed that BTBTF₁ and F₂ were allodiploids with heterozygous genomes that had inherited genetic material from both parents simultaneously and exhibited stable inheritance.

3.5. MSAP Analysis

A total of 7538 bands were obtained after MSAP selective amplification. The results are presented in

Table 7. Methylation degree of BSB, TC, BTBTF₁-F₂.

Fish Type	Type 1	Type 2	Type 3	Total	Percent of Type 1 (%)	Percent of Type 2 (%)	Percent of Type 3 (%)
BSB	532	439	178	1149	46.30	38.21	15.49
TC	676	383	238	1297	52.12	29.53	18.35
BTBTF1	1358	612	642	2612	51.99	23.43	24.58
BTBTF2	1354	547	579	2480	54.60	22.06	23.34

. In the BSB genome, 53.70% of CCGG sites were methylated, including 38.21% fully methylated and 15.49% hemimethylated. In the TC genome, 47.88% of CCGG sites were methylated, including 29.53% fully methylated and 18.35% hemimethylated. In BTBTF₁, 48.01% of CCGG sites were methylated, including 23.43% fully methylated and 24.58% hemimethylated. In BTBTF₂, 45.40% of CCGG sites were methylated, including 22.06% fully methylated and 23.34% hemimethylated. The genomic methylation levels of BTBTF₁ and BTBTF₂ were similar and lower than those of BSB and TC, where the percentage of fully methylated levels was lower than that of the original parents, but the hemimethylation was higher than that of the original parents.

To further study the inheritance and variation in methylation at the CCGG sites of BTBTF₁ and BTBTF₂, BTBTF₁ and BTBTF₂ bands were compared with those of BSB and TC, respectively. The bands were divided into four classes (A, B, C, and D), and each class was further divided into three subclasses (A1–A3, B1–B3, C1–C3, and D1–D3). The data are presented in

Table 8. Genetic and variation status of methylation in BTBTF₁ and BTBTF₂.

Fish Type	Class	Subclass	Total Number in Class	Total Number in Subclass	Percent of Class (%)	Percent of Subclass (%)
BTBTF1	A	A1	740	287	37.13	14.40
		A2		141		7.07
		A3		312		15.66
	B	B1	258	113	12.94	5.67
		B2		48		2.40
		B3		97		4.87
	C	C1	607	297	30.46	14.92
		C2		156		7.82
		C3		154		7.72
	D	D1	388	121	19.47	6.07
		D2		151		7.58
		D3		116		5.82
BTBTF2	A	A1	700	272	38.83	15.09
		A2		120		6.66
		A3		308		17.08
	B	B1	222	102	12.31	5.66
		B2		39		2.16
		B3		81		4.49
	C	C1	480	196	26.62	10.87
		C2		149		8.26
		C3		135		7.49
	D	D1	401	129	22.24	7.15
		D2		119		6.60
		D3		153		8.49

. The bands in class A were the same for BSB and TC, indicating that the methylation sites were inherited. Bands in class B were the same as BSB but not with TC, indicating that the methylation sites were inherited from BSB only. Bands in class C were the same as those in TC but not with BSB, indicating that the methylation sites were inherited from TC only. Bands in class D were inconsistent with BSB and TC, suggesting genomic methylation variation. In BTBTF₁-F₂, the percentage of class A was the highest at 37.13% and 38.83%, respectively. In BTBTF₁-F₂, the percentage of class C (30.46% and 26.62%) was significantly higher than that of class B (12.94% and 12.31%) (p < 0.05), exhibiting bias towards TC. Class D bands were found in BTBTF₁ and BTBTF₂, accounting for 19.47% and 22.24%, respectively. These results showed that BTBTF₁-F₂ inherited genomes from BSB and TC and produced mutated genes simultaneously.

3.6. Transcriptome Analysis

Clean data of 81.36 Gb were obtained by performing next-generation transcriptome sequencing on each of the three fish of BSB, TC, BTBTF_1, and BTBTF₂. The effective data for each sample ranged from 5.85 to 7.06 Gb. The mean GC content was 46.74%. A total of 52,874 unigenes were obtained, with a total length of 62,335,273 bp and an average length of 1178.94 bp.

Differentially expressed genes (DEGs) were identified using DESeq2, considering the expression levels of each sample. The screening criteria were set as follows: false discovery rate (FDR) < 0.05 and |log₂ (fold change) | > 1. A total of 7877 DEGs were obtained. The statistics of expression patterns of DEGs in BSB, TC, BTBTF_1, and BTBTF₂ are demonstrated in Figure 5. In BTBTF₁ and BTBTF₂, 8.99% and 9.53% of DEGs were upregulated; 9.05% and 8.30% were expressed in ELD-BSB; 17.01% and 18.95% were expressed in ELD-TC; 41.58% and 45.54% were expressed in additivity; and 23.38% and 16.67% were downregulated, respectively. The results exhibited that DEG expression was similar in BTBTF₁ and BTBTF₂. Moreover, in BTBTF₁-F_2, the expression pattern of homologous genes in BTBTF₁ and BTBTF₂ was mainly based on additive expression and was more biased towards TC than towards BSB (p < 0.05). The five expression patterns were verified using qRT-PCR, and the results are illustrated in Figure 6. The verification results were consistent with the transcriptome analysis.

4. Discussion

Distant hybridization makes it possible to transfer the genome of one species to another, resulting in phenotypic and genotypic changes in progeny [27], which is widely used to produce offspring with heterosis [28] and form lineages [29]. The feasibility of hybridization makes it a widely used practice in fish genetics and breeding [8]. BTBTF₁ was obtained by crossing and back-crossing of BSB and TC, displaying a TC-biased appearance. Although BSB and TC belong to different genera, these hybrid offspring were fertile, and BTBTF₂ was obtained via self-crossing of BTBTF₁, providing new germplasm resources for breeding of Culter. DNA content analysis, chromosome preparation, and morphological traits revealed that BTBTF₁-F₂ was diploid with 48 chromosomes and presented a hybrid appearance compared with the original parents.

The internal transcribed spacer (ITS) region of 45S rDNA functions as a molecular marker for hybrid genetic identification, owing to its moderate evolutionary rate, pronounced interspecific divergence, and exceptional environmental conservation [30]. ITS1 sequencing of BTBT allohybridized progenies (F₁-F₂) demonstrated retention of dual parental ITS1 haplotypes: one exhibiting elevated sequence homology (≥99%) to the maternal BSB-type, and the other to the paternal TC-type (≥98.5%). This bimodal inheritance pattern unequivocally substantiates BTBT’s allohybrid genomic architecture—paralleling Schumer et al.’s observations in swordtail hybrids and corroborating analytical precision [31]. Remarkably, ITS1 sequences across F₁ and F₂ generations manifested profound sequence conservation, with ≤3 site-specific polymorphisms—well within established parameters of intraspecific genomic variation [32]. Crucially, F₂ progenies exhibited an absence of parental genomic bias. These findings collectively affirm the generational conservation of ITS genomic architecture in BTBT, establishing its status as a stably inherited allodiploid lineage [21]. Thus, ITS1 profiling not only validates BTBT’s allodiploid constitution but also provides a new insight underlying genetic stabilization in distant hybridization, thereby furnishing molecular substantiation for elite strain aquacultural propagation.

DNA methylation plays a critical role in regulating gene expression, developing X-chromosome inactivation, genetic imprinting, and the repression of transposable elements [33]. Previous studies have indicated that it may be associated with gene expression and phenotypic variation in fish [25]. In this study, MSAP results exhibited that BTBTF₁-F₂ inherited methylation sites from BSB and TC, consistent with the findings of ITS analysis, further indicating that BTBTF₁-F₂ is a hybrid lineage with a hybrid genome. Conversely, the genomic methylation level of BTBTF₁-F₂ was lower than that of its original parents, consistent with a related study [34] and international reports on hybrid fish epigenetics [18]. Further research is needed to determine whether BTBTF₁-F₂ exhibits more hybrid vigor than BSB and TC, or if this vigor correlates with reduced genomic methylation levels.

Cytoplasmic inheritance frequently engenders a pronounced bias in genetic expression within hybrid offspring, preferentially favoring the maternal lineage [35]. For example, a marked preference for maternal transcripts was observed in the placenta of mid-gestation F₁ hybrid mice derived from a cross between Mus musculus (♀) × Rattus norvegicus (♂) [36]. However, DEG expression in BTBTF₁-F₂ was biased towards that of the original male parent (TC) in this study. These findings demonstrated that bias in homologous gene expression within hybrid progeny does not stem exclusively from cytoplasmic inheritance, but may be significantly modulated by genomic elements, particularly paternal DNA, thereby inducing a preference for paternal expression.

5. Conclusions

In sum, we established a hybrid culter lineage from Megalobrama amblycephala (♀) and Culter alburnus (♂), evacuated the biological characteristics regarding the DNA content, chromosome number, morphological traits, ITS1, MSAP, and transcriptomic analyses. And the results of BTBTF₂ were consistent with those of BTBTF₁, indicating that BTBTF₁-F₂ exhibited stable genetic traits. The successful preparation of BTBTF₁-F₂ demonstrated the fertility of this type of hybrid fish, providing a novel fish resource for genetic and breeding research in Culter.