Neuropeptide Y Boosts Intestinal Mucosal Immunity of Tilapia Infected with Streptococcus agalactiae by Reducing Inflammation and Oxidative Stress
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Fish
2.2. NPY for Injection
2.3. S. agalactiae Challenge
2.4. NPY and S. agalactiae Co-Injection Model
2.5. Sample Collection
2.6. RNA Extraction and Real-Time PCR
2.7. Histopathology
2.8. Serum Biochemical Parameter Assay
2.9. Statistical Analysis
3. Results
3.1. S. agalactiae Infection Triggered the Expression of NPY Family in the Gastrointestinal Tissues of Tilapia
3.2. Effects of NPY on Gastrointestinal Inflammatory Response in Tilapia Infected with S. agalactiae
3.3. Correlation Analysis of PYY, Receptors and Inflammatory Factors in the Gastrointestinal Tract
3.4. NPY Ameliorated Gastrointestinal Tissue Damage in Tilapia Caused by S. agalactiae
3.5. NPY Affected Immune and Oxidative Reaction Induced by S. agalactiae
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| PP | Pancreatic Polypeptide |
| PYY | Peptide YY |
| NPY | Neuropeptide Y |
| ENS | Enteric Nervous System |
| GALT | Gut-Associated Lymphoid Tissue |
| IBD | Inflammatory Bowel Disease |
| Ig | Immunoglobulin |
| IgM | Immunoglobulin M |
| IgT | Immunoglobulin T |
| LPS | Lipopolysaccharide |
| MALT | Mucosa-Associated Lymphoid Tissue |
| MDA | Malondialdehyde |
| ACP | Acid Phosphatase |
| AKP | Alkaline Phosphatase |
| SOD | Superoxide Dismutase |
| GSH-PX | Glutathione Peroxidase |
| H&E | Hematoxylin and Eosin |
| OD | Optical Density |
| CFU | Colony-Forming Unit |
| IL-1 | Interleukin-1 |
| IL-10 | Interleukin-10 |
| TNF-α | Tumor Necrosis Factor Alpha |
| INF-γ | Interferon-gamma |
| nNOS | Neuronal nitric oxide synthase |
| qRT-PCR | Quantitative Real-Time Polymerase Chain Reaction |
| PBS | Phosphate-Buffered Saline |
References
- Larsson, T.A.; Larson, E.T.; Fredriksson, R.; Conlon, J.M.; Larhammar, D. Characterization of NPY receptor subtypes Y2 and Y7 in rainbow trout Oncorhynchus mykiss. Peptides 2006, 27, 1320–1327. [Google Scholar] [CrossRef]
- Sundstrom, G.; Larsson, T.A.; Brenner, S.; Venkatesh, B.; Larhammar, D. Evolution of the neuropeptide Y family: New genes by chromosome duplications in early vertebrates and in teleost fishes. Gen. Comp. Endocrinol. 2008, 155, 705–716. [Google Scholar] [CrossRef]
- Sundstrom, G.; Larsson, T.A.; Brenner, S.; Venkatesh, B.; Larhammar, D. Ray-fin fish tetraploidization gave rise to pufferfish duplicates of NPY and PYY, but zebrafish NPY duplicate was lost. Ann. N. Y. Acad. Sci. 2005, 1040, 476–478. [Google Scholar] [CrossRef]
- Ekblad, E.; Sundler, F. Distribution of pancreatic polypeptide and peptide YY. Peptides 2002, 23, 251–261. [Google Scholar] [CrossRef] [PubMed]
- Narnaware, Y.K.; Peyon, P.P.; Lin, X.; Peter, R.E. Regulation of food intake by neuropeptide Y in goldfish. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2000, 279, R1025–R1034. [Google Scholar] [CrossRef] [PubMed]
- Yokobori, E.; Azuma, M.; Nishiguchi, R.; Kang, K.S.; Kamijo, M.; Uchiyama, M.; Matsuda, K. Neuropeptide Y stimulates food intake in the Zebrafish, Danio rerio. J. Neuroendocr. 2012, 24, 766–773. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Pandit, N.P.; Fu, J.; Li, D.; Li, J. Identification, characterization and feeding response of peptide YYb (PYYb) gene in grass carp (Ctenopharyngodon idellus). Fish Physiol. Biochem. 2014, 40, 45–55. [Google Scholar] [CrossRef]
- Kurokawa, T.; Suzuki, T. Development of neuropeptide Y-related peptides in the digestive organs during the larval stage of Japanese flounder, Paralichthys olivaceus. Gen. Comp. Endocrinol. 2002, 126, 30–38. [Google Scholar] [CrossRef]
- Chen, Y.; Shen, Y.; Pandit, N.P.; Fu, J.; Li, D.; Li, J. Molecular cloning, expression analysis, and potential food intake attenuation effect of peptide YY in grass carp (Ctenopharyngodon idellus). Gen. Comp. Endocrinol. 2013, 187, 66–73. [Google Scholar] [CrossRef]
- Yan, P.; Jia, J.; Yang, G.; Wang, D.; Sun, C.; Li, W. Duplication of neuropeptide Y and peptide YY in Nile tilapia Oreochromis niloticus and their roles in food intake regulation. Peptides 2017, 88, 97–105. [Google Scholar] [CrossRef]
- Mokhtar, D.M.; Abdelhafez, E.A. An overview of the structural and functional aspects of immune cells in teleosts. Histol. Histopathol. 2021, 36, 399–414. [Google Scholar] [CrossRef]
- Sommer, F.; Backhed, F. The gut microbiota--masters of host development and physiology. Nat. Rev. Microbiol. 2013, 11, 227–238. [Google Scholar] [CrossRef]
- Press, C.M.; Evensen, O. The morphology of the immune system in teleost fishes. Fish Shellfish. Immunol. 1999, 9, 309–318. [Google Scholar] [CrossRef]
- Parra, D.; Korytar, T.; Takizawa, F.; Sunyer, J.O. B cells and their role in the teleost gut. Dev. Comp. Immunol. 2016, 64, 150–166. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.; Wang, Q.; Huang, Z.; Ding, L.; Xu, Z. Immunoglobulins, Mucosal Immunity and Vaccination in Teleost Fish. Front. Immunol. 2020, 11, 567941. [Google Scholar] [CrossRef]
- Zhang, Y.A.; Salinas, I.; Li, J.; Parra, D.; Bjork, S.; Xu, Z.; LaPatra, S.E.; Bartholomew, J.; Sunyer, J.O. IgT, a primitive immunoglobulin class specialized in mucosal immunity. Nat. Immunol. 2010, 11, 827–835. [Google Scholar] [CrossRef] [PubMed]
- Estensoro, I.; Calduch-Giner, J.A.; Kaushik, S.; Perez-Sanchez, J.; Sitja-Bobadilla, A. Modulation of the IgM gene expression and IgM immunoreactive cell distribution by the nutritional background in gilthead sea bream (Sparus aurata) challenged with Enteromyxum leei (Myxozoa). Fish Shellfish. Immunol. 2012, 33, 401–410. [Google Scholar] [CrossRef] [PubMed]
- Ballesteros, N.A.; Saint-Jean, S.S.; Encinas, P.A.; Perez-Prieto, S.I.; Coll, J.M. Oral immunization of rainbow trout to infectious pancreatic necrosis virus (Ipnv) induces different immune gene expression profiles in head kidney and pyloric ceca. Fish Shellfish. Immunol. 2012, 33, 174–185. [Google Scholar] [CrossRef]
- Chandrasekharan, B.; Nezami, B.G.; Srinivasan, S. Emerging neuropeptide targets in inflammation: NPY and VIP. Am. J. Physiol.-Gastrointest. Liver Physiol. 2013, 304, G949–G957. [Google Scholar] [CrossRef]
- Stasi, C.; Bellini, M.; Gambaccini, D.; Duranti, E.; de Bortoli, N.; Fani, B.; Albano, E.; Russo, S.; Sudano, I.; Laffi, G.; et al. Neuroendocrine Dysregulation in Irritable Bowel Syndrome Patients: A Pilot Study. J. Neurogastroenterol. Motil. 2017, 23, 428–434. [Google Scholar] [CrossRef]
- Reichmann, F.; Hassan, A.M.; Farzi, A.; Jain, P.; Schuligoi, R.; Holzer, P. Dextran sulfate sodium-induced colitis alters stress-associated behaviour and neuropeptide gene expression in the amygdala-hippocampus network of mice. Sci. Rep. 2015, 5, 9970. [Google Scholar] [CrossRef]
- Holzer, P.; Reichmann, F.; Farzi, A. Neuropeptide Y, peptide YY and pancreatic polypeptide in the gut-brain axis. Neuropeptides 2012, 46, 261–274. [Google Scholar] [CrossRef]
- Hassani, H.; Lucas, G.; Rozell, B.; Ernfors, P. Attenuation of acute experimental colitis by preventing NPY Y1 receptor signaling. Am. J. Physiol. Gastrointest. Liver Physiol. 2005, 288, G550–G556. [Google Scholar] [CrossRef]
- Wheway, J.; Mackay, C.R.; Newton, R.A.; Sainsbury, A.; Boey, D.; Herzog, H.; Mackay, F. A fundamental bimodal role for neuropeptide Y1 receptor in the immune system. J. Exp. Med. 2005, 202, 1527–1538. [Google Scholar] [CrossRef] [PubMed]
- Pang, X.H.; Li, T.K.; Xie, Q.; He, F.Q.; Cui, D.J.; Chen, Y.Q.; Huang, X.L.; Gan, H.T. Amelioration of dextran sulfate sodium-induced colitis by neuropeptide Y antisense oligodeoxynucleotide. Int. J. Color. Dis. 2010, 25, 1047–1053. [Google Scholar] [CrossRef]
- Chandrasekharan, B.; Jeppsson, S.; Pienkowski, S.; Belsham, D.D.; Sitaraman, S.V.; Merlin, D.; Kokkotou, E.; Nusrat, A.; Tansey, M.G.; Srinivasan, S. Tumor Necrosis Factor-Neuropeptide Y Cross Talk Regulates Inflammation, Epithelial Barrier Functions, and Colonic Motility. Inflamm. Bowel Dis. 2013, 19, 2535–2546. [Google Scholar] [CrossRef]
- Chandrasekharan, B.; Bala, V.; Kolachala, V.L.; Vijay-Kumar, M.; Jones, D.; Gewirtz, A.T.; Sitaraman, S.V.; Srinivasan, S. Targeted deletion of neuropeptide Y (NPY) modulates experimental colitis. PLoS ONE 2008, 3, e3304. [Google Scholar] [CrossRef] [PubMed]
- Pierre, J.F.; Peters, B.M.; La Torre, D.; Sidebottom, A.M.; Tao, Y.; Zhu, X.R.; Cham, C.M.; Wang, L.; Kambal, A.; Harris, K.G.; et al. Peptide YY: A Paneth cell antimicrobial peptide that maintains gut commensalism. Science 2023, 381, 502–508. [Google Scholar] [CrossRef]
- Yang, T.; Lai, K.; Yu, Y.; Liao, Z.; Cai, R.; Yu, X.; Li, W. Effects of neuropeptide Y on the immune-protection and intestinal tract of juvenile Micropterus salmoides. Gen. Comp. Endocrinol. 2024, 351, 114480. [Google Scholar] [CrossRef]
- Li, W.; Su, Y.L.; Mai, Y.Z.; Li, Y.W.; Mo, Z.Q.; Li, A.X. Comparative proteome analysis of two Streptococcus agalactiae strains from cultured tilapia with different virulence. Vet. Microbiol. 2014, 170, 135–143. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.W.; Liu, L.; Huang, P.R.; Fang, W.; Li, A.X. Chronic streptococcosis in Nile tilapia, Oreochromis niloticus (L.), caused by Streptococcus agalactiae. J. Fish Dis. 2014, 37, 757–763. [Google Scholar] [CrossRef]
- Yu, Y.; Li, R.; Yu, X.; Hu, Y.; Liao, Z.; Li, W. Immuno-protective effect of neuropeptide Y immersion on the juvenile tilapia infected by Streptococcus agalactiae. Fish Shellfish. Immunol. 2023, 141, 109072. [Google Scholar] [CrossRef]
- Ghia, J.E.; Blennerhassett, P.; Deng, Y.; Verdu, E.F.; Khan, W.I.; Collins, S.M. Reactivation of inflammatory bowel disease in a mouse model of depression. Gastroenterology 2009, 136, 2280–2288.e4. [Google Scholar] [CrossRef]
- Ferreira, R.; Santos, T.; Cortes, L.; Cochaud, S.; Agasse, F.; Silva, A.P.; Xapelli, S.; Malva, J.O. Neuropeptide Y inhibits interleukin-1 beta-induced microglia motility. J. Neurochem. 2012, 120, 93–105. [Google Scholar] [CrossRef]
- Bedoui, S.; von Horsten, S.; Gebhardt, T. A role for neuropeptide Y (NPY) in phagocytosis: Implications for innate and adaptive immunity. Peptides 2007, 28, 373–376. [Google Scholar] [CrossRef] [PubMed]
- Itano, J.; Taniguchi, A.; Senoo, S.; Asada, N.; Gion, Y.; Egusa, Y.; Guo, L.L.; Oda, N.; Araki, K.; Sato, Y.; et al. Neuropeptide Y Antagonizes Development of Pulmonary Fibrosis through IL-1β Inhibition. Am. J. Resp. Cell Mol. 2022, 67, 654–665. [Google Scholar] [CrossRef] [PubMed]
- Bedoui, S.; Kawamura, N.; Straub, R.H.; Pabst, R.; Yamamura, T.; von Horsten, S. Relevance of neuropeptide Y for the neuroimmune crosstalk. J. Neuroimmunol. 2003, 134, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Puerto, M.; Jos, A.; Pichardo, S.; Moyano, R.; Blanco, A.; Camean, A.M. Acute exposure to pure cylindrospermopsin results in oxidative stress and pathological alterations in tilapia (Oreochromis niloticus). Environ. Toxicol. 2014, 29, 371–385. [Google Scholar] [CrossRef]
- Molina, R.; Moreno, I.; Pichardo, S.; Jos, A.; Moyano, R.; Monterde, J.G.; Camean, A. Acid and alkaline phosphatase activities and pathological changes induced in Tilapia fish (Oreochromis sp.) exposed subchronically to microcystins from toxic cyanobacterial blooms under laboratory conditions. Toxicon 2005, 46, 725–735. [Google Scholar] [CrossRef]
- Shubin, A.V.; Demidyuk, I.V.; Komissarov, A.A.; Rafieva, L.M.; Kostrov, S.V. Cytoplasmic vacuolization in cell death and survival. Oncotarget 2016, 7, 55863–55889. [Google Scholar] [CrossRef]
- Zhou, Y.; Hu, X.; Zhong, S.; Yu, W.; Wang, J.; Zhu, W.; Yang, T.; Zhao, G.; Jiang, Y.; Li, Y. Effects of Continuous LPS Induction on Oxidative Stress and Liver Injury in Weaned Piglets. Vet. Sci. 2022, 10, 22. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Forrester, S.P.; Fan, J.; Liu, B.; Zhou, Q.; Miao, L.; Shao, P.; Li, X. Effects of M. oleifera leaf extract on the growth, physiological response and related immune gene expression of crucian carp fingerlings under Aeromonas hydrophila infection. Fish Shellfish. Immunol. 2022, 131, 358–367. [Google Scholar] [CrossRef] [PubMed]
- Zuwala-Jagiello, J.; Simon, K.; Kukla, M.; Murawska-Cialowicz, E.; Gorka-Dynysiewicz, J.; Grzebyk, E.; Pazgan-Simon, M. Increased circulating endocan in patients with cirrhosis: Relation to bacterial infection and severity of disease. J. Physiol. Pharmacol. 2017, 68, 273–282. [Google Scholar] [PubMed]
- Carpio, Y.; Leon, K.; Acosta, J.; Morales, R.; Estrada, M.P. Recombinant tilapia Neuropeptide Y promotes growth and antioxidant defenses in African catfish (Clarias gariepinus) fry. Aquaculture 2007, 272, 649–655. [Google Scholar] [CrossRef]








| Genes | Primer Sequence (5′-3′) | Accession Numbers | Tm | Product Size (bp) | Efficiency (%) |
|---|---|---|---|---|---|
| ef-1α F | ATCATTGATGCCCCTGGACA | NM_001279647.1 | 59 | 190 | 99.3 |
| ef-1α R | CTCCAACGATGAGCTGCTTC | NM_001279647.1 | 59 | 190 | 99.3 |
| pyyb F | GCCGTCAGGCACTATGTCAACC | XM_003438748.5 | 63 | 184 | 93.7 |
| pyyb R | GTGTTGGTAGTGCGGGATTGTG | XM_003438748.5 | 62 | 184 | 93.7 |
| y8b F | GCACAGCACCAATCACAACC | XM_025897149.1 | 60 | 235 | 99.6 |
| y8b R | GCACGTGAGAATGTCTGAGC | XM_025897149.1 | 59 | 235 | 99.6 |
| il-1β F | TGCACTGTCACTGACAGCCAA | XM_019365844.2 | 62 | 113 | 101.4 |
| il-1β R | ATGTTCAGGTGCACTTTGCGG | XM_019365844.2 | 62 | 113 | 101.4 |
| il-10 F | CTGCTAGATCAGTCCGTCGAA | XM_013269189.3 | 59 | 94 | 95.3 |
| il-10 R | GCAGAACCGTGTCCAGGTAA | XM_013269189.3 | 60 | 94 | 95.3 |
| tnf-α F | CTTCCCATAGACTCTGAGTAGCG | NM_001279533.1 | 60 | 161 | 98.2 |
| tnf-α R | GAGGCCAACAAAATCATCATCCC | NM_001279533.1 | 60 | 161 | 98.2 |
| ifn-γ F | CAACAACTCAGGCTCGCTAC | XM_001287402.1 | 59 | 167 | 102.5 |
| ifn-γ R | TGCTCTGAACGATGTGGTCA | XM_001287402.1 | 59 | 167 | 102.5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, Y.; Liu, Z.; Zhou, M.; Chen, Z.; Cai, R.; Song, C.; Li, M.; Zhu, T.; Sun, C.; Li, W. Neuropeptide Y Boosts Intestinal Mucosal Immunity of Tilapia Infected with Streptococcus agalactiae by Reducing Inflammation and Oxidative Stress. Animals 2025, 15, 2730. https://doi.org/10.3390/ani15182730
Yu Y, Liu Z, Zhou M, Chen Z, Cai R, Song C, Li M, Zhu T, Sun C, Li W. Neuropeptide Y Boosts Intestinal Mucosal Immunity of Tilapia Infected with Streptococcus agalactiae by Reducing Inflammation and Oxidative Stress. Animals. 2025; 15(18):2730. https://doi.org/10.3390/ani15182730
Chicago/Turabian StyleYu, Yang, Ziyan Liu, Mengyuan Zhou, Zexia Chen, Ran Cai, Chaowei Song, Meiqing Li, Tiansheng Zhu, Caiyun Sun, and Wensheng Li. 2025. "Neuropeptide Y Boosts Intestinal Mucosal Immunity of Tilapia Infected with Streptococcus agalactiae by Reducing Inflammation and Oxidative Stress" Animals 15, no. 18: 2730. https://doi.org/10.3390/ani15182730
APA StyleYu, Y., Liu, Z., Zhou, M., Chen, Z., Cai, R., Song, C., Li, M., Zhu, T., Sun, C., & Li, W. (2025). Neuropeptide Y Boosts Intestinal Mucosal Immunity of Tilapia Infected with Streptococcus agalactiae by Reducing Inflammation and Oxidative Stress. Animals, 15(18), 2730. https://doi.org/10.3390/ani15182730

