Effects of Bile Acids on Growth Performance, Hepatopancreatic Antioxidant Capacity, Intestinal Immune-Related Gene Expression, and Gut Microbiota of Penaeus vannamei
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Materials and Shrimp
2.2. Experimental Design and Feeding Management
2.3. Measurement of Growth Parameters and Sample Acquisition
2.4. Measurement of Digestive Enzyme Activity in the Gut and Antioxidant Enzyme Activity in the Hepatopancreas
2.5. Real-Time Quantitative PCR (qRT-PCR) Detection
2.6. Analysis of Differential Microorganisms in the Gut
2.7. Data Statistics and Analysis
3. Results
3.1. The Effect of Adding BA to Feed on the Growth Performance of P. vannamei
3.2. The Effect of Adding BA to Feed on the Activity of Digestive Enzymes in the Gut Tract of P. vannamei
3.3. The Effect of BA Added to Feed on Hepatopancreatic Antioxidant Enzyme Activity Capacity of P. vannamei
3.4. The Effect of Adding BA to Feed on the Expression of Gut Immunity-Related Genes in P. vannamei
3.5. The Effects of Adding BA to Feeds on Gut Microorganisms of P. vannamei
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhang, M.; Pan, L.; Huang, F.; Gao, S.; Su, C.; Zhang, M.; He, Z. Metagenomic analysis of composition, function and cycling processes of microbial community in water, sediment and effluent of Litopenaeus vannamei farming environments under different culture modes. Aquaculture 2019, 56, 280–293. [Google Scholar] [CrossRef]
- FAO. The State of World Fisheries and Aquaculture 2018: Meeting the Sustainable Development Goals; United Nations: Rome, Italy, 2018. [Google Scholar]
- Hoseinifar, S.H.; Ringø, E.; Shenavar Masouleh, A.; Esteban, M.Á. Probiotic, prebiotic and synbiotic supplements in sturgeon aquaculture: A review. Rev. Aquac. 2016, 8, 89–102. [Google Scholar] [CrossRef]
- Zhou, L.; Li, H.; Qin, J.G.; Wang, X.; Chen, L.; Xu, C.; Li, E. Dietary prebiotic inulin benefits on growth performance, antioxidant capacity, immune response and intestinal microbiota in Pacific white shrimp (Litopenaeus vannamei) at low salinity. Aquaculture 2020, 518, 734847. [Google Scholar] [CrossRef]
- Bu, X.; Lin, Z.; Liu, S.; Wang, C.; Wang, N.; Lei, Y.; Zhu, J.; Wang, X.; Qin, J.G.; Chen, L. Effects of myo-inositol on growth performance, body composition, antioxidant status, non-specific immunity and lipid metabolism of juvenile Chinese mitten crab (Eriocheir sinensis). Aquac. Nutr. 2020, 26, 1623–1635. [Google Scholar] [CrossRef]
- Lefebvre, K.A.; Noren, D.P.; Schultz, I.R.; Bogard, S.M.; Wilson, J.; Eberhart, B.T.L. Uptake, tissue distribution and excretion of domoic acid after oral exposure in coho salmon (Oncorhynchus kisutch). Aquat. Toxicol. 2007, 81, 266–274. [Google Scholar] [CrossRef] [PubMed]
- Di Ciaula, A.; Garruti, G.; Lunardi Baccetto, R.; Molina-Molina, E.; Bonfrate, L.; Wang, D.Q.H.; Portincasa, P. Bile Acid Physiology. Ann. Hepatol. 2017, 16, S4–S14. [Google Scholar] [CrossRef]
- Hu, M.M.; He, W.R.; Gao, P.; Yang, Q.; He, K.; Cao, L.B.; Li, S.; Feng, Y.Q.; Shu, H.B. Virus-induced accumulation of intracellular bile acids activates the TGR5-β-arrestin-SRC axis to enable innate antiviral immunity. Cell Res. 2019, 29, 193–205. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.Y.; Liu, M.; Portincasa, P.; Wang, D.Q.H. New insights into the molecular mechanism of intestinal fatty acid absorption. Eur. J. Clin. Investig. 2013, 43, 1203–1223. [Google Scholar] [CrossRef] [PubMed]
- Hofmann, A.F. The continuing importance of bile acids in liver and intestinal disease. Arch. Intern. Med. 1999, 159, 2647–2658. [Google Scholar] [CrossRef]
- Portincasa, P.; Di Ciaula, A.; Wang, H.H.; Palasciano, G.; van Erpecum, K.J.; Moschetta, A.; Wang, D.Q.H. Coordinate regulation of gallbladder motor function in the gut-liver axis. Hepatology 2008, 47, 2112–2126. [Google Scholar] [CrossRef]
- Gong, Z.; Zhou, J.; Zhao, S.; Tian, C.; Wang, P.; Xu, C.; Chen, Y.; Cai, W.; Wu, J. Chenodeoxycholic acid activates NLRP3 inflammasome and contributes to cholestatic liver fibrosis. Oncotarget 2016, 7, 83951–83963. [Google Scholar] [CrossRef] [PubMed]
- Tremblay, S.; Romain, G.; Roux, M.; Chen, X.L.; Brown, K.; Gibson, D.L.; Ramanathan, S.; Menendez, A. Bile Acid Administration Elicits an Intestinal Antimicrobial Program and Reduces the Bacterial Burden in Two Mouse Models of Enteric Infection. Infect. Immun. 2017, 85, e00942-16. [Google Scholar] [CrossRef] [PubMed]
- Guo, C.; Xie, S.; Chi, Z.; Zhang, J.; Liu, Y.; Zhang, L.; Zheng, M.; Zhang, X.; Xia, D.; Ke, Y.; et al. Bile Acids Control Inflammation and Metabolic Disorder through Inhibition of NLRP3 Inflammasome. Immunity 2016, 45, 944. [Google Scholar] [CrossRef] [PubMed]
- Zhu, C.; Fuchs, C.D.; Halilbasic, E.; Trauner, M. Bile acids in regulation of inflammation and immunity: Friend or foe? Clin. Exp. Rheumatol. 2016, 34 (4 Suppl. S98), 25–31. [Google Scholar]
- Dossa, A.Y.; Escobar, O.; Golden, J.; Frey, M.R.; Ford, H.R.; Gayer, C.P. Bile acids regulate intestinal cell proliferation by modulating EGFR and FXR signaling. Am. J. Physiol. Gastrointest. Liver Physiol. 2015, 310, G81–G92. [Google Scholar] [CrossRef] [PubMed]
- Yokota, A.; Fukiya, S.; Islam, K.B.M.S.; Ooka, T.; Ogura, Y.; Hayashi, T.; Hagio, M.; Ishizuka, S. Is bile acid a determinant of the gut microbiota on a high-fat diet? Gut Microbes 2012, 3, 455–459. [Google Scholar] [CrossRef] [PubMed]
- De Fabiani, E.; Mitro, N.; Gilardi, F.; Galmozzi, A.; Caruso, D.; Crestani, M. When Food Meets Man: The Contribution of Epigenetics to Health. Nutrients 2010, 2, 551–571. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.Q.H.; Portincasa, P.; Tso, P. Transintestinal cholesterol excretion (TICE): A secondary, non-biliary pathway contributing to reverse cholesterol transport. Hepatology 2017, 66, 1337–1340. [Google Scholar] [CrossRef] [PubMed]
- Kumar, V.; Sinha, A.K.; Romano, N.; Allen, K.M.; Bowman, B.A.; Thompson, K.R.; Tidwell, J.H. Metabolism and Nutritive Role of Cholesterol in the Growth, Gonadal Development, and Reproduction of Crustaceans. Rev. Fish. Sci. Aquac. 2018, 26, 254–273. [Google Scholar] [CrossRef]
- Lester, R.; Carey, M.C.; Little, J.M.; Cooperatein, L.A.; Dowd, S.R. Crustacean intestinal detergent promotes sterol solubilization. Science 1975, 189, 1098–1100. [Google Scholar] [CrossRef] [PubMed]
- Alam, M.S.; Teshima, S.; Ishikawa, M.; Koshio, S. Effects of ursodeoxycholic acid on growth and digestive enzyme activities of Japanese flounder Paralichthys olivaceus (Temminck & Schlegel). Aquac. Res. 2001, 32 (Suppl. S1), 235–243. [Google Scholar]
- Ding, T.; Xu, N.; Liu, Y.; Du, J.; Xiang, X.; Xu, D.; Liu, Q.; Yin, Z.; Li, J.; Mai, K.; et al. Effect of dietary bile acid (BA) on the growth performance, body composition, antioxidant responses and expression of lipid metabolism-related genes of juvenile large yellow croaker (Larimichthys crocea) fed high-lipid diets. Aquaculture 2020, 518, 734768. [Google Scholar] [CrossRef]
- Guo, J.L.; Kuang, W.M.; Zhong, Y.F.; Zhou, Y.L.; Chen, Y.J.; Lin, S.M. Effects of supplemental dietary bile acids on growth, liver function and immunity of juvenile largemouth bass (Micropterus salmoides) fed high-starch diet. Fish Shellfish Immunol. 2020, 97, 602–607. [Google Scholar] [CrossRef] [PubMed]
- Jiang, M.; Wen, H.; Gou, G.W.; Liu, T.L.; Lu, X.; Deng, D.F. Preliminary study to evaluate the effects of dietary bile acids on growth performance and lipid metabolism of juvenile genetically improved farmed tilapia (Oreochromis niloticus) fed plant ingredient-based diets. Aquac. Nutr. 2018, 24, 1175–1183. [Google Scholar] [CrossRef]
- Liao, Z.; Sun, B.; Zhang, Q.; Jia, L.; Wei, Y.; Liang, M.; Xu, H. Dietary bile acids regulate the hepatic lipid homeostasis in tiger puffer fed normal or high-lipid diets. Aquaculture 2020, 519, 734935. [Google Scholar] [CrossRef]
- Zhou, J.S.; Chen, H.J.; Ji, H.; Shi, X.C.; Li, X.X.; Chen, L.Q.; Du, Z.Y.; Yu, H.B. Effect of dietary bile acids on growth, body composition, lipid metabolism and microbiota in grass carp (Ctenopharyngodon idella). Aquac. Nutr. 2017, 24, 802–813. [Google Scholar] [CrossRef]
- Lin, Y.H.; Cheng, W.; Huang, Y.S. Effects of bile acids supplementation in soybean meal-based diet on growth, cholesterol status, digestibility and moulting-related gene expression in white shrimp Litopenaeus vannamei. Aquac. Res. 2022, 53, 5375–5381. [Google Scholar] [CrossRef]
- Reschly, E.J.; Ai, N.; Ekins, S.; Welsh, W.J.; Hagey, L.R.; Hofmann, A.F.; Krasowski, M.D. Evolution of the bile salt nuclear receptor FXR in vertebrates. J. Lipid Res. 2008, 49, 1577–1587. [Google Scholar] [CrossRef] [PubMed]
- Ou, G.; Xie, R.; Huang, J.; Huang, J.; Wen, Z.; Li, Y.; Jiang, X.; Ma, Q.; Chen, G. Effects of Dietary Alpha-Lipoic Acid on Growth Performance, Serum Biochemical Indexes, Liver Antioxidant Capacity and Transcriptome of Juvenile Hybrid Grouper (Epinephelus fuscoguttatus♀ × Epinephelus polyphekadion♂). Animals 2023, 13, 887. [Google Scholar] [CrossRef] [PubMed]
- Zheng, X.; Huang, F.; Zhao, A.; Lei, S.; Zhang, Y.; Xie, G.; Chen, T.; Qu, C.; Rajani, C.; Dong, B.; et al. Bile acid is a significant host factor shaping the gut microbiome of diet-induced obese mice. BMC Biol. 2017, 15, 120. [Google Scholar] [CrossRef]
- Huang, F.; Zheng, X.; Ma, X.; Jiang, R.; Zhou, W.; Zhou, S.; Zhang, Y.; Lei, S.; Wang, S.; Kuang, J.; et al. Theabrownin from Pu-erh tea attenuates hypercholesterolemia via modulation of gut microbiota and bile acid metabolism. Nat. Commun. 2019, 10, 4971. [Google Scholar] [CrossRef] [PubMed]
- Sayin Sama, I.; Wahlström, A.; Felin, J.; Jäntti, S.; Marschall, H.U.; Bamberg, K.; Angelin, B.; Hyötyläinen, T.; Orešič, M.; Bäckhed, F. Gut microbiota regulates bile acid metabolism by reducing the levels of tauro-beta-muricholic acid, a naturally occurring FXR antagonist. Cell Metab. 2013, 17, 225–235. [Google Scholar] [CrossRef] [PubMed]
- Wahlström, A.; Sayin Sama, I.; Marschall, H.U.; Bäckhed, F. Intestinal Crosstalk between Bile Acids and Microbiota and Its Impact on Host Metabolism. Cell Metab. 2016, 24, 41–50. [Google Scholar] [CrossRef] [PubMed]
- Wei, H.C.; Xing, S.J.; Chen, P.; Wu, X.F.; Gu, X.; Luo, L.; Liang, X.F.; Xue, M. Plant protein diet-induced hypoimmunity by affecting the spiral valve intestinal microbiota and bile acid enterohepatic circulation in Amur sturgeon (Acipenser schrenckii). Fish Shellfish Immunol. 2020, 106, 421–430. [Google Scholar] [CrossRef] [PubMed]
- Maita, M.; Tachiki, H.; Kaibara, A.; Itawaki, R.; Ikeda, Y. Pharmacological Effect of Ursodeoxycholic Acid in Juvenile Eel. Nippon Suisan Gakkaishi 1996, 62, 129–130. [Google Scholar] [CrossRef]
- Mitsuyoshi, H.; Nakashima, T.; Sumida, Y.; Yoh, T.; Nakajima, Y.; Ishikawa, H.; Inaba, K.; Sakamoto, Y.; Okanoue, T.; Kashima, K. Ursodeoxycholic acid protects hepatocytes against oxidative injury via induction of antioxidants. Biochem. Biophys. Res. Commun. 1999, 263, 537–542. [Google Scholar] [CrossRef] [PubMed]
- Ljubuncic, P.; Tanne, Z.; Bomzon, A. Ursodeoxycholic acid suppresses extent of lipid peroxidation in diseased liver in experimental cholestatic liver disease. Dig. Dis. Sci. 2000, 45, 1921–1928. [Google Scholar] [CrossRef]
- Lesser, M.P. Oxidative stress in marine environments: Biochemistry and physiological ecology. Annu. Rev. Physiol. 2006, 68, 253–278. [Google Scholar] [CrossRef] [PubMed]
- Baskol, G.; Atmaca, H.; Tanriverdi, F.; Baskol, M.; Kocer, D.; Bayram, F. Oxidative stress and enzymatic antioxidant status in patients with hypothyroidism before and after treatment. Exp. Clin. Endocrinol. Diabetes 2007, 115, 522–526. [Google Scholar] [CrossRef] [PubMed]
- Yin, P.; Xie, S.; Zhuang, Z.; He, X.; Tang, X.; Tian, L.; Liu, Y.; Niu, J. Dietary supplementation of bile acid attenuate adverse effects of high-fat diet on growth performance, antioxidant ability, lipid accumulation and intestinal health in juvenile largemouth bass (Micropterus salmoides). Aquaculture 2021, 531, 734864. [Google Scholar] [CrossRef]
- Jin, M.; Pan, T.; Cheng, X.; Zhu, T.T.; Sun, P.; Zhou, F.; Ding, X.; Zhou, Q. Effects of supplemental dietary l-carnitine and bile acids on growth performance, antioxidant and immune ability, histopathological changes and inflammatory response in juvenile black seabream (Acanthopagrus schlegelii) fed high-fat diet. Aquaculture 2019, 504, 199–209. [Google Scholar] [CrossRef]
- Chen, P.; Wu, Z.; Cui, Z.; Liu, C.; Lei, K.; Tian, S.; Mai, K.; Zhang, W. Effects of dietary bile acids levels on growth performance, anti-oxidative capacity, immunity and intestinal microbiota of abalone Haliotis discus hannai. Fish Shellfish Immunol. 2023, 142, 109114. [Google Scholar] [CrossRef]
- Su, C.; Lu, Y.; Li, J.; Wang, Y.; Pan, L.; Zhang, M. Effects of bile acids on aflatoxin B1 bioaccumulation, detoxification system, and growth performance of Pacific white shrimp. Food Chem. 2022, 371, 131169. [Google Scholar] [CrossRef]
- Wang, P.H.; Huang, T.; Zhang, X.; He, J.G. Antiviral defense in shrimp: From innate immunity to viral infection. Antivir. Res. 2014, 108, 129–141. [Google Scholar] [CrossRef]
- Xie, S.; Zheng, L.; Wan, M.; Niu, J.; Liu, Y.; Tian, L. Effect of deoxynivalenol on growth performance, histological morphology, anti-oxidative ability and immune response of juvenile Pacific white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 2018, 82, 442–452. [Google Scholar] [CrossRef] [PubMed]
- Pasparakis, M. IKK/NF-kappaB signaling in intestinal epithelial cells controls immune homeostasis in the gut. Mucosal Immunol. 2008, 1 (Suppl. S1), S54–S57. [Google Scholar] [CrossRef]
- Ibrahim, H.R.; Matsuzaki, T.; Aoki, T. Genetic evidence that antibacterial activity of lysozyme is independent of its catalytic function. FEBS Lett. 2001, 506, 27–32. [Google Scholar] [CrossRef] [PubMed]
- Sharma, S.; Garg, I.; Ashraf, M.Z. TLR signalling and association of TLR polymorphism with cardiovascular diseases. Vascul. Pharmacol. 2016, 87, 30–37. [Google Scholar] [CrossRef] [PubMed]
- Thamizhvanan, S.; Nafeez Ahmed, A.; Vinoth Kumar, D.; Vimal, S.; Majeed, S.A.; Taju, G.; Hauton, C.; Sahul Hameed, A.S. Silencing of prophenoloxidase (proPO) gene in freshwater prawn, Macrobrachium rosenbergii, makes them susceptible to white spot syndrome virus (WSSV). J. Fish Dis. 2020, 44, 573–584. [Google Scholar] [CrossRef]
- Xia, R.; Zhang, Q.; Xia, D.; Hao, Q.; Ding, Q.; Ran, C.; Yang, Y.; Cao, A.; Zhang, Z.; Zhou, Z. The direct and gut microbiota-mediated effects of dietary bile acids on the improvement of gut barriers in largemouth bass (Micropterus salmoides). Anim Nutr. 2023, 14, 32–42. [Google Scholar] [CrossRef]
- Deng, J.; Kang, B.; Tao, L.; Rong, H.; Zhang, X. Effects of dietary cholesterol on antioxidant capacity, non-specific immune response, and resistance to Aeromonas hydrophila in rainbow trout (Oncorhynchus mykiss) fed soybean meal-based diets. Fish Shellfish Immunol. 2012, 34, 324–331. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Bian, G.; Zhu, W. Interactions between the monogastric animal gut microbiota and the intestinal immune function—A review. Wei Sheng Wu Xue Bao 2014, 54, 480–486. [Google Scholar] [PubMed]
- Lee, W.J.; Hase, K. Gut microbiota–generated metabolites in animal health and disease. Nat. Chem. Biol. 2014, 10, 416–424. [Google Scholar] [CrossRef]
- Xu, J.; Xie, S.W.; Chi, S.Y.; Zhang, S.; Cao, J.M.; Tan, B.P. Short-term dietary antibiotics altered the intestinal microbiota and improved the lipid metabolism in hybrid grouper fed medium and high-lipid diets. Aquaculture 2021, 547, 737453. [Google Scholar] [CrossRef]
- Zhang, Y.; Feng, H.; Liang, X.F.; He, S.; Lan, J.; Li, L. Dietary bile acids reduce liver lipid deposition via activating farnesoid X receptor, and improve gut health by regulating gut microbiota in Chinese perch (Siniperca chuatsi). Fish Shellfish Immunol. 2022, 121, 265–275. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wang, S.; Hu, Y.; Cheng, J.; Cheng, X.; Cheng, P.; Cui, Z. Dietary bile acid supplementation reveals beneficial effects on intestinal healthy status of tongue sole (Cynoglossus semiliaevis). Fish Shellfish Immunol. 2021, 116, 52–60. [Google Scholar] [CrossRef] [PubMed]
- Fan, L.; Li, Q.X. Characteristics of intestinal microbiota in the Pacific white shrimp Litopenaeus vannamei differing growth performances in the marine cultured environment. Aquaculture 2019, 505, 450–461. [Google Scholar] [CrossRef]
- Wang, T.; Yang, J.; Lin, G.; Li, M.; Zhu, R.; Zhang, Y.; Mai, K. Effects of Dietary Mannan Oligosaccharides on Non-Specific Immunity, Intestinal Health, and Antibiotic Resistance Genes in Pacific White Shrimp Litopenaeus vannamei. Front. Immunol. 2021, 13, 1015734. [Google Scholar] [CrossRef]
Ingredients | Content (%) |
---|---|
Fish meal | 25.00 |
Soybean meal | 20.00 |
Peanut meal | 10.00 |
Canola meal | 5.00 |
Shrimp shell meal | 6.00 |
Flour | 23.00 |
Fish oil | 5.00 |
Microcrystalline cellulose | 1.70 |
Phosphatidylinositol | 1.50 |
Calcium bis | 1.50 |
1 Vitamin premix | 0.50 |
2 Mineral premix | 0.50 |
Sodium chloride | 0.20 |
Vitamin C ester | 0.10 |
Nutrient components | |
Crude protein | 42.54 |
Crude lipid | 9.63 |
Ash | 7.23 |
Dry matter (DM, %) | Energy content (kcal/kg) |
93.5 | 3300 |
Primer Name | Sequence (5′-3′) | Fragment Size (bp) | Accession Number |
---|---|---|---|
β-actin-F | GCCCTGTTCCAGCCCTCATT | 944 | AY486466.2 |
β-actin-R | ACGGATGTCCACGTCGCACT | ||
LYZ-F | GAAGCGACTACGGCAAGAAC | 1069 | XM_070138434.1 |
LYZ-R | AACCGTGAGACCAGCACTCT | ||
TLR-F | GACCATCCCTTTTACACCAGACT | 4090 | XM_070131812.1 |
TLR-R | CCTCGCACATCCAGGACTTTTA | ||
proPO-F | CAATGACCAGCAGCGTCTTC | 2061 | AF521948.1 |
proPO-R | CACGGAAGGAGGCGTATCAT |
3 Group | |||||
---|---|---|---|---|---|
CT | BA1 | BA2 | BA3 | p-Value | |
1 IBW (g) | 2 1.22 ± 0.04 a | 1.21 ± 0.06 a | 1.21 ± 0.07 a | 1.21 ± 0.06 a | 0.9863 |
FBW (g) | 13.75 ± 1.14 a | 14.11 ± 0.82 ab | 16.29 ± 0.95 b | 16.09 ± 0.89 ab | 0.0219 |
WGR (%) | 1126.78 ± 93.50 a | 1165.84 ± 67.56 ab | 1346.56 ± 78.56 b | 1329.75 ± 73.31 ab | 0.0186 |
FI (g) | 24.28 ± 1.22 a | 24.81 ± 0.86 a | 26.93 ± 1.26 a | 25.96 ± 1.14 a | 0.3235 |
FC | 1.94 ± 0.1 a | 1.92 ± 0.07 a | 1.79 ± 0.08 a | 1.74 ± 0.08 a | 0.2832 |
SR (%) | 86.67 ± 2.08 a | 89.33 ± 1.53 ab | 91.67 ± 1.53 b | 91.33 ± 1.15 b | 0.0180 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, Y.; Chen, D.; Wang, H. Effects of Bile Acids on Growth Performance, Hepatopancreatic Antioxidant Capacity, Intestinal Immune-Related Gene Expression, and Gut Microbiota of Penaeus vannamei. Animals 2025, 15, 240. https://doi.org/10.3390/ani15020240
Zhao Y, Chen D, Wang H. Effects of Bile Acids on Growth Performance, Hepatopancreatic Antioxidant Capacity, Intestinal Immune-Related Gene Expression, and Gut Microbiota of Penaeus vannamei. Animals. 2025; 15(2):240. https://doi.org/10.3390/ani15020240
Chicago/Turabian StyleZhao, Yun, Duanduan Chen, and Hui Wang. 2025. "Effects of Bile Acids on Growth Performance, Hepatopancreatic Antioxidant Capacity, Intestinal Immune-Related Gene Expression, and Gut Microbiota of Penaeus vannamei" Animals 15, no. 2: 240. https://doi.org/10.3390/ani15020240
APA StyleZhao, Y., Chen, D., & Wang, H. (2025). Effects of Bile Acids on Growth Performance, Hepatopancreatic Antioxidant Capacity, Intestinal Immune-Related Gene Expression, and Gut Microbiota of Penaeus vannamei. Animals, 15(2), 240. https://doi.org/10.3390/ani15020240