Transcriptomic Analysis Reveals the Growth Regulatory Mechanisms in Diploid, Triploid, and Tetraploid Pacific Oyster (Crassostrea gigas)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Materials and Sample Collection
2.2. Ploidy Verification and Measurement of Phenotypic Traits
2.3. Total RNA Extraction, cDNA Library Construction and Sequencing
2.4. Data Processing and Analysis
2.5. Analysis of DEGs
2.6. qRT-PCR Verification
3. Results
3.1. Ploidy Analysis and Phenotypic Traits
3.2. Assembly of Sequencing Data
3.3. DEGs Expression
3.4. Functional Annotation and Enrichment Analysis of DEGs
3.5. Expression Trend Profiling
3.6. Validation of RNA-Seq by qRT-PCR
4. Discussion
4.1. Trend Analysis Among Different Ploidy Levels
4.2. Innate Immune Response in Tetraploid C. gigas
4.3. Sterility Environmental Adaptability, and Enhanced Growth Mechanisms in Triploid C. gigas
4.3.1. Effects of Steroid Hormone Biosynthesis on Sterility in Triploid C. gigas
4.3.2. Effects of Taurine and Hypotaurine Metabolism on Environmental Adaptability in Triploid C. gigas
4.3.3. Effects of the Bone Morphogenetic Protein (BMP) Gene Family on Growth in Triploid C. gigas
4.4. Limitations and Future Perspectives
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- O’Carroll, J.P.J.; Quinn, C.; Forde, J.; Patterson, A.; O’Beirn, F.X.; Kennedy, R. Impact of prolonged storm activity on the Ecological Status of intertidal benthic habitats within oyster (Crassostrea gigas) trestle cultivation sites. Mar. Pollut. Bull. 2016, 110, 460–469. [Google Scholar] [CrossRef]
- Tan, C.; Shi, C.; Li, Y.; Teng, W.; Li, Y.; Fu, H.; Ren, L.; Yu, H.; Li, Q.; Liu, S. Comparative Methylome Analysis Reveals Epigenetic Signatures Associated with Growth and Shell Color in the Pacific Oyster, Crassostrea gigas. Mar. Biotechnol. 2022, 24, 911–926. [Google Scholar] [CrossRef] [PubMed]
- Nell, J.A. Farming triploid oysters. Aquaculture 2002, 210, 69–88. [Google Scholar] [CrossRef]
- Julien, N.; Ernande, B.; Haure, J.; McCombie, H.; Boudry, P. Reproductive effort and growth in Crassostrea gigas: Comparison of young diploid and triploid oysters issued from natural crosses or chemical induction. Aquat. Biol. 2009, 7, 229–241. [Google Scholar] [CrossRef]
- Piferrer, F.; Beaumont, A.; Falguière, J.-C.; Flajšhans, M.; Haffray, P.; Colombo, L. Polyploid fish and shellfish: Production, biology and applications to aquaculture for performance improvement and genetic containment. Aquaculture 2009, 293, 125–156. [Google Scholar] [CrossRef]
- Dégremont, L.; Garcia, C.; Frank-Lawale, A.; Allen, S. Triploid Oysters in the Chesapeake Bay: Comparison of Diploid and Triploid Crassostrea virginica. J. Shellfish Res. 2012, 31, 21–31. [Google Scholar] [CrossRef]
- Yu, Q.; Chu, L.; Li, Y.; Wang, Q.; Zhu, J.; Wang, C.; Cui, S. miR-23a/b suppress cGAS-mediated innate and autoimmunity. Cell. Mol. Immunol. 2021, 18, 1235–1248. [Google Scholar] [CrossRef]
- Guo, X.; Allen, S. Viable tetraploid Pacific oyster (Crassostrea gigas Thunburg) produced by inhibiting polar body I in eggs of triploids. Mol. Mar. Biol. Biotechnol. 1994, 3, 42–50. [Google Scholar]
- Guo, X.; DeBrosse, G.A.; Allen, S.K. All-triploid Pacific oysters (Crassostrea gigas Thunberg) produced by mating tetraploids and diploids. Aquaculture 1996, 142, 149–161. [Google Scholar] [CrossRef]
- Achouri, A.; Melizi, M.; Belbedj, H.; Azizi, A. Comparative study of histological and histo-chemical image processing in muscle fiber sections of broiler chicken. J. Appl. Poult. Res. 2021, 30, 100173. [Google Scholar] [CrossRef]
- Matt, J.L.; Allen, S.K. Heteroploid mosaic tetraploids of Crassostrea virginica produce normal triploid larvae and juveniles as revealed by flow cytometry. Aquaculture 2014, 432, 336–345. [Google Scholar] [CrossRef]
- Wadsworth, P.; Wilson, A.E.; Walton, W.C. A meta-analysis of growth rate in diploid and triploid oysters. Aquaculture 2019, 499, 9–16. [Google Scholar] [CrossRef]
- Walton, W.C.; Rikard, F.S.; Chaplin, G.I.; Davis, J.E.; Arias, C.R.; Supan, J.E. Effects of ploidy and gear on the performance of cultured oysters, Crassostrea virginica: Survival, growth, shape, condition index and Vibrio abundances. Aquaculture 2013, 414–415, 260–266. [Google Scholar] [CrossRef]
- Garnier-Géré, P.H.; Naciri-Graven, Y.; Bougrier, S.; Magoulas, A.; Héral, M.; Kotoulas, G.; Hawkins, A.; Gérard, A. Influences of triploidy, parentage and genetic diversity on growth of the Pacific oyster Crassostrea gigas reared in contrasting natural environments. Mol. Ecol. 2002, 11, 1499–1514. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Qin, Y.; Yu, Z. Comparative study of tetraploid-based reciprocal triploid Portuguese oysters, Crassostrea angulata, from seed to marketsize. Aquaculture 2022, 547, 737523. [Google Scholar] [CrossRef]
- Liang, Y.; Hu, H.; Cheng, G.; Xu, C.; Li, Q. Growth, survival and thermotolerance of diploids, triploids and tetraploids of the Fujian oyster Crassostrea angulata with normal, golden and black shell colors. Aquaculture 2024, 591, 741131. [Google Scholar] [CrossRef]
- Wang, Z.; Guo, X.; Allen, S.K.; Wang, R. Heterozygosity and body size in triploid Pacific oysters, Crassostrea gigas Thunberg, produced from meiosis II inhibition and tetraploids. Aquaculture 2002, 204, 337–348. [Google Scholar] [CrossRef]
- Stanley, J.G.; Hidu, H.; Allen, S.K. Growth of American oysters increased by polyploidy induced by blocking meiosis I but not meiosis II. Aquaculture 1984, 37, 147–155. [Google Scholar] [CrossRef]
- McCombie, H.; Ledu, C.; Phelipot, P.; Lapègue, S.; Boudry, P.; Gérard, A. A Complementary Method for Production of Tetraploid Crassostrea gigas Using Crosses Between Diploids and Tetraploids with Cytochalasin B Treatments. Mar. Biotechnol. 2005, 7, 318–330. [Google Scholar] [CrossRef]
- Dégremont, L.; Garcia, C.; Allen, S.K. Genetic improvement for disease resistance in oysters: A review. J. Invertebr. Pathol. 2015, 131, 226–241. [Google Scholar] [CrossRef]
- Jeung, H.-D.; Keshavmurthy, S.; Lim, H.-J.; Kim, S.-K.; Choi, K.-S. Quantification of reproductive effort of the triploid Pacific oyster, Crassostrea gigas raised in intertidal rack and bag oyster culture system off the west coast of Korea during spawning season. Aquaculture 2016, 464, 374–380. [Google Scholar] [CrossRef]
- Li, Y.; Qin, J.G.; Abbott, C.A.; Li, X.; Benkendorff, K. Synergistic impacts of heat shock and spawning on the physiology and immune health of Crassostrea gigas: An explanation for summer mortality in Pacific oysters. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 2007, 293, R2353–R2362. [Google Scholar] [CrossRef]
- Li, Y.; Qin, J.G.; Li, X.; Benkendorff, K. Monthly variation of condition index, energy reserves and antibacterial activity in Pacific oysters, Crassostrea gigas, in Stansbury (South Australia). Aquaculture 2009, 286, 64–71. [Google Scholar] [CrossRef]
- Leitch, A.R.; Leitch, I.J. Genome evolution: On the nature of trade-offs with polyploidy and endopolyploidy. Curr. Biol. 2022, 32, R952–R954. [Google Scholar] [CrossRef]
- Pacey, E.K.; Maherali, H.; Husband, B.C. Polyploidy increases storage but decreases structural stability in Arabidopsis thaliana. Curr. Biol. 2022, 32, 4057–4063.e4053. [Google Scholar] [CrossRef] [PubMed]
- Ni, J.; Zeng, Z.; Ke, C. Sex steroid levels and expression patterns of estrogen receptor gene in the oyster Crassostrea angulata during reproductive cycle. Aquaculture 2013, 376–379, 105–116. [Google Scholar] [CrossRef]
- Dheilly, N.M.; Jouaux, A.; Boudry, P.; Favrel, P.; Lelong, C. Transcriptomic profiling of gametogenesis in triploid Pacific Oysters Crassostrea gigas: Towards an understanding of partial sterility associated with triploidy. PLoS ONE 2014, 9, e112094. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Bao, X.; Liu, X.; Wang, Y.; Zhu, X.; Zhang, Y.; Wang, Z.; Maslennikov, S.; Whiteside, M.; Wang, W.; et al. Transcriptome analysis provides preliminary insights into the response of Sepia esculenta to high salinity stress. Agric. Commun. 2024, 2, 100064. [Google Scholar] [CrossRef]
- Zhao, Y.; Chang, D.; Zheng, Y.; Zhang, Y.; Wang, Y.; Bao, X.; Sun, G.; Feng, Y.; Li, Z.; Liu, X.; et al. Comparative transcriptome analysis reveals differences in immune responses to copper ions in Sepia esculenta under high-temperature conditions. BMC Genom. 2025, 26, 262. [Google Scholar] [CrossRef]
- Dong, L.; Sun, Y.; Chu, M.; Xie, Y.; Wang, P.; Li, B.; Li, Z.; Xu, X.; Feng, Y.; Sun, G.; et al. Exploration of Response Mechanisms in the Gills of Pacific Oyster (Crassostrea gigas) to Cadmium Exposure through Integrative Metabolomic and Transcriptomic Analyses. Animals 2024, 14, 2318. [Google Scholar] [CrossRef]
- Liu, X.; Wang, W.; Zhao, H.; Wang, Y.; Jiang, L.; Zhang, E.; Feng, Y.; Wang, X.; Qu, J.; Yang, J.; et al. Transcriptome profiling of triploid Crassostrea gigas gills indicates the host immune mechanism against bacterial infection. Comp. Biochem. Physiol. Part D Genom. Proteom. 2025, 54, 101392. [Google Scholar] [CrossRef]
- Dong, L.; Li, Z.; Wang, W.; Meng, Y.; Zhang, E.; Cui, X.; Xu, X.; Feng, Y.; Sun, G.; Wang, Z.; et al. Transcriptome analysis reveals polyploidy-related differential gene expression among diploid, triploid, and tetraploid Pacific oysters (Crassostrea gigas) based on growth-related phenotypes. Aquaculture 2024, 587, 740859. [Google Scholar] [CrossRef]
- Wang, X.; Wang, L.; Zhang, H.; Ji, Q.; Song, L.; Qiu, L.; Zhou, Z.; Wang, M.; Wang, L. Immune response and energy metabolism of Chlamys farreri under Vibrio anguillarum challenge and high temperature exposure. Fish Shellfish Immunol. 2012, 33, 1016–1026. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Song, X.; Song, L. The oyster immunity. Dev. Comp. Immunol. 2018, 80, 99–118. [Google Scholar] [CrossRef] [PubMed]
- Batista, C.R.; Figueiredo, M.A.; Almeida, D.V.; Romano, L.A.; Marins, L.F. Impairment of the immune system in GH-overexpressing transgenic zebrafish (Danio rerio). Fish Shellfish Immunol. 2014, 36, 519–524. [Google Scholar] [CrossRef]
- Xia, H.-X.; Li, Q.; Cushman, S.A.; Yuan, W.-J.; Li, Y. Expression dosage effects of a small number of genes after the artificial doubling of weeping forsythia. Plant Physiol. Biochem. 2023, 202, 107945. [Google Scholar] [CrossRef]
- Shi, X.; Chen, C.; Yang, H.; Hou, J.; Ji, T.; Cheng, J.; Veitia, R.A.; Birchler, J.A. The Gene Balance Hypothesis: Epigenetics and Dosage Effects in Plants. In Plant Epigenetics and Epigenomics: Methods and Protocols; Spillane, C., McKeown, P., Eds.; Springer: New York, NY, USA, 2020; pp. 161–171. [Google Scholar] [CrossRef]
- Zhou, C.; Liu, X.; Li, X.; Zhou, H.; Wang, S.; Yuan, Z.; Zhang, Y.; Li, S.; You, A.; Zhou, L.; et al. A Genome Doubling Event Reshapes Rice Morphology and Products by Modulating Chromatin Signatures and Gene Expression Profiling. Rice 2021, 14, 72. [Google Scholar] [CrossRef]
- Doyle, J.J.; Coate, J.E. Autopolyploidy: An epigenetic macromutation. Am. J. Bot. 2020, 107, 1097–1100. [Google Scholar] [CrossRef]
- Kivanc, D.; Dasdemir, S. The relationship between defects in DNA repair genes and autoinflammatory diseases. Rheumatol. Int. 2022, 42, 1–13. [Google Scholar] [CrossRef]
- Wang, Y.; Yuan, S.; Jia, X.; Ge, Y.; Ling, T.; Nie, M.; Lan, X.; Chen, S.; Xu, A. Mitochondria-localised ZNFX1 functions as a dsRNA sensor to initiate antiviral responses through MAVS. Nat. Cell Biol. 2019, 21, 1346–1356. [Google Scholar] [CrossRef]
- Cheng, L.Y.; Parker, R. ZNFX1: A multifunctional modulator of the innate immune response. Front. Immunol. 2025, 16, 1564628. [Google Scholar] [CrossRef]
- Iwasaki, A. A Virological View of Innate Immune Recognition. Annu. Rev. Microbiol. 2012, 66, 177–196. [Google Scholar] [CrossRef] [PubMed]
- Da, G.; Wang, J.; Shang, J.; Xun, C.; Yu, Y.; Wang, Y.; Tie, N.; Li, H. Nuclear PCGF3 inhibits the antiviral immune response by suppressing the interferon-stimulated gene. Cell Death Discov. 2024, 10, 429. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Zhang, H.; Qiu, Z.; Wang, S.; Wang, C.; Cheng, H.; Wan, Q.; Pan, M. SESN1 negatively regulates STING1 to maintain innate immune homeostasis. Autophagy 2025, 21, 1245–1262. [Google Scholar] [CrossRef] [PubMed]
- Bayly-Jones, C.; Pang, S.S.; Spicer, B.A.; Whisstock, J.C.; Dunstone, M.A. Ancient but Not Forgotten: New Insights Into MPEG1, a Macrophage Perforin-Like Immune Effector. Front Immunol. 2020, 11, 581906. [Google Scholar] [CrossRef]
- Ni, T.; Jiao, F.; Yu, X.; Aden, S.; Ginger, L.; Williams, S.I.; Bai, F.; Pražák, V.; Karia, D.; Stansfeld, P.; et al. Structure and mechanism of bactericidal mammalian perforin-2, an ancient agent of innate immunity. Sci. Adv. 2020, 6, eaax8286. [Google Scholar] [CrossRef]
- McCormack, R.M.; de Armas, L.R.; Shiratsuchi, M.; Fiorentino, D.G.; Olsson, M.L.; Lichtenheld, M.G.; Morales, A.; Lyapichev, K.; Gonzalez, L.E.; Strbo, N.; et al. Perforin-2 is essential for intracellular defense of parenchymal cells and phagocytes against pathogenic bacteria. eLife 2015, 4, e06508. [Google Scholar] [CrossRef]
- He, X.; Zhang, Y.; Yu, Z. An Mpeg (macrophage expressed gene) from the Pacific oyster Crassostrea gigas: Molecular characterization and gene expression. Fish Shellfish Immunol. 2011, 30, 870–876. [Google Scholar] [CrossRef]
- Wang, K.-J.; Ren, H.-L.; Xu, D.-D.; Cai, L.; Yang, M. Identification of the up-regulated expression genes in hemocytes of variously colored abalone (Haliotis diversicolor Reeve, 1846) challenged with bacteria. Dev. Comp. Immunol. 2008, 32, 1326–1347. [Google Scholar] [CrossRef]
- Li, J.; Wan, S.J.; Metruccio, M.M.E.; Ma, S.; Nazmi, K.; Bikker, F.J.; Evans, D.J.; Fleiszig, S.M.J. DMBT1 inhibition of Pseudomonas aeruginosa twitching motility involves its N-glycosylation and cannot be conferred by the Scavenger Receptor Cysteine-Rich bacteria-binding peptide domain. Sci. Rep. 2019, 9, 13146. [Google Scholar] [CrossRef]
- Polley, S.; Prescott, N.; Nimmo, E.; Veal, C.; Vind, I.; Munkholm, P.; Fode, P.; Mansfield, J.; Skyt Andersen, P.; Satsangi, J.; et al. Copy number variation of scavenger-receptor cysteine-rich domains within DMBT1 and Crohn’s disease. Eur. J. Hum. Genet. 2016, 24, 1294–1300. [Google Scholar] [CrossRef] [PubMed]
- Katsu, Y.; Bermudez, D.S.; Braun, E.L.; Helbing, C.; Miyagawa, S.; Gunderson, M.P.; Kohno, S.; Bryan, T.A.; Guillette, L.J.; Iguchi, T. Molecular cloning of the estrogen and progesterone receptors of the American alligator. Gen. Comp. Endocrinol. 2004, 136, 122–133. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.-Y.; Wang, D.-S.; Kobayashi, T.; Yano, A.; Paul-Prasanth, B.; Suzuki, A.; Sakai, F.; Nagahama, Y. A Novel Type of P450c17 Lacking the Lyase Activity Is Responsible for C21-Steroid Biosynthesis in the Fish Ovary and Head Kidney. Endocrinology 2007, 148, 4282–4291. [Google Scholar] [CrossRef] [PubMed]
- Zhai, G.; Shu, T.; Xia, Y.; Lu, Y.; Shang, G.; Jin, X.; He, J.; Nie, P.; Yin, Z. Characterization of Sexual Trait Development in cyp17a1-Deficient Zebrafish. Endocrinology 2018, 159, 3549–3562. [Google Scholar] [CrossRef]
- Zhai, G.; Shu, T.; Chen, K.; Lou, Q.; Jia, J.; Huang, J.; Shi, C.; Jin, X.; He, J.; Jiang, D.; et al. Successful Production of an All-Female Common Carp (Cyprinus carpio L.) Population Using cyp17a1-Deficient Neomale Carp. Engineering 2022, 8, 181–189. [Google Scholar] [CrossRef]
- Lundqvist, J.; Norlin, M. Effects of CYP7B1-related steroids on androgen receptor activation in different cell lines. Biochim. Biophys. Acta (BBA) Mol. Cell Biol. Lipids 2012, 1821, 973–979. [Google Scholar] [CrossRef]
- Pettersson, H.; Lundqvist, J.; Oliw, E.; Norlin, M. CYP7B1-mediated metabolism of 5α-androstane-3α,17β-diol (3α-Adiol): A novel pathway for potential regulation of the cellular levels of androgens and neurosteroids. Biochim. Biophys. Acta (BBA) Mol. Cell Biol. Lipids 2009, 1791, 1206–1215. [Google Scholar] [CrossRef]
- Xiao, L.; Wang, D.; Guo, Y.; Tang, Z.; Liu, Q.; Li, S.; Zhang, Y.; Lin, H. Comparative transcriptome analysis of diploid and triploid hybrid groupers (Epinephelus coioides♀ × E. lanceolatus♂) reveals the mechanism of abnormal gonadal development in triploid hybrids. Genomics 2019, 111, 251–259. [Google Scholar] [CrossRef]
- Murata, Y.; Touhata, K.; Miwa, R. Correlation of extractive components and body index with taste in oyster Crassostrea gigas brands. Fish. Sci. 2020, 86, 561–572. [Google Scholar] [CrossRef]
- Tochitani, S. Taurine: A Maternally Derived Nutrient Linking Mother and Offspring. Metabolites 2022, 12, 228. [Google Scholar] [CrossRef]
- Sokolov, E.P.; Sokolova, I.M. Compatible osmolytes modulate mitochondrial function in a marine osmoconformer Crassostrea gigas (Thunberg, 1793). Mitochondrion 2019, 45, 29–37. [Google Scholar] [CrossRef]
- Sun, D.; Yu, H.; Li, Q. Examination of the role of CgSox-like in sex determination and gonadal development in the Pacific oyster Crassostrea gigas. Aquaculture 2023, 566, 739234. [Google Scholar] [CrossRef]
- Sun, Y.; Du, X.; Yang, Y.; Wang, A.; Gu, Z.; Liu, C. Dietary Taurine Intake Affects the Growth Performance, Lipid Composition, and Antioxidant Defense of Juvenile Ivory Shell (Babylonia areolata). Animals 2023, 13, 2592. [Google Scholar] [CrossRef] [PubMed]
- Takagi, S.; Murata, H.; Goto, T.; Ichiki, T.; Endo, M.; Hatate, H.; Yoshida, T.; Sakai, T.; Yamashita, H.; Ukawa, M. Efficacy of taurine supplementation for preventing green liver syndrome and improving growth performance in yearling red sea bream Pagrus major fed low-fishmeal diet. Fish. Sci. 2006, 72, 1191–1199. [Google Scholar] [CrossRef]
- Takagi, S.; Murata, H.; Goto, T.; Hatate, H.; Endo, M.; Yamashita, H.; Miyatake, H.; Ukawa, M. Role of taurine deficiency in inducing green liver symptom and effect of dietary taurine supplementation in improving growth in juvenile red sea bream Pagrus major fed non-fishmeal diets based on soy protein concentrate. Fish. Sci. 2011, 77, 235–244. [Google Scholar] [CrossRef]
- Luo, W.; Qu, F.; Song, P.; Xiong, D.; Yin, Y.; Li, J.; Liu, Z. Molecular characterization and taurine regulation of two novel CDOs (CDO1 and CDO2) from Carassius auratus. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2019, 235, 54–61. [Google Scholar] [CrossRef]
- Miyazaki, T. Identification of a novel enzyme and the regulation of key enzymes in mammalian taurine synthesis. J. Pharmacol. Sci. 2024, 154, 9–17. [Google Scholar] [CrossRef]
- Urist, M.R. Bone: Formation by autoinduction. Science 1965, 150, 893–899. [Google Scholar] [CrossRef]
- Ali, S.; Rehman, M.U.; Yatoo, A.M.; Arafah, A.; Khan, A.; Rashid, S.; Majid, S.; Ali, A.; Ali, M.N. TGF-β signaling pathway: Therapeutic targeting and potential for anti-cancer immunity. Eur. J. Pharmacol. 2023, 947, 175678. [Google Scholar] [CrossRef]
- Jia, S.; Dai, F.; Wu, D.; Lin, X.; Xing, C.; Xue, Y.; Wang, Y.; Xiao, M.; Wu, W.; Feng, X.H.; et al. Protein phosphatase 4 cooperates with Smads to promote BMP signaling in dorsoventral patterning of zebrafish embryos. Dev. Cell 2012, 22, 1065–1078. [Google Scholar] [CrossRef][Green Version]
- Ducy, P.; Karsenty, G. The family of bone morphogenetic proteins. Kidney Int. 2000, 57, 2207–2214. [Google Scholar] [CrossRef]
- Yan, F.; Luo, S.; Jiao, Y.; Deng, Y.; Du, X.; Huang, R.; Wang, Q.; Chen, W. Molecular Characterization of the BMP7 Gene and Its Potential Role in Shell Formation in Pinctada martensii. Int. J. Mol. Sci. 2014, 15, 21215–21228. [Google Scholar] [CrossRef]
- Fan, S.; Daizhi, Z.; Youhou, X.; Yu, D. Cloning and functional analysis of BMP3 in the pearl oyster (Pinctada fucata). J. Appl. Anim. Res. 2019, 47, 250–261. [Google Scholar] [CrossRef]
- Yao, L.; Liu, Y.; Li, L.; Jiang, X. Contribution of the TGFβ signaling pathway to growth of Pacific oyster (Crassostrea gigas). Aquaculture 2024, 590, 740983. [Google Scholar] [CrossRef]
- Jouaux, A.; Heude-Berthelin, C.; Sourdaine, P.; Mathieu, M.; Kellner, K. Gametogenic stages in triploid oysters Crassostrea gigas: Irregular locking of gonial proliferation and subsequent reproductive effort. J. Exp. Mar. Biol. Ecol. 2010, 395, 162–170. [Google Scholar] [CrossRef]








| Gene Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| EF-1α | AGTCACCAAGGCTGCACAGAAAG | TCCGACGTATTTCTTTGCGATGT |
| BMP3 | GGCACAAAGCGAAAGCGGAAAC | GCCAAGTGTTCGGGACCTCATG |
| BMP7 | CCGAAGCCGAAATCTAGCACCAC | CCACGCTGTCGCCTACTGTAAC |
| PDHA1 | CGAGAGTACGCCCTGAACAATGG | ACGGTGATTGGGTCCCTGGTC |
| IDH3A | CTGCTGCTCAGTGCGGTCATG | AGACGAGCCTCCTAAGTCACCAG |
| IDH3B | GTCTTCCAAGCCGCAGGAGTTC | CTGGCTGGGCGTGCTGATAATG |
| PCK1 | TGCTCCTATGGAAGCGGATACGG | CAAGCCAGCCCTCTCTCCTACC |
| GADD45A | GCTGGAGAACAAGTCGGACGATG | GGTCGGTGTGAGAGGACAGGATC |
| GADD45G | CAAGGAGCCTGTGTTGGTAAGCC | GCCATGCACCGACGACTCTG |
| CHIT1 | GGCGTCAGAGTCGGGCATTTC | TGTGGGTGGTGGGTAAGGAGAC |
| CHIA | CAACGGACTGGATGCGAGGAATG | TCCACCCACCCACAGCCAATAG |
| CYP17A1 | GGAAGAAGACGAGCTGCCGAATC | GGGGAAACCGACAGGAAGTATGC |
| CYP7B1 | GTACCCACCAGCAATCCACAAGG | ACGTGGCATCAACGAACCTGTC |
| Sample | 2N | 3N | 4N |
|---|---|---|---|
| Clean reads | 43,355,229 | 45,147,518 | 44,476,049 |
| Raw reads | 44,128,517 | 45,834,319 | 45,245,143 |
| Mapped reads | 35,513,324 | 37,335,903 | 36,124,735 |
| Mapping rate (%) | 81.92 | 82.69 | 81.20 |
| Uniquely mapped reads | 33,510,189 | 35,367,460 | 34,060,315 |
| Uniquely mapped rate (%) | 77.30 | 78.34 | 76.57 |
| G/C content (%) | 44.51 | 44.53 | 44.47 |
| % ≥ Q20 | 97.41 | 97.46 | 97.44 |
| % ≥ Q30 | 92.88 | 92.98 | 92.94 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Meng, Y.; Zhang, Y.; Wang, W.; Zhao, Y.; Qiu, D.; Li, Z.; Sun, G.; Cui, C.; Wang, Q.; Liu, Z.; et al. Transcriptomic Analysis Reveals the Growth Regulatory Mechanisms in Diploid, Triploid, and Tetraploid Pacific Oyster (Crassostrea gigas). Animals 2025, 15, 2691. https://doi.org/10.3390/ani15182691
Meng Y, Zhang Y, Wang W, Zhao Y, Qiu D, Li Z, Sun G, Cui C, Wang Q, Liu Z, et al. Transcriptomic Analysis Reveals the Growth Regulatory Mechanisms in Diploid, Triploid, and Tetraploid Pacific Oyster (Crassostrea gigas). Animals. 2025; 15(18):2691. https://doi.org/10.3390/ani15182691
Chicago/Turabian StyleMeng, Yuting, Yousen Zhang, Weijun Wang, Yancheng Zhao, Daowen Qiu, Zan Li, Guohua Sun, Cuiju Cui, Qiang Wang, Zhongyi Liu, and et al. 2025. "Transcriptomic Analysis Reveals the Growth Regulatory Mechanisms in Diploid, Triploid, and Tetraploid Pacific Oyster (Crassostrea gigas)" Animals 15, no. 18: 2691. https://doi.org/10.3390/ani15182691
APA StyleMeng, Y., Zhang, Y., Wang, W., Zhao, Y., Qiu, D., Li, Z., Sun, G., Cui, C., Wang, Q., Liu, Z., & Yang, J. (2025). Transcriptomic Analysis Reveals the Growth Regulatory Mechanisms in Diploid, Triploid, and Tetraploid Pacific Oyster (Crassostrea gigas). Animals, 15(18), 2691. https://doi.org/10.3390/ani15182691

