Dietary γ-Aminobutyric Acid Promotes Growth and Immune System Performance and Improves Erythropoiesis and Angiogenesis in Gibel Carp (Carassius auratus gibelio)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Diet Preparation
2.2. Experimental Management
2.3. Sample Collection
2.4. Chemical Analysis
2.5. Gene Expression Analysis
2.6. Data Analysis
3. Results
3.1. Growth Performance
3.2. Whole Body Composition
3.3. Plasma Biochemistry
3.4. Plasma Enzymatic Indices
3.5. Nrf2 Signaling Pathway
3.6. Liver Inflammatory Factor Genes
3.7. Genes Related to Vascular Regeneration and Iron Metabolism
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Golden, C.D.; Koehn, J.Z.; Shepon, A.; Passarelli, S.; Free, C.M.; Viana, D.F.; Matthey, H.; Eurich, J.G.; Gephart, J.A.; Fluet-Chouinard, E.; et al. Aquatic Foods to Nourish Nations. Nature 2021, 598, 315–320. [Google Scholar] [CrossRef] [PubMed]
- Naylor, R.L.; Kishore, A.; Sumaila, U.R.; Issifu, I.; Hunter, B.P.; Belton, B.; Bush, S.R.; Cao, L.; Gelcich, S.; Gephart, J.A.; et al. Blue Food Demand across Geographic and Temporal Scales. Nat. Commun. 2021, 12, 5413. [Google Scholar] [CrossRef] [PubMed]
- FAO. Blue Transformation in Action. In Brief to the State of World Fisheries and Aquaculture; FAO: Rome, Italy, 2024. [Google Scholar]
- Dawood, M.A.O.; Koshio, S. Recent Advances in the Role of Probiotics and Prebiotics in Carp Aquaculture: A Review. Aquaculture 2016, 454, 243–251. [Google Scholar] [CrossRef]
- Chen, Y.; Zhu, X.; Yang, Y.; Han, D.; Jin, J.; Xie, S. Effect of Dietary Chitosan on Growth Performance, Haematology, Immune Response, Intestine Morphology, Intestine Microbiota and Disease Resistance in Gibel Carp (Carassius auratus gibelio). Aquac. Nutr. 2014, 20, 532–546. [Google Scholar] [CrossRef]
- Steward, F.C. γ-Aminobutyric Acid: A Constituent of Potato Tubers? Science 1949, 110, 439–440. [Google Scholar]
- Michaeli, S.; Fromm, H. Closing the Loop on the GABA Shunt in Plants: Are GABA Metabolism and Signaling Entwined? Front. Plant Sci. 2015, 6, 419. [Google Scholar] [CrossRef] [PubMed]
- Ali, M.M.; Ashrafuzzaman, M.; Ismail, M.R.; Shahidullah, S.M.; Prodhan, A. Influence of Foliar Applied GABA on Growth and Yield Contributing Characters of White Gourd (Benincasa Hispida). Int. J. Agric. Biol. 2010, 12, 373–376. [Google Scholar]
- Ashrafuzzaman, M.; Ismail, M.R.; Fazal, K.A.I.; Uddin, M.K.; Prodhan, A. Effect of GABA Application on the Growth and Yield of Bitter Gourd (Momordica charantia). Int. J. Agric. Biol. 2010, 12, 129–132. [Google Scholar]
- Fathi, M.; Saeedyan, S.; Kaoosi, M. Gamma-Amino Butyric Acid (GABA) Supplementation Alleviates Dexamethasone Treatment-Induced Oxidative Stress and Inflammation Response in Broiler Chickens. Stress 2023, 26, 2185861. [Google Scholar] [CrossRef]
- Guo, K.; Cao, H.; Zhu, Y.; Wang, T.; Hu, G.; Kornmatitsuk, B.; Luo, J. Improving Effects of Dietary Rumen Protected Γ-aminobutyric Acid Additive on Apparent Nutrient Digestibility, Growth Performance and Health Status in Heat-stressed Beef Cattle. Anim. Sci. J. 2018, 89, 1280–1286. [Google Scholar] [CrossRef] [PubMed]
- Bi, C.; Yin, J.; Yang, W.; Shi, B.; Shan, A. Effects of Dietary Γ-aminobutyric Acid Supplementation on Antioxidant Status, Blood Hormones and Meat Quality in Grow-ing-finishing Pigs Undergoing Transport Stress. J. Anim. Physiol. Anim. Nutr. 2020, 104, 590–596. [Google Scholar] [CrossRef] [PubMed]
- Ruenkoed, S.; Nontasan, S.; Phudkliang, J.; Phudinsai, P.; Pongtanalert, P.; Panprommin, D.; Mongkolwit, K.; Wangkahart, E. Effect of Dietary Gamma Aminobutyric Acid (GABA) Modulated the Growth Performance, Immune and Antioxidant Capac-ity, Digestive Enzymes, Intestinal Histology and Gene Expression of Nile Tilapia (Oreochromis niloticus). Fish Shellfish. Immunol. 2023, 141, 109056. [Google Scholar] [CrossRef] [PubMed]
- Temu, V.; Kim, H.; Hamidoghli, A.; Park, M.; Won, S.; Oh, M.; Han, J.-K.; Bai, S.C. Effects of Dietary Gamma-Aminobutyric Acid in Juvenile Nile Tilapia, Orechromis niloticus. Aquaculture 2019, 507, 475–480. [Google Scholar] [CrossRef]
- Li, M.; Qiu, L.; Wang, L.; Wang, W.; Xin, L.; Li, Y.; Liu, Z.; Song, L. The Inhibitory Role of γ-Aminobutyric Acid (GABA) on Immunomodulation of Pacific Oyster Crassostrea Gigas. Fish Shellfish. Immunol. 2016, 52, 16–22. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Jiang, M.; Han, Q.; Peng, R.; Jiang, X. Effects of Γ-aminobutyric Acid Supplementation on the Growth Performance, Serum Biochemical Indices and Antioxidant Status of Pharaoh Cuttlefish, Sepia Pharaonis. Aquac. Nutr. 2020, 26, 1026–1034. [Google Scholar] [CrossRef]
- Chen, X.; Gao, C.; Du, X.; Xu, H.; Wang, G.; Zhang, D. Effects of Dietary Γ-aminobutyric Acid Levels on the Growth, Serum Biochemical Indexes, Immune-related Signalling Mole-cules of Jian Carp. Aquac. Res. 2021, 52, 1096–1105. [Google Scholar] [CrossRef]
- Bae, J.; Hamidoghli, A.; Farris, N.W.; Olowe, O.S.; Choi, W.; Lee, S.; Won, S.; Ohh, M.; Lee, S.; Bai, S.C. Dietary γ-Aminobutyric Acid (GABA) Promotes Growth and Resistance to Vibrio Alginolyticus in Whiteleg Shrimp Li-topenaeus Vannamei. Aquac. Nutr. 2022, 2022, 9105068. [Google Scholar] [CrossRef]
- Xie, S.-W.; Li, Y.-T.; Zhou, W.-W.; Tian, L.-X.; Li, Y.-M.; Zeng, S.-L.; Liu, Y.-J. Effect of Γ-aminobutyric Acid Supplementation on Growth Performance, Endocrine Hormone and Stress Tolerance of Juve-nile Pacific White Shrimp, Litopenaeus Vannamei, Fed Low Fishmeal Diet. Aquac. Nutr. 2017, 23, 54–62. [Google Scholar] [CrossRef]
- Lee, S.; Moniruzzaman, M.; Farris, N.; Min, T.; Bai, S.C. Interactive Effect of Dietary Gamma-Aminobutyric Acid (GABA) and Water Temperature on Growth Performance, Blood Plasma Indices, Heat Shock Proteins and GABAergic Gene Expression in Juvenile Olive Flounder Paralichthys Olivaceus. Metabolites 2023, 13, 619. [Google Scholar] [CrossRef]
- Wu, F.; Liu, M.; Chen, C.; Chen, J.; Tan, Q. Effects of Dietary Gamma Aminobutyric Acid on Growth Performance, Antioxidant Status, and Feeding-related Gene Ex-pression of Juvenile Grass Carp, Ctenopharyngodon Idellus. J. World Aquac. Soc. 2016, 47, 820–829. [Google Scholar] [CrossRef]
- Shelp, B.J.; Aghdam, M.S.; Flaherty, E.J. γ-Aminobutyrate (GABA) regulated plant defense: Mechanisms and opportunities. Plants 2021, 10, 1939. [Google Scholar] [CrossRef] [PubMed]
- Cao, Z.; Chen, H.; Zhou, C.; Gong, M.; Li, Y.; Shao, Y.; Wu, Y.; Bao, D. Exogenous γ-Aminobutyric Acid (GABA) Enhanced Response to Abiotic Stress in Hypsizygus Marmoreus by Improving My-celial Growth and Antioxidant Capacity. Metabolites 2024, 14, 94. [Google Scholar] [CrossRef] [PubMed]
- Jeong, S.-B.; Kim, Y.B.; Lee, J.-W.; Kim, D.-H.; Moon, B.-H.; Chang, H.-H.; Choi, Y.-H.; Lee, K.-W. Role of Dietary Gamma-Aminobutyric Acid in Broiler Chickens Raised under High Stocking Density. Anim. Nutr. 2020, 6, 293–304. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Zhao, J.; Hu, J.; He, H.; Wei, Y.; Ji, L.; Ma, X. Gama-Aminobutyric Acid (GABA) Alleviates Hepatic Inflammation via GABA Receptors/TLR4/NF-κB Pathways in Grow-ing-Finishing Pigs Generated by Super-Multiparous Sows. Anim. Nutr. 2022, 9, 280–290. [Google Scholar] [CrossRef] [PubMed]
- Kutyrev, I.A.; Franke, F.; Kurtz, J.; Scharsack, J.P. In Vitro Effects of the Neuroactive Substances Serotonin and γ-Aminobutyric Acid on Leucocytes from Sticklebacks (Gas-terosteus aculeatus). Fish Shellfish. Immunol. 2019, 87, 286–296. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Zhou, Q.; Tu, J.; Wang, Y.; Song, R.; Chu, Z.; Li, S.; Li, J.; Zhang, H.; Zhang, M. Ameliorative Effect of Gamma-Aminobutyric Acid on the Antioxidant Status and Ammonia Stress Resistance of Micropterus Salmoides. Aquac. Rep. 2023, 32, 101734. [Google Scholar] [CrossRef]
- Zhang, C.; Liu, J.; Wang, X.; Li, E.; Song, M.; Yang, Y.; Qin, C.; Qin, J.; Chen, L. Comprehensive Transcriptional and Metabolomic Analysis Reveals the Neuroprotective Mechanism of Dietary Gamma-Aminobutyric Acid Response to Hypoxic Stress in the Chinese Mitten Crab (Eriocheir sinensis). Fish Shellfish. Immunol. 2023, 135, 108663. [Google Scholar] [CrossRef] [PubMed]
- Varghese, T.; Kumar, R.V.J.; Anand, G.; Dasgupta, S.; Pal, A.K. Dietary GABA Enhances Hypoxia Tolerance of a Bottom-Dwelling Carp, Cirrhinus Mrigala by Modulating HIF-1α, Thyroid Hormones and Metabolic Responses. Fish Physiol. Biochem. 2020, 46, 199–212. [Google Scholar] [CrossRef] [PubMed]
- Salvatierra, A.; Pimentel, P.; Almada, R.; Hinrichsen, P. Exogenous GABA Application Transiently Improves the Tolerance to Root Hypoxia on a Sensitive Genotype of Prunus Root-stock. Environ. Exp. Bot. 2016, 125, 52–66. [Google Scholar] [CrossRef]
- Lü, G.; Liang, Y.; Wu, X.; Li, J.; Ma, W.; Zhang, Y.; Gao, H. Molecular Cloning and Functional Characterization of Mitochondrial Malate Dehydrogenase (mMDH) Is Involved in Exoge-nous GABA Increasing Root Hypoxia Tolerance in Muskmelon Plants. Sci. Hortic. 2019, 258, 108741. [Google Scholar] [CrossRef]
- Zhang, C.; He, J.; Wang, X.; Yang, Y.; Huang, Q.; Qiao, F.; Shi, Q.; Qin, J.; Chen, L. Gamma-Aminobutyric Acid Enhances Hypoxia Tolerance of Juvenile Chinese Mitten Crab (Eriocheir sinensis) by Regulating Respiratory Metabolism and Alleviating Neural Excitotoxicity. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2022, 260, 109409. [Google Scholar] [CrossRef] [PubMed]
- Won, C.; Lin, Z.; Kumar T, P.; Li, S.; Ding, L.; Elkhal, A.; Szabó, G.; Vasudevan, A. Autonomous Vascular Networks Synchronize GABA Neuron Migration in the Embryonic Forebrain. Nat. Commun. 2013, 4, 2149. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Kumar T, P.; Joshee, S.; Kirschstein, T.; Subburaju, S.; Khalili, J.S.; Kloepper, J.; Du, C.; Elkhal, A.; Szabó, G. Endothelial Cell-Derived GABA Signaling Modulates Neuronal Migration and Postnatal Behavior. Cell Res. 2018, 28, 221–248. [Google Scholar] [CrossRef] [PubMed]
- Kocharyan, A.; Fernandes, P.; Tong, X.-K.; Vaucher, E.; Hamel, E. Specific Subtypes of Cortical GABA Interneurons Contribute to the Neurovascular Coupling Response to Basal Forebrain Stimulation. J. Cereb. Blood Flow Metab. 2008, 28, 221–231. [Google Scholar] [CrossRef] [PubMed]
- Nilsson, G.E.; Renshaw, G.M. Hypoxic Survival Strategies in Two Fishes: Extreme Anoxia Tolerance in the North European Crucian Carp and Natural Hypoxic Preconditioning in a Coral-Reef Shark. J. Exp. Biol. 2004, 207, 3131–3139. [Google Scholar] [CrossRef] [PubMed]
- Yan, Z.; Liu, B.; Liu, J.; Guo, Z.; Kou, Y.; Lu, W.; Sun, J.; Li, Y. Enhancing Resilience to Chronic Ammonia Stress in Crucian Carp (Carassius carassius) through Dietary Gamma-Aminobutyric Acid (GABA) Supplementation: Effects on Growth Performance, Immune Function, Hepatotoxicity, and Apoptosis. Aquac. Rep. 2024, 37, 102259. [Google Scholar] [CrossRef]
- Wang, K.; Zhang, L.; Liang, H.; Ren, M.; Mi, H.; Huang, D.; Gu, J. Effects of Dietary Ferroporphyrin Supplementation on Growth Performance, Antioxidant Capacity, Immune Response, and Oxygen-Carrying Capacity in Gibel Carp (Carassius auratus gibelio). Animals 2024, 14, 3104. [Google Scholar] [CrossRef]
- Yi, C.; Liang, H.; Huang, D.; Yu, H.; Xue, C.; Gu, J.; Chen, X.; Wang, Y.; Ren, M.; Zhang, L. Phenylalanine Plays Important Roles in Regulating the Capacity of Intestinal Immunity, Antioxidants and Apoptosis in Largemouth Bass (Micropterus salmoides). Animals 2023, 13, 2980. [Google Scholar] [CrossRef] [PubMed]
- Kohen, R.; Nyska, A. Invited Review: Oxidation of Biological Systems: Oxidative Stress Phenomena, Antioxidants, Redox Reactions, and Methods for Their Quantification. Toxicol. Pathol. 2002, 30, 620–650. [Google Scholar] [CrossRef] [PubMed]
- Parvez, S.; Raisuddin, S. Protein Carbonyls: Novel Biomarkers of Exposure to Oxidative Stress-Inducing Pesticides in Freshwater Fish Channa punctata (Bloch). Environ. Toxicol. Pharmacol. 2005, 20, 112–117. [Google Scholar] [CrossRef]
- Kusano, C.; Ferrari, B. Total Antioxidant Capacity: A Biomarker in Biomedical and Nutritional Studies. J. Cell Mol. Biol. 2008, 7, 1–15. [Google Scholar]
- Ryan, H.E.; Lo, J.; Johnson, R.S. HIF-1α Is Required for Solid Tumor Formation and Embryonic Vascularization. EMBO J. 1998, 17, 3005–3015. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Wang, Z.-W.; Wang, Y.; Gui, J.-F. Crucian carp and gibel carp culture. In Aquaculture in China: Success Stories and Modern Trends; John Wiley & Sons: Hoboken, NJ, USA, 2018; pp. 149–157. [Google Scholar] [CrossRef]
- Nadermann, N.; Seward, R.K.; Volkoff, H. Effects of Potential Climate Change-Induced Environmental Modifications on Food Intake and the Expression of Appetite Regulators in Goldfish. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2019, 235, 138–147. [Google Scholar] [CrossRef] [PubMed]
- Jacquin, L.; Gandar, A.; Aguirre-Smith, M.; Perrault, A.; Le Hénaff, M.; De Jong, L.; Paris-Palacios, S.; Laffaille, P.; Jean, S. High Temperature Aggravates the Effects of Pesticides in Goldfish. Ecotoxicol. Environ. Saf. 2019, 172, 255–264. [Google Scholar] [CrossRef]
- Zhang, M.; Cai, Z.; Zhang, G.; Zhang, Y.; Xue, N.; Zhang, D.; Pan, X. Effectively Reducing Antibiotic Contamination and Resistance in Fishery by Efficient Gastrointestine-Blood Delivering Dietary Millispheres. J. Hazard. Mater. 2021, 409, 125012. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Lu, G.; Cui, J. Responses of AChE and GST Activities to Insecticide Coexposure in Carassius auratus. Environ. Toxicol. 2012, 27, 50–57. [Google Scholar] [CrossRef] [PubMed]
- Sollid, J.; Weber, R.E.; Nilsson, G.E. Temperature Alters the Respiratory Surface Area of Crucian Carp Carassius Carassius and Goldfish Carassius auratus. J. Exp. Biol. 2005, 208, 1109–1116. [Google Scholar] [CrossRef] [PubMed]
- Auteri, M.; Zizzo, M.G.; Serio, R. GABA and GABA Receptors in the Gastrointestinal Tract: From Motility to Inflammation. Pharmacol. Res. 2015, 93, 11–21. [Google Scholar] [CrossRef]
- Jiang, J.; Yin, L.; Li, J.-Y.; Li, Q.; Shi, D.; Feng, L.; Liu, Y.; Jiang, W.-D.; Wu, P.; Zhao, Y. Glutamate Attenuates Lipopolysaccharide-Induced Oxidative Damage and mRNA Expression Changes of Tight Junction and Defensin Proteins, Inflammatory and Apoptosis Response Signaling Molecules in the Intestine of Fish. Fish Shellfish. Immunol. 2017, 70, 473–484. [Google Scholar] [CrossRef]
- Li, J.; Wang, C.; Wang, L.; Xu, Q.; Zhao, Z.; Luo, L.; Du, X. Effects of Glutamate in Low-phosphorus Diets on Growth Performance, Antioxidant Enzyme Activity, Immune-related Gene Expression and Resistance to Aeromonas Hydrophila of Juvenile Mirror Carp (Cyprinus carpio). Aquac. Nutr. 2020, 26, 1329–1339. [Google Scholar] [CrossRef]
- Wellington, M.O.; Hulshof, T.G.; Ernst, K.; Balemans, A.; Page, G.I.; Van Hees, H.M. Impact of L-arginine and L-glutamine Supplementation on Growth Performance and Immune Status in Weanling Pigs Chal-lenged with Escherichia coli F4. J. Anim. Sci. 2023, 101, skad138. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Dong, X.; Yang, Q.; Liu, H.; Zhang, S.; Chi, S.; Tan, B. Glutamine Improves Growth and Intestinal Health in Juvenile Hybrid Groupers Fed High-Dose Glycinin. Fish Shellfish. Immunol. 2023, 141, 109003. [Google Scholar] [CrossRef]
- Zhang, S.; Li, X.; Yuan, T.; Guo, X.; Jin, C.; Jin, Z.; Li, J. Glutamine Inhibits Inflammation, Oxidative Stress, and Apoptosis and Ameliorates Hyperoxic Lung Injury. J. Physiol. Biochem. 2023, 79, 613–623. [Google Scholar] [CrossRef]
- Lee, D.G.; Cho, S.; Lee, J.; Cho, S.H.; Lee, S. Analysis of γ-Aminobutyric Acid Content in Fermented Plant Products by HPLC/UV. J. Appl. Biol. Chem. 2015, 58, 303–309. [Google Scholar] [CrossRef]
- Association of Official Analytical Chemists. Official Methods of Analysis; Association of Official Analytical Chemists: Washington, DC, USA, 1990. [Google Scholar]
- Zhang, L.; Zhang, L.; Liang, H.; Huang, D.; Ren, M. Effects of Taurine and Vitamin C on the Improvement of Antioxidant Capacity, Immunity and Hypoxia Tolerance in Gibel Carp (Carrassius auratus gibeilo). Antioxidants 2024, 13, 1169. [Google Scholar] [CrossRef] [PubMed]
- Zhao, F.; Xu, P.; Xu, G.; Huang, D.; Zhang, L.; Ren, M.; Liang, H. Dietary Valine Affects Growth Performance, Intestinal Immune and Antioxidant Capacity in Juvenile Largemouth Bass (Micropterus salmoides). Anim. Feed Sci. Technol. 2023, 295, 115541. [Google Scholar] [CrossRef]
- Sun, L.; Wang, Q.; Wang, R.; Sun, K.; Li, S.; Lin, G.; Lei, P.; Xu, H. Effect of Dietary Poly-γ-Glutamic Acid on Growth, Digestive Enzyme Activity, Antioxidant Capacity, and TOR Pathway Gene Expression of Gibel Carp (Carassius auratus gibelio). Aquac. Rep. 2022, 27, 101412. [Google Scholar] [CrossRef]
- Zhao, Y.; Zhang, T.-R.; Li, Q.; Feng, L.; Liu, Y.; Jiang, W.-D.; Wu, P.; Zhao, J.; Zhou, X.-Q.; Jiang, J. Effect of Dietary L-glutamate Levels on Growth, Digestive and Absorptive Capability, and Intestinal Physical Barrier Func-tion in Jian Carp (Cyprinus carpio Var. Jian). Anim. Nutr. 2020, 6, 198–209. [Google Scholar] [CrossRef] [PubMed]
- Geyer, P.E.; Holdt, L.M.; Teupser, D.; Mann, M. Revisiting Biomarker Discovery by Plasma Proteomics. Mol. Syst. Biol. 2017, 13, 942. [Google Scholar] [CrossRef] [PubMed]
- Ji, K.; He, J.; Liang, H.; Ren, M.; Ge, X.; Masagounder, K. Response of Gibel Carp (Carassius auratus gibelio) to Increasing Levels of Dietary Lysine in Zero Fish Meal Diets. Aquac. Nutr. 2021, 27, 49–62. [Google Scholar] [CrossRef]
- Zhang, C.; He, J.; Wang, X.; Su, R.; Huang, Q.; Qiao, F.; Qin, C.; Qin, J.; Chen, L. Dietary Gamma-Aminobutyric Acid (GABA) Improves Non-Specific Immunity and Alleviates Lipopolysaccharide (LPS)-Induced Immune Overresponse in Juvenile Chinese Mitten Crab (Eriocheir sinensis). Fish Shellfish. Immunol. 2022, 124, 480–489. [Google Scholar] [CrossRef] [PubMed]
- Yi, C.; Huang, D.; Yu, H.; Gu, J.; Liang, H.; Ren, M. Enzymatically Hydrolyzed Poultry By-Product Supplementation, Instead of Fishmeal, Alone Improves the Quality of Large-mouth Bass (Micropterus salmoides) Back Muscle without Compromising Growth. Foods 2023, 12, 3485. [Google Scholar] [CrossRef] [PubMed]
- Mittler, R.; Vanderauwera, S.; Suzuki, N.; Miller, G.; Tognetti, V.B.; Vandepoele, K.; Gollery, M.; Shulaev, V.; Van Breusegem, F. ROS Signaling: The New Wave? Trends Plant Sci. 2011, 16, 300–309. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.; Rui, D.; Yan, Y.; Xu, S.; Niu, Q.; Feng, G.; Wang, Y.; Li, S.; Jing, M. Oxidative Damage Induced by Arsenic in Mice or Rats: A Systematic Review and Meta-Analysis. Biol. Trace Elem. Res. 2017, 176, 154–175. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Hu, Y.; Zhou, X.-Q.; Zeng, X.-Y.; Feng, L.; Liu, Y.; Jiang, W.-D.; Li, S.-H.; Li, D.-B.; Wu, X.-Q.; et al. Effects of Dietary Glutamate Supplementation on Growth Performance, Digestive Enzyme Activities and Antioxidant Capacity in Intestine of Grass Carp (Ctenopharyngodon idella). Aquac. Nutr. 2015, 21, 935–941. [Google Scholar] [CrossRef]
- Wang, D.M.; Wang, C.; Liu, H.Y.; Liu, J.X.; Ferguson, J.D. Effects of Rumen-Protected γ-Aminobutyric Acid on Feed Intake, Lactation Performance, and Antioxidative Status in Early Lactating Dairy Cows. J. Dairy Sci. 2013, 96, 3222–3227. [Google Scholar] [CrossRef] [PubMed]
- Bae, J.; Hamidoghli, A.; Won, S.; Choi, W.; Lim, S.-G.; Kim, K.-W.; Lee, B.-J.; Hur, S.-W.; Bai, S.C. Evaluation of Seven Different Functional Feed Additives in a Low Fish Meal Diet for Olive Flounder, Paralichthys olivaceus. Aquaculture 2020, 525, 735333. [Google Scholar] [CrossRef]
- Li, C.; Tian, Y.; Ma, Q.; Zhang, B. Dietary Gamma-Aminobutyric Acid Ameliorates Growth Impairment and Intestinal Dysfunction in Turbot (Scophthalmus maximus L.) Fed a High Soybean Meal Diet. Food Funct. 2022, 13, 290–303. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhen, S.; Sun, F.; Cao, L.; Wang, L. Effects of γ-Aminobutyric Acid on Growth Performance, Immunity, Antioxidant Capacity, and Intestinal Microbiota of Growing Minks. Vet. Sci. 2024, 11, 398. [Google Scholar] [CrossRef]
- Zhang, S.; Xue, J.; Zheng, J.; Wang, S.; Zhou, J.; Jiao, Y.; Geng, Y.; Wu, J.; Hannafon, B.N.; Ding, W.-Q. The Superoxide Dismutase 1 3′UTR Maintains High Expression of the SOD1 Gene in Cancer Cells: The Involvement of the RNA-Binding Protein AUF-1. Free Radic. Biol. Med. 2015, 85, 33–44. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Reyes-García, M.G.; Hernández-Hernández, F.; Hernández-Téllez, B.; García-Tamayo, F. GABA (A) Receptor Subunits RNA Expression in Mice Peritoneal Macrophages Modulate Their IL-6/IL-12 Production. J. Neuroimmunol. 2007, 188, 64–68. [Google Scholar] [CrossRef] [PubMed]
- Bergeret, M.; Khrestchatisky, M.; Tremblay, E.; Bernard, A.; Gregoire, A.; Chany, C. GABA Modulates Cytotoxicity of Immunocompetent Cells Expressing GABAA Receptor Subunits. Biomed. Pharmacother. 1998, 52, 214–219. [Google Scholar] [CrossRef] [PubMed]
- Pfeffer, K. Biological Functions of Tumor Necrosis Factor Cytokines and Their Receptors. Cytokine Growth Factor Rev. 2003, 14, 185–191. [Google Scholar] [CrossRef] [PubMed]
- Roca, F.J.; Mulero, I.; López-Muñoz, A.; Sepulcre, M.P.; Renshaw, S.A.; Meseguer, J.; Mulero, V. Evolution of the Inflammatory Response in Vertebrates: Fish TNF-Is a Powerful Activator of Endothelial Cells but Hardly Activates Phagocytes. J. Immunol. 2008, 181, 5071–5081. [Google Scholar] [CrossRef]
- Hong, S.; Li, R.; Xu, Q.; Secombes, C.J.; Wang, T. Two Types of TNF-α Exist in Teleost Fish: Phylogeny, Expression, and Bioactivity Analysis of Type-II TNF-A3 in Rainbow Trout Oncorhynchus Mykiss. J. Immunol. 2013, 191, 5959–5972. [Google Scholar] [CrossRef] [PubMed]
- Grayfer, L.; Walsh, J.G.; Belosevic, M. Characterization and Functional Analysis of Goldfish (Carassius auratus L.) Tumor Necrosis Factor-Alpha. Dev. Comp. Immunol. 2008, 32, 532–543. [Google Scholar] [CrossRef]
- Grayfer, L.; Hodgkinson, J.W.; Hitchen, S.J.; Belosevic, M. Characterization and Functional Analysis of Goldfish (Carassius auratus L.) Interleukin-10. Mol. Immunol. 2010, 48, 563–571. [Google Scholar] [CrossRef] [PubMed]
- Haddad, G.; Hanington, P.C.; Wilson, E.C.; Grayfer, L.; Belosevic, M. Molecular and Functional Characterization of Goldfish (Carassius auratus L.) Transforming Growth Factor Beta. Dev. Comp. Immunol. 2008, 32, 654–663. [Google Scholar] [CrossRef] [PubMed]
- Nájera-Martínez, M.; López-Tapia, B.P.; Aguilera-Alvarado, G.P.; Madera-Sandoval, R.L.; Sánchez-Nieto, S.; Giron-Pérez, M.I.; Vega-López, A. Sub-Basal Increases of GABA Enhance the Synthesis of TNF-α, TGF-β, and IL-1β in the Immune System Organs of the Nile Tilapia. J. Neuroimmunol. 2020, 348, 577382. [Google Scholar] [CrossRef] [PubMed]
- Domenici, P.; Claireaux, G.; McKenzie, D.J. Environmental Constraints upon Locomotion and Predator-Prey Interactions in Aquatic Organisms: An Introduction. Philos. Trans. R. Soc. B Biol. Sci. 2007, 362, 1929–1936. [Google Scholar] [CrossRef]
- Guérit, S.; Allain, A.; Léon, C.; Cazenave, W.; Ferrara, N.; Branchereau, P.; Bikfalvi, A. VEGF Modulates Synaptic Activity in the Developing Spinal Cord. Dev. Neurobiol. 2014, 74, 1110–1122. [Google Scholar] [CrossRef] [PubMed]
- Negri, S.; Scolari, F.; Vismara, M.; Brunetti, V.; Faris, P.; Terribile, G.; Sancini, G.; Berra-Romani, R.; Moccia, F. GABAA and GABAB Receptors Mediate GABA-Induced Intracellular Ca2+ Signals in Human Brain Microvascular Endothe-lial Cells. Cells 2022, 11, 3860. [Google Scholar] [CrossRef] [PubMed]
- Vodovotz, Y.; Bogdan, C.; Paik, J.; Xie, Q.W.; Nathan, C. Mechanisms of Suppression of Macrophage Nitric Oxide Release by Transforming Growth Factor Beta. J. Exp. Med. 1993, 178, 605–613. [Google Scholar] [CrossRef]




| Ingredients | |||
|---|---|---|---|
| Fish meal a | 14.00 | Calcium dihydrogen phosphate | 2.00 |
| Poultry meal a | 4.00 | Vitamin premix b | 0.20 |
| Soybean meal a | 22.00 | Mineral premix b | 2.00 |
| Cottonseed meal a | 5.00 | 98.5%L-Lysine c | 0.30 |
| Rapeseed meal a | 22.00 | DL-Methionine c | 0.10 |
| Wheat flour a | 14.15 | Vc Phospholipids | 0.05 |
| Rice bran a | 10.00− d | 60%Choline chloride | 0.20 |
| Soybean oil | 4.00 | γ-Aminobutyric acid (mg/kg) | d |
| Analyzed proximate composition | |||
| Crude protein (%) | 40.25 ± 0.28 | ||
| Crude lipid (%) | 8.16 ± 0.11 |
| Genes a | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Accession Number/Reference |
|---|---|---|---|
| β-actin | TCCATTGTTGGACGACCCAG | TGGGCCTCATCTCCCACATA | LC382464.1 |
| gpx | GAAGTGAACGGTGTGAACGC | GATCCCCCATCAAGGACACG | DQ983598.1 |
| nrf2 | TACCAAAGACAAGCAGAAGAAACG | GCCTCGTTGAGCTGGTGTTTGG | [60] |
| cat | TGAAGTTCTACACCGATGAG | CTGAGAGTGGACGAAGGA | XM_026238665.1 |
| sod | TCGGAGACCTTGGTAATGT | CGCCTTCTCATGGATCAC | JQ776518.1 |
| il-10 | AGTGAGACTGAAGGAGCTCCG | TGGCAGAATGGTGTCCAAGTA | [61] |
| il-1β | GCGCTGCTCAACTTCATCTTG | GTGACACATTAAGCGGCTTCA C | [62] |
| tgf-β | GTTGGCGTAATAACCAGAAGG | AACAGAACAAGTTTGTACCGATAAG | [62] |
| tnf-α | CATTCCTACGGATGGCATTTACTT | CCTCAGGAATGTCAGTCTTGCAT | [62] |
| hif-1α | CTGCCGATCAGTCTGTCTCC | TTTGTGGAGTCTGGACCACG | DQ306727.1 |
| vegf | ATCGAGCACACGTACATCCC | CCTTTGGCCTGCATTCACAC | NM_131408.3 |
| nos | GGGGACCCTCCTGAAAATGG | TTCTGTCCTCAACGCTGGTG | AY644726.1 |
| et1 | TAAAGCAGCGTCAGACAGGG | CTGCCAGCTTGTGTTTGCAT | NM_131519.1 |
| angpt1 | CCAAACCTCACCAAGCAAGC | GGATTACAGTCCAGCCTCCG | XM_059556208.1 |
| ho-1 | GCAAACCAAGAGAAGCCACC | GGAAGTAGACGGGCTGAACC | KC758864 |
| epo | CGAAGTGTCAGCATACCGGA | GCAGATGACGCACTTTTCCC | KC460317.1 |
| tf | CCGAGAAGATGCACGCAAAG | TGTGCATGCCTTGACCAGAT | AF518747.1 |
| tfr1 | CTTTGTCAACGAAGTGGCTGAAT | TACCAAAGAAAATGTGGCGGAAC | XM_052542523.1 |
| Indices | G1 | G2 | G3 | G4 | G5 |
|---|---|---|---|---|---|
| IBW (g) | 41.83 ± 0.04 | 41.88 ± 0.06 | 41.82 ± 0.03 | 41.93 ± 0.04 | 41.90 ± 0.05 |
| FBW (g) | 100.68 ± 0.87 a | 103.33 ± 2.20 ab | 107.40 ± 1.23 b | 102.97 ± 2.42 ab | 98.67 ± 1.69 a |
| FCR | 1.30 ± 0.02 ab | 1.26 ± 0.05 ab | 1.18 ± 0.02 a | 1.27 ± 0.05 ab | 1.35 ± 0.04 b |
| WGR (%) | 140.68 ± 2.33 a | 146.73 ± 5.58 ab | 156.83 ± 2.86 b | 145.56 ± 5.97 ab | 135.49 ± 4.15 a |
| SGR (%/d) | 0.94 ± 0.01 a | 0.97 ± 0.02 ab | 1.01 ± 0.01 b | 0.97 ± 0.03 ab | 0.92 ± 0.02 a |
| Indices | G1 | G2 | G3 | G4 | G5 |
|---|---|---|---|---|---|
| Moisture (%) | 76.62 ± 0.15 | 75.83 ± 0.52 | 75.93 ± 0.39 | 75.96 ± 0.51 | 76.12 ± 0.51 |
| Protein (%) | 15.38 ± 0.27 | 15.89 ± 0.48 | 16.28 ± 0.70 | 16.29 ± 0.72 | 16.36 ± 0.51 |
| Lipid (%) | 2.19 ± 0.35 | 1.93 ± 0.52 | 2.12 ± 0.63 | 2.43 ± 0.37 | 1.81 ± 0.41 |
| Ash (%) | 4.50 ± 0.13 | 4.64 ± 0.29 | 4.57 ± 0.12 | 4.52 ± 0.08 | 4.96 ± 0.24 |
| Indices | G1 | G2 | G3 | G4 | G5 |
|---|---|---|---|---|---|
| ALB (g/L) | 9.19 ± 0.28 bc | 9.62 ± 0.37 c | 9.48 ± 0.32 bc | 7.71 ± 0.22 a | 8.64 ± 0.17 b |
| ALT (U/L) | 0.81 ± 0.16 a | 1.11 ± 0.13 ab | 1.58 ± 0.32 b | 1.48 ± 0.21 ab | 1.27 ± 0.19 ab |
| AST (U/L) | 134.54 ± 4.56 a | 149.75 ± 9.27 ab | 159.50 ± 8.54 b | 143.00 ± 9.55 ab | 142.93 ± 4.61 ab |
| TC (mmol/L) | 5.76 ± 0.22 b | 6.34 ± 0.28 b | 6.02 ± 0.26 b | 4.99 ± 0.19 a | 5.93 ± 0.24 b |
| TG (mmol/L) | 1.21 ± 0.05 b | 1.47 ± 0.09 b | 1.28 ± 0.07 b | 1.14 ± 0.06 a | 1.43 ± 0.07 b |
| GLU (mmol/L) | 5.29 ± 0.47 a | 7.11 ± 0.36 b | 7.13 ± 0.33 b | 7.52 ± 0.38 b | 7.76 ± 0.22 b |
| TP (g/L) | 28.77 ± 0.82 b | 30.61 ± 1.32 b | 29.08 ± 1.11 b | 25.56 ± 0.32 a | 27.88 ± 0.76 b |
| Indices | G1 | G2 | G3 | G4 | G5 |
|---|---|---|---|---|---|
| SOD (U/mL) | 19.39 ± 0.32 | 20.05 ± 0.55 | 19.88 ± 0.58 | 19.69 ± 0.86 | 18.47 ± 0.75 |
| MDA (nmol/mL) | 10.63 ± 1.02 | 10.02 ± 0.71 | 9.04 ± 0.48 | 10.04 ± 0.82 | 8.78 ± 0.63 |
| CAT (U/mL) | 12.11 ± 3.02 | 14.97 ± 2.51 | 13.72 ± 3.14 | 9.02 ± 1.51 | 7.92 ± 1.32 |
| T-AOC (mM) | 0.32 ± 0.007 a | 0.33 ± 0.005 a | 0.35 ± 0.004 b | 0.34 ± 0.003 b | 0.33 ± 0.005 ab |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bai, X.; Zhang, L.; Liang, H.; Huang, D.; Ren, M.; Mi, H. Dietary γ-Aminobutyric Acid Promotes Growth and Immune System Performance and Improves Erythropoiesis and Angiogenesis in Gibel Carp (Carassius auratus gibelio). Animals 2025, 15, 125. https://doi.org/10.3390/ani15020125
Bai X, Zhang L, Liang H, Huang D, Ren M, Mi H. Dietary γ-Aminobutyric Acid Promotes Growth and Immune System Performance and Improves Erythropoiesis and Angiogenesis in Gibel Carp (Carassius auratus gibelio). Animals. 2025; 15(2):125. https://doi.org/10.3390/ani15020125
Chicago/Turabian StyleBai, Xinlan, Lu Zhang, Hualiang Liang, Dongyu Huang, Mingchun Ren, and Haifeng Mi. 2025. "Dietary γ-Aminobutyric Acid Promotes Growth and Immune System Performance and Improves Erythropoiesis and Angiogenesis in Gibel Carp (Carassius auratus gibelio)" Animals 15, no. 2: 125. https://doi.org/10.3390/ani15020125
APA StyleBai, X., Zhang, L., Liang, H., Huang, D., Ren, M., & Mi, H. (2025). Dietary γ-Aminobutyric Acid Promotes Growth and Immune System Performance and Improves Erythropoiesis and Angiogenesis in Gibel Carp (Carassius auratus gibelio). Animals, 15(2), 125. https://doi.org/10.3390/ani15020125

