Effects of High Concentrations of Flumequine on CYP Gene Expression and Histopathology in Olive Flounder, Paralichthys olivaceus
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals and Drug
2.2. Expression Analysis of Drug Metabolism-Related Genes by Real-Time PCR
2.3. Histopathological Analysis
3. Results
3.1. Gene Expression Analysis
3.2. Histopathological Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Son, K.T.; Jo, M.R.; Oh, E.G.; Mok, J.S.; Kwon, J.Y.; Lee, T.S.; Song, K.C.; Kim, P.H.; Lee, H.J. Residues of ampicillin and amoxicillin in Olive Flounder Paralichthys olivaceus following oral administration. Korean J. Fish. Aquat. Sci. 2011, 44, 464–469. [Google Scholar] [CrossRef] [Scilit]
- Pecorelli, I.; Galarini, R.; Bibi, R.; Floridi, A.; Casciarri, E.; Floridi, A. Simultaneous determination of 13 quinolones from feeds using accelerated solvent extraction and liquid chromatography. Anal. Chim. Acta 2003, 483, 81–89. [Google Scholar] [CrossRef] [Scilit]
- Ali, I.; Sekkoum, K.; Belboukhari, N.; Rebizi, M.N.; Zaid, M.E.A.; Yusuf, K.; Alothman, A.A.; AlJumah, B.A.; Ouladsmane, M. Determination of enantio-separation, absolute configuration and chiral recognition mechanism of ofloxacin and flumequine by HPLC and modeling studies. J. Chem. Technol. Biotechnol. 2021, 96, 2901–2908. [Google Scholar] [CrossRef] [Scilit]
- Baati, T.; Brahim, M.B.; Salek, A.; Selmi, M.; Njim, L.; Umek, P.; Aouane, A.; Hammami, M.; Hosni, K. Flumequine-loaded titanate nanotubes as antibacterial agents for aquaculture farms. RSC Adv. 2022, 12, 5953–5963. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rajakumari, K.; Aravind, K.; Balamugundhan, M.; Jagadeesan, M.; Somasundaram, A.; Devi, P.B.; Ramasamy, P. Comprehensive review of DNA gyrase as enzymatic target for drug discovery and development. Eur. J. Med. Chem. Rep. 2024, 12, 100233. [Google Scholar] [CrossRef] [Scilit]
- David, S.; Hamilton, J.P. Drug-induced liver injury. US Gastroenterol. Hepatol. Rev. 2010, 6, 73. [Google Scholar] [PubMed]
- Cakan-Akdogan, G.; Aftab, A.M.; Cinar, M.C.; Abdelhalim, K.A.; Konu, O. Zebrafish as a model for drug induced liver injury: State of the art and beyond. Explor. Dig. Dis. 2023, 2, 44–55. [Google Scholar] [CrossRef] [Scilit]
- Long, S.; Dong, X.; Liu, H.; Yan, X.; Tan, B.; Zhang, S.; Chi, S.; Yang, Q.; Liu, H.; Yang, Y.; et al. Effect of dietary oxidized fish oil on liver function in hybrid grouper (♀ Epinephelus fuscoguttatus × ♂ Epinephelus lanceolatus). Aquac. Rep. 2022, 22, 101000. [Google Scholar] [CrossRef] [Scilit]
- Zhao, M.; Ma, J.; Li, M.; Zhang, Y.; Jiang, B.; Zhao, X.; Huai, C.; Shen, L.; Zhang, N.; He, L.; et al. Cytochrome P450 enzymes and drug metabolism in humans. Int. J. Mol. Sci. 2021, 22, 12808. [Google Scholar] [CrossRef] [Scilit]
- Bardhan, A.; Abraham, T.J.; Das, R.; Patil, P.K. Unraveling florfenicol’s effects on splenic histology, erythrocytes, and hematology of healthy Oreochromis niloticus juveniles. Appl. Res. 2024, 3, e202400017. [Google Scholar] [CrossRef] [Scilit]
- Limbu, S.M.; Ma, Q.; Zhang, M.L.; Du, Z.Y. High fat diet worsens the adverse effects of antibiotic on intestinal health in juvenile Nile tilapia (Oreochromis niloticus). Sci. Total Environ. 2019, 680, 169–180. [Google Scholar] [CrossRef] [Scilit]
- Rodrigues, S.; Antunes, S.C.; Nunes, B.; Correia, A.T. Histological alterations in gills and liver of rainbow trout (Oncorhynchus mykiss) after exposure to the antibiotic oxytetracycline. Environ. Toxicol. Pharmacol. 2017, 53, 164–176. [Google Scholar] [CrossRef] [Scilit]
- Seong, M.J.; Park, Y.J. Short and long-term immune effects of Poly (I: C) in kidney of Olive flounder (Paralichthys olivaceus). J. Fish Pathol. 2024, 37, 123–132. [Google Scholar]
- Bailey, C.; von Siebenthal, E.W.; Rehberger, K.; Segner, H. Transcriptomic analysis of the impacts of ethinylestradiol (EE2) and its consequences for proliferative kidney disease outcome in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2019, 222, 31–48. [Google Scholar] [CrossRef] [Scilit]
- Reddy, J.K.; Rao, M.S. Lipid metabolism and liver inflammation. II. Fatty liver disease and fatty acid oxidation. Am. J. Physiol.-Gastrointest. Liver Physiol. 2006, 290, G852–G858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dorrington, T.; Zanette, J.; Zacchi, F.L.; Stegeman, J.J.; Bainy, A.C. Basal and 3-methylcholanthrene-induced expression of cytochrome P450 1A, 1B and 1C genes in the Brazilian guppy, Poecilia vivipara. Aquat. Toxicol. 2012, 124, 106–113. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; He, B.; Ge, C.; Yu, D. Transcriptomics-based systematic identification and tissue-specific distribution of cytochrome P450 genes in Carassius auratus. Aquac. Res. 2022, 53, 4567–4576. [Google Scholar] [CrossRef] [Scilit]
- Saad, M.; Cavanaugh, K.; Verbueken, E.; Pype, C.; Casteleyn, C.; Van Ginneken, C.; Van Cruchten, S. Xenobiotic metabolism in the zebrafish: A review of the spatiotemporal distribution, modulation and activity of Cytochrome P450 families 1 to 3. J. Toxicol. Sci. 2016, 41, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Uno, T.; Ishizuka, M.; Itakura, T. Cytochrome P450 (CYP) in fish. Environ. Toxicol. Pharmacol. 2012, 34, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Baer, B.R.; Rettie, A.E. CYP4B1: An enigmatic P450 at the interface between xenobiotic and endobiotic metabolism. Drug Metab. Rev. 2006, 38, 451–476. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cortés-Miranda, J.; Rojas-Hernández, N.; Muñoz, G.; Copaja, S.; Quezada-Romegialli, C.; Veliz, D.; Vega-Retter, C. Biomarker selection depends on gene function and organ: The case of the cytochrome P450 family genes in freshwater fish exposed to chronic pollution. PeerJ 2024, 12, e16925. [Google Scholar] [CrossRef] [Scilit]
- Serras, A.S.; Rodrigues, J.S.; Cipriano, M.; Rodrigues, A.V.; Oliveira, N.G.; Miranda, J.P. A critical perspective on 3D liver models for drug metabolism and toxicology studies. Front. Cell Dev. Biol. 2021, 9, 626805. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vliegenthart, A.B.; Tucker, C.S.; Del Pozo, J.; Dear, J.W. Zebrafish as model organisms for studying drug-induced liver injury. Br. J. Clin. Pharmacol. 2014, 78, 1217–1227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burkina, V.; Zlabek, V.; Zamaratskaia, G. Effects of pharmaceuticals present in aquatic environment on Phase I metabolism in fish. Environ. Toxicol. Pharmacol. 2015, 40, 430–444. [Google Scholar] [CrossRef] [Scilit]
- Rodrigues, S.; Antunes, S.C.; Nunes, B.; Correia, A.T. Histopathological effects in gills and liver of Sparus aurata following acute and chronic exposures to erythromycin and oxytetracycline. Environ. Sci. Pollut. Res. 2019, 26, 15481–15495. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoshida, M.; Miyajima, K.; Shiraki, K.; Ando, J.; Kudoh, K.; Nakae, D.; Takahashi, M.; Maekawa, A. Hepatotoxicity and consequently increased cell proliferation are associated with flumequine hepatocarcinogenesis in mice. Cancer Lett. 1999, 141, 99–107. [Google Scholar] [CrossRef] [Scilit]
- Khasawneh, A.F.; Al-Hadidi, K.A.; Aburjai, T.A.; Obeidat, F.N. Acute and subacute (20-d) oral dose toxicity study of modified fluoroquinolone compound 6C in BALB/c mice. Toxin Rev. 2015, 34, 129–135. [Google Scholar] [CrossRef] [Scilit]


| Genes | Primer | Sequences (5′-3′) |
|---|---|---|
| β-actin | forward | GAGATGAAGCCCAGAGCAAGAG |
| reverse | CAGCTGTGGTGGTGAAGGAGTAG | |
| CYP1A1 | forward | GATGAGGAGCTGTGGAAAGA |
| reverse | AGACTTCATTTCGAGCGATG | |
| CYP1B1 | forward | ATGCAGCTGTTCCTTTTCAC |
| reverse | TTTGACCTCCTCTGCACTTC | |
| CYP2B4 | forward | CACACATACAAGAGCGTTGC |
| reverse | CCCATGAGCTCTGTGTCTTT | |
| CYP2F2 | forward | AAGCCTTCATGCCTTTCTCT |
| reverse | GGTTTAGGGGTCTGAGTCGT | |
| CYP4B1 | forward | TGCCTGAAGGTTCTCTTGTC |
| reverse | GTCTGACCGATGCAGTTTCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, G.B.; Na, H.J.; Jeong, J.-M.; Kwon, M.-G.; Hwang, S.D.; Seo, J.S. Effects of High Concentrations of Flumequine on CYP Gene Expression and Histopathology in Olive Flounder, Paralichthys olivaceus. Animals 2025, 15, 3125. https://doi.org/10.3390/ani15213125
Lee GB, Na HJ, Jeong J-M, Kwon M-G, Hwang SD, Seo JS. Effects of High Concentrations of Flumequine on CYP Gene Expression and Histopathology in Olive Flounder, Paralichthys olivaceus. Animals. 2025; 15(21):3125. https://doi.org/10.3390/ani15213125
Chicago/Turabian StyleLee, Gi Baeg, Hyeon Ju Na, Ji-Min Jeong, Mun-Gyeong Kwon, Seong Don Hwang, and Jung Soo Seo. 2025. "Effects of High Concentrations of Flumequine on CYP Gene Expression and Histopathology in Olive Flounder, Paralichthys olivaceus" Animals 15, no. 21: 3125. https://doi.org/10.3390/ani15213125
APA StyleLee, G. B., Na, H. J., Jeong, J.-M., Kwon, M.-G., Hwang, S. D., & Seo, J. S. (2025). Effects of High Concentrations of Flumequine on CYP Gene Expression and Histopathology in Olive Flounder, Paralichthys olivaceus. Animals, 15(21), 3125. https://doi.org/10.3390/ani15213125

