Effects of Low-Protein Amino Acid-Balanced Diets and Astragalus Polysaccharides on Production Performance, Antioxidants, Immunity, and Lipid Metabolism in Heat-Stressed Laying Hens
Simple Summary
Abstract
1. Introduction
2. Material and Methods
2.1. Experimental Design and Diets
2.2. Animals and Sample Collection
2.3. Measurement of Serum Hormone, Antioxidant, Immunoglobulin, Inflammatory and Biochemical Indicators
2.4. Expression of Gonadotropin-Releasing Hormone mRNA in the Liver and Ovaries
2.5. Statistical Analysis
3. Results
3.1. Production Performance and Follicle Development
3.2. Egg Quality and Egg Components
3.3. Serum Hormone Indicators and Relevant Gene Expression in the Ovary
3.4. Serum Antioxidant Index and Relevant Gene Expression in the Liver
3.5. Serum Immunoglobulin, Inflammatory Cytokine Indicators and Relevant Gene Expression in the Liver
3.6. Serum Biochemical Indicators and Relevant Gene Expression in the Liver
4. Discussion
4.1. Production Performance, Follicle Development, Serum Hormone and Related Gene Expression in the Ovary
4.2. Effects of Astragalus Polysaccharides in Low-Protein Diet on Egg Quality
4.3. Serum Antioxidant and Relevant Gene Expression in the Liver
4.4. Serum Immunoglobulin, Inflammatory Cytokines and Relevant Gene Expression in the Liver
4.5. Serum Biochemical and Relevant Gene Expression in the Liver
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tučková, K.; Filipčík, R. Effect of Heat Stress on Age in Conception of Holstein Heifers. Acta. Univ. Agric. Silvic. Mendel. Brun. 2019, 67, 173–177. [Google Scholar] [CrossRef] [Scilit]
- Barrett, N.W.; Rowland, K.; Schmidt, C.J.; Lamont, S.J.; Rothschild, M.F.; Ashwell, C.M.; Persia, M.E. Effects of Acute and Chronic Heat Stress on the Performance, Egg Quality, Body Temperature, and Blood Gas Parameters of Laying Hens. Poult. Sci. 2019, 98, 6684–6692. [Google Scholar] [CrossRef] [Scilit]
- Fatima, N.; Ahmad, M.; Usman, M.; Haider, U.; Raza Farhan, M.H.; Iftikhar, E.; Hassan, S.U.; Narayan, E. Role of Feed Additives in Mitigating the Impact of Heat Stress on Poultry Gut Health and Productivity. World’s Poult. Sci. J. 2024, 80, 1055–1075. [Google Scholar] [CrossRef] [Scilit]
- Vandana, G.D.; Sejian, V.; Lees, A.M.; Pragna, P.; Silpa, M.V.; Maloney, S.K. Heat Stress and Poultry Production: Impact and Amelioration. Int. J. Biometeorol. 2021, 65, 163–179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ezzat, W.; Mahrose, K.M.; Rizk, A.M.; Ouda, M.M.M.; Fathey, I.A.; Othman, S.I.; Allam, A.A.; Rudayni, H.A.; Almasmoum, H.A.; Taha, A.E.; et al. Impact of β-Glucan Dietary Supplementation on Productive, Reproductive Performance and Physiological Response of Laying Hens under Heat Stress Conditions. Poult. Sci. 2024, 103, 103183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saleh, A.A.; Eltantawy, M.S.; Gawish, E.M.; Younis, H.H.; Amber, K.A.; Abd El-Moneim, A.E.-M.E.; Ebeid, T.A. Impact of Dietary Organic Mineral Supplementation on Reproductive Performance, Egg Quality Characteristics, Lipid Oxidation, Ovarian Follicular Development, and Immune Response in Laying Hens Under High Ambient Temperature. Biol. Trace Elem. Res. 2020, 195, 506–514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, J.S.; Maskal, J.M.; Duttlinger, A.W.; Kpodo, K.R.; McConn, B.R.; Byrd, C.J.; Richert, B.T.; Marchant-Forde, J.N.; Lay, D.C.; Perry, S.D.; et al. In Utero Heat Stress Alters the Postnatal Innate Immune Response of Pigs. J. Anim. Sci. 2020, 98, skaa356. [Google Scholar] [CrossRef] [Scilit]
- Siddiqui, S.H.; Kang, D.; Park, J.; Khan, M.; Belal, S.A.; Shin, D.; Shim, K. Altered Relationship between Gluconeogenesis and Immunity in Broilers Exposed to Heat Stress for Different Durations. Poult. Sci. 2021, 100, 101274. [Google Scholar] [CrossRef] [Scilit]
- Benyelloul, K.; Seddik, L.; Bouhadda, Y.; Bououdina, M.; Aourag, H.; Khodja, K. Effect of Pressure on Structural, Elastic and Mechanical Properties of Transition Metal Hydrides Mg7TMH16 (TM = Sc, Ti, V, Y, Zr and Nb): First-Principles Investigation. J. Phys. Chem. Solids 2017, 111, 229–237. [Google Scholar] [CrossRef] [Scilit]
- Teyssier, J.-R.; Brugaletta, G.; Sirri, F.; Dridi, S.; Rochell, S.J. A Review of Heat Stress in Chickens. Part II: Insights into Protein and Energy Utilization and Feeding. Front. Physiol. 2022, 13, 943612. [Google Scholar] [CrossRef] [Scilit]
- Torki, M.; Mohebbifar, A.; Ghasemi, H.A.; Zardast, A. Response of Laying Hens to Feeding Low-Protein Amino Acid-Supplemented Diets under High Ambient Temperature: Performance, Egg Quality, Leukocyte Profile, Blood Lipids, and Excreta pH. Int. J. Biometeorol. 2015, 59, 575–584. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Wang, D.; Zhao, L.; Zhang, J.; Huang, S.; Ma, Q. Effect of Methionine Deficiency on the Growth Performance, Serum Amino Acids Concentrations, Gut Microbiota and Subsequent Laying Performance of Layer Chicks. Front. Vet. Sci. 2022, 9, 878107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poosuwan, K.; Bunchasak, C.; Kaewtapee, C. Long-Term Feeding Effects of Dietary Protein Levels on Egg Production, Immunocompetence and Plasma Amino Acids of Laying Hens in Subtropical Condition. J. Anim. Physiol. Anim. Nutr. 2010, 94, 186–195. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.-Y.; Wang, R.-C.; Qu, Z.-Y.; Zhu, Y.-Z.; Li, Y.-L. Advances on Immunoregulation Effect of Astragalus Polysaccharides. Front. Nat. Prod. 2022, 1, 971679. [Google Scholar] [CrossRef] [Scilit]
- Lu, Y.; Wu, Y.; Sun, L.; Yang, S.; Kuang, H.; Li, R.; Meng, Y.; Wu, Y. Identifying the Anti-Inflammatory Effects of Astragalus Polysaccharides in Anti-N-Methyl-D-Aspartate Receptor Encephalitis: Network Pharmacology and Experimental Validation. Comb. Chem. High Throughput Screen. 2024, 27, 1022–1032. [Google Scholar] [CrossRef] [Scilit]
- Qiao, Y.; Liu, C.; Guo, Y.; Zhang, W.; Guo, W.; Oleksandr, K.; Wang, Z. Polysaccharides Derived from Astragalus membranaceus and Glycyrrhiza uralensis Improve Growth Performance of Broilers by Enhancing Intestinal Health and Modulating Gut Microbiota. Poult. Sci. 2022, 101, 101905. [Google Scholar] [CrossRef] [Scilit]
- National Research Council, and Subcommittee on Poultry Nutrition. Nutrient Requirements of Poultry: 1994; National Academies Press: Washington, WA, USA, 1994; ISBN 0-309-04892-3. [Google Scholar]
- NY/T 823-2020; Terminology and Measurement Calculation Method for Poultry Performance. The National Standards of the People’s Republic of China: Beijing, China, 2020.
- Palmer, S.S.; Bahr, J.M. Follicle Stimulating Hormone Increases Serum Oestradial-17ß Concentrations, Number of Growing Follicles and Yolk Deposition in Aging Hens (Gallus Gallus Domesticus) with Decreased Egg Production. Br. Poult. Sci. 1992, 33, 403–414. [Google Scholar] [CrossRef] [Scilit]
- Osman, R.H.; Liu, L.; Xia, L.; Zhao, X.; Wang, Q.; Sun, X.; Zhang, Y.; Yang, B.; Zheng, Y.; Gong, D. Fads1 and 2 Are Promoted to Meet Instant Need for Long-Chain Polyunsaturated Fatty Acids in Goose Fatty Liver. Mol. Cell. Biochem. 2016, 418, 103–117. [Google Scholar] [CrossRef] [Scilit]
- Bohler, M.W.; Chowdhury, V.S.; Cline, M.A.; Gilbert, E.R. Heat Stress Responses in Birds: A Review of the Neural Components. Biology 2021, 10, 1095. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.-R.; Ryu, C.; Lee, S.-D.; Cho, J.-H.; Kang, H. Effects of Heat Stress on the Laying Performance, Egg Quality, and Physiological Response of Laying Hens. Animals 2024, 14, 1076. [Google Scholar] [CrossRef] [Scilit]
- Torki, M.; Nasiroleslami, M.; Ghasemi, H.A. The Effects of Different Protein Levels in Laying Hens under Hot Summer Conditions. Anim. Prod. Sci. 2016, 57, 927–934. [Google Scholar] [CrossRef] [Scilit]
- Soares, K.R.; Lara, L.J.C.; da Silva Martins, N.R.; e Silva, R.R.; Pereira, L.F.P.; Cardeal, P.C.; Teixeira, M.d.P.F. Protein Diets for Growing Broilers Created under a Thermoneutral Environment or Heat Stress. Anim. Feed. Sci. Technol. 2020, 259, 114332. [Google Scholar] [CrossRef] [Scilit]
- Mosca, F.; Kuster, C.A.; Stella, S.; Farina, G.; Madeddu, M.; Zaniboni, L.; Cerolini, S. Growth Performance, Carcass Characteristics and Meat Composition of Milanino Chickens Fed on Diets with Different Protein Concentrations. Br. Poult. Sci. 2016, 57, 531–537. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, B.; Zhou, S.; Zhai, W.; Zhao, Y. Effect of Reduction in Dietary Amino Acids and Energy on Growth Performance and Economic Return of Cobb 700 and Ross 708 Broilers. Animals 2025, 15, 890. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Niu, J.; Qiao, Y.; Yang, X.; Chen, X.; Li, H.; Guo, Y.; Zhang, W.; Wang, Z. Protease and Bacillus Coagulans Supplementation in a Low-Protein Diet Improves Broiler Growth, Promotes Amino Acid Transport Gene Activity, Strengthens Intestinal Barriers, and Alters the Cecal Microbial Composition. Animals 2025, 15, 170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, H.; Xu, K.; Wang, H.; Lin, H.; Yang, X.; Wang, X.; Zhao, J.; Ma, B.; Shu, Q.; Lu, Y. Effects of Different Forms of Amino Acid Supplementation on the Performance and Intestinal Barrier Function of Laying Hens Fed a Low-Protein Diet. Poult. Sci. 2024, 103, 104375. [Google Scholar] [CrossRef] [Scilit]
- Cabezas-Garcia, E.H.; Rodríguez-Aguilar, D.E.; Afanador-Téllez, G. Individual Egg Production of Hy-Line Brown Hens during the Early Laying Phase in Response to Dietary CP Levels. Anim.-Open Space 2022, 1, 100027. [Google Scholar] [CrossRef] [Scilit]
- Parenteau, I.A.; Stevenson, M.; Kiarie, E.G. Egg Production and Quality Responses to Increasing Isoleucine Supplementation in Shaver White Hens Fed a Low Crude Protein Corn-Soybean Meal Diet Fortified with Synthetic Amino Acids between 20 and 46 Weeks of Age. Poult. Sci. 2020, 99, 1444–1453. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.-M.; Sun, X.-Y.; Ouyang, J.-M. Structural Characterization, Antioxidant Activity, and Biomedical Application of Astragalus Polysaccharide Degradation Products. Int. J. Polym. Sci. 2018, 2018, 5136185. [Google Scholar] [CrossRef] [Scilit]
- Liao, J.; Li, C.; Huang, J.; Liu, W.; Chen, H.; Liao, S.; Chen, H.; Rui, W. Structure Characterization of Honey-Processed Astragalus Polysaccharides and Its Anti-Inflammatory Activity in Vitro. Molecules 2018, 23, 168. [Google Scholar] [CrossRef] [Scilit]
- Li, K.; Cao, Y.; Jiao, S.; Du, G.; Du, Y.; Qin, X. Structural Characterization and Immune Activity Screening of Polysaccharides with Different Molecular Weights from Astragali Radix. Front. Pharmacol. 2020, 11, 582091. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, J.; Li, C.; Bai, L.; Wu, J.; Bo, R.; Ye, M.; Huang, L.; Chen, H.; Rui, W. Structural Differences of Polysaccharides from Astragalus before and after Honey Processing and Their Effects on Colitis Mice. Int. J. Biol. Macromol. 2021, 182, 815–824. [Google Scholar] [CrossRef] [Scilit]
- Zexi, Z.; Lei, Z.; Hansong, X. Effect of Astragalus Polysaccharide in Treatment of Diabetes Mellitus: A Narrative Review. J. Tradit. Chin. Med. 2019, 39, 133–138. [Google Scholar] [CrossRef]
- Yang, L.; Fan, X.; Tian, K.; Yan, S.; Xu, C.; Tian, Y.; Xiao, C.; Jia, X.; Shi, J.; Bai, Y.; et al. Dynamic Expression Profile of Follicles at Different Stages in High- and Low-Production Laying Hens. Genes 2023, 15, 40. [Google Scholar] [CrossRef] [Scilit]
- Tuğalay, Ç.Ş.; Bayraktar, Ö.H.; Genç, N. Effects of ACTH and Acute Heat Stress on Oxidative Stress in an Early Environmentally Enriched Broilers. J. Anim. Prod. 2021, 62, 93–98. [Google Scholar]
- Mishra, S.K.; Chen, B.; Zhu, Q.; Xu, Z.; Ning, C.; Yin, H.; Wang, Y.; Zhao, X.; Fan, X.; Yang, M.; et al. Transcriptome Analysis Reveals Differentially Expressed Genes Associated with High Rates of Egg Production in Chicken Hypothalamic-Pituitary-Ovarian Axis. Sci. Rep. 2020, 10, 5976. [Google Scholar] [CrossRef] [Scilit]
- Yin, Z.Z.; Dong, X.Y.; Cao, H.Y.; Mao, H.G.; Ma, Y.Z. Effects of Rearing Systems on Reproductive Hormones Secretion and Their Receptors Gene Expression in Xianju Chickens under Summer Conditions. Poult. Sci. 2018, 97, 3092–3096. [Google Scholar] [CrossRef] [Scilit]
- Titto, C.G.; Negrão, J.A.; Canaes, T.D.S.; Titto, R.M.; Leme-dos Santos, T.M.D.C.; Henrique, F.L.; Calviello, R.F.; Pereira, A.M.F.; Titto, E.A.L. Heat Stress and ACTH Administration on Cortisol and Insulin-like Growth Factor I (IGF-I) Levels in Lactating Holstein Cows. J. Appl. Anim. Res. 2017, 45, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.; Cai, H.; Han, Y.; Yang, P. Mechanisms of Heat Stress on Neuroendocrine and Organ Damage and Nutritional Measures of Prevention and Treatment in Poultry. Biology 2024, 13, 926. [Google Scholar] [CrossRef] [Scilit]
- Alagawany, M.; El-Hindawy, M.M.; El-Hack, M.E.A.; Arif, M.; El-Sayed, S.A. Influence of Low-Protein Diet with Different Levels of Amino Acids on Laying Hen Performance, Quality and Egg Composition. An. Acad. Bras. Ciências 2020, 92, e20180230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van Harn, J.; Dijkslag, M.A.; van Krimpen, M.M. Effect of Low Protein Diets Supplemented with Free Amino Acids on Growth Performance, Slaughter Yield, Litter Quality, and Footpad Lesions of Male Broilers. Poult. Sci. 2019, 98, 4868–4877. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zurak, D.; Slovenec, P.; Janječić, Z.; Bedeković, X.; Pintar, J.; Kljak, K. Overview on Recent Findings of Nutritional and Non-Nutritional Factors Affecting Egg Yolk Pigmentation. World’s Poult. Sci. J. 2022, 78, 531–560. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Xuan, Y.; Guo, D.; Zeng, Q.; Bai, S.; Liu, Y.; Ding, X.; Zhang, K.; Wang, J. Effects of Dietary Low Protein Levels and Amino Acid Patterns on Production Performance, Egg Quality and Intestinal Function in Laying Hens. Poult. Sci. 2025, 104, 105578. [Google Scholar] [CrossRef] [Scilit]
- Akbarian, A.; Michiels, J.; Degroote, J.; Majdeddin, M.; Golian, A.; De Smet, S. Association between Heat Stress and Oxidative Stress in Poultry; Mitochondrial Dysfunction and Dietary Interventions with Phytochemicals. J. Anim. Sci. Biotechnol. 2016, 7, 37. [Google Scholar] [CrossRef] [Scilit]
- Cheng, Y.; Du, M.; Xu, Q.; Chen, Y.; Wen, C.; Zhou, Y. Dietary Mannan Oligosaccharide Improves Growth Performance, Muscle Oxidative Status, and Meat Quality in Broilers under Cyclic Heat Stress. J. Therm. Biol 2018, 75, 106–111. [Google Scholar] [CrossRef] [Scilit]
- Tang, L.-P.; Liu, Y.-L.; Zhang, J.-X.; Ding, K.-N.; Lu, M.-H.; He, Y.-M. Heat Stress in Broilers of Liver Injury Effects of Heat Stress on Oxidative Stress and Autophagy in Liver of Broilers. Poult. Sci. 2022, 101, 102085. [Google Scholar] [CrossRef] [Scilit]
- Mahanty, A.; Mohanty, S.; Mohanty, B.P. Dietary Supplementation of Curcumin Augments Heat Stress Tolerance through Upregulation of Nrf-2-Mediated Antioxidative Enzymes and Hsps in Puntius Sophore. Fish Physiol. Biochem. 2017, 43, 1131–1141. [Google Scholar] [CrossRef] [Scilit]
- Ouyang, J.; Li, Q.; Zhou, H.; Li, G.; Wu, Y.; Yang, L. Effect of Dietary Tryptophan Supplementation on Serum Biochemical Indices, Antioxidant Capacities, Cytokine Levels and Mitochondrial Function of Broilers under Chronic Heat Stress. Trop. Anim. Health Prod. 2023. [Google Scholar] [CrossRef] [Scilit]
- Zulkifli, I.; Akmal, A.F.; Soleimani, A.F.; Hossain, M.A.; Awad, E.A. Effects of Low-Protein Diets on Acute Phase Proteins and Heat Shock Protein 70 Responses, and Growth Performance in Broiler Chickens under Heat Stress Condition. Poult. Sci. 2018, 97, 1306–1314. [Google Scholar] [CrossRef] [Scilit]
- Salahi, A.; Shahir, M.H.; Attia, Y.A.; Fahmy, K.N.E.; Bovera, F.; Tufarelli, V. Impact of Low-Protein Diets on Broiler Nutrition, Production Sustainability, Gene Expression, Meat Quality and Greenhouse Gas Emissions. J. Appl. Anim. Res. 2025, 53, 2473419. [Google Scholar] [CrossRef] [Scilit]
- Belhadj Slimen, I.; Najar, T.; Ghram, A.; Abdrrabba, M. Heat Stress Effects on Livestock: Molecular, Cellular and Metabolic Aspects, a Review. J. Anim. Physiol. Anim. Nutr. 2016, 100, 401–412. [Google Scholar] [CrossRef] [Scilit]
- Surai, P.F.; Kochish, I.I.; Fisinin, V.I.; Kidd, M.T. Antioxidant Defence Systems and Oxidative Stress in Poultry Biology: An Update. Antioxidants 2019, 8, 235. [Google Scholar] [CrossRef] [Scilit]
- Liao, X.D.; Ma, G.; Cai, J.; Fu, Y.; Yan, X.Y.; Wei, X.B.; Zhang, R.J. Effects ofClostridium Butyricum on Growth Performance, Antioxidation, and Immune Function of Broilers. Poult. Sci. 2015, 94, 662–667. [Google Scholar] [CrossRef] [Scilit]
- Song, X.; Qian, J.; Wang, C.; Wang, D.; Zhou, J.; Zhao, Y.; Wang, W.; Li, J.; Guo, R.; Li, Y. Correlation between the IgG/IgA Antibody Response against PEDV Structural Protein and Virus Neutralization. Microbiol. Spectr. 2023, 11, e05233-22. [Google Scholar] [CrossRef] [Scilit]
- Zhou, J.; Qiu, K.; Wang, J.; Zhang, H.; Qi, G.; Wu, S. Effect of Dietary Serine Supplementation on Performance, Egg Quality, Serum Indices, and Ileal Mucosal Immunity in Laying Hens Fed a Low Crude Protein Diet. Poult. Sci. 2021, 100, 101465. [Google Scholar] [CrossRef] [Scilit]
- Sun, H.; Zhao, L.; Xu, Z.-J.; De Marco, M.; Briens, M.; Yan, X.-H.; Sun, L.-H. Hydroxy-Selenomethionine Improves the Selenium Status and Helps to Maintain Broiler Performances under a High Stocking Density and Heat Stress Conditions through a Better Redox and Immune Response. Antioxidants 2021, 10, 1542. [Google Scholar] [CrossRef] [Scilit]
- Alagawany, M.; Ashour, E.A.; El-Fakhrany, H.H.H.; Ismail, T.A.; Nasr, M. Early Nutrition Programming with Astragalus membranaceus Polysaccharide: Its Effect on Growth, Carcasses, Immunity, Antioxidants, Lipid Profile and Liver and Kidney Functions in Broiler Chickens. Anim. Biotechnol. 2022, 33, 362–368. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.H.; Lee, W.-W. IL-1 Receptor Dynamics in Immune Cells: Orchestrating Immune Precision and Balance. Immune Netw. 2024, 24, e21. [Google Scholar] [CrossRef] [Scilit]
- Martinez-Espinosa, I.; Serrato, J.A.; Ortiz-Quintero, B. Role of IL-10-Producing Natural Killer Cells in the Regulatory Mechanisms of Inflammation during Systemic Infection. Biomolecules 2021, 12, 4. [Google Scholar] [CrossRef] [Scilit]
- Bueno, J.P.R.; de Mattos Nascimento, M.R.B.; da Silva Martins, J.M.; Marchini, C.F.P.; Gotardo, L.R.M.; de Sousa, G.M.R.; Mundim, A.V.; Guimarães, E.C.; Rinaldi, F.P. Effect of Age and Cyclical Heat Stress on the Serum Biochemical Profile of Broiler Chickens. Semin. Ciências Agrárias 2017, 38, 1383. [Google Scholar] [CrossRef] [Scilit]
- Zhou, J.; Zhang, N.; Zhao, L.; Wu, W.; Zhang, L.; Zhou, F.; Li, J. Astragalus Polysaccharides and Saponins Alleviate Liver Injury and Regulate Gut Microbiota in Alcohol Liver Disease Mice. Foods 2021, 10, 2688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saeed, M.; YaTao, X.; Rehman, Z.U.; Arain, M.A.; Soomro, R.N.; El-Hack, M.E.A.; Bhutto, Z.A.; Abbasi, B.; Dhama, K.; Sarwar, M.; et al. Nutritional and Healthical Aspects of Yacon (Smallanthus sonchifolius) for Human, Animals and Poultry. Int. J. Pharmacol. 2017, 13, 361–369. [Google Scholar] [CrossRef] [Scilit]
- Mokondjimobe, E.; Longo-Mbenza, B.; Akiana, J.; Ndalla, U.O.; Dossou-Yovo, R.; Mboussa, J.; Parra, H.-J. Biomarkers of Oxidative Stress and Personalized Treatment of Pulmonary Tuberculosis: Emerging Role of Gamma-Glutamyltransferase. Adv. Pharmacol. Sci. 2012, 2012, 465634. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, O.M.; Elkomy, M.H.; Fahim, H.I.; Ashour, M.B.; Naguib, I.A.; Alghamdi, B.S.; Mahmoud, H.U.R.; Ahmed, N.A. Rutin and Quercetin Counter Doxorubicin-induced Liver Toxicity in Wistar Rats via Their Modulatory Effects on Inflammation, Oxidative Stress, Apoptosis, and Nrf2. Oxidative Med. Cell. Longev. 2022, 2022, 2710607. [Google Scholar] [CrossRef] [Scilit]
- Badawi, M.E.-S.; Ali, A.H.; El-Razik, W.M.A.; Soliman, M.H. Influence of Low Crude Protein Diets on Broiler Chickens Performance. Adv. Anim. Vet. Sci. 2019, 7, 26–33. [Google Scholar] [CrossRef] [Scilit]
- Sun, X.; Zhang, H.; Sheikhahmadi, A.; Wang, Y.; Jiao, H.; Lin, H.; Song, Z. Effects of Heat Stress on the Gene Expression of Nutrient Transporters in the Jejunum of Broiler Chickens (Gallus gallus domesticus). Int. J. Biometeorol. 2015, 59, 127–135. [Google Scholar] [CrossRef] [Scilit]
- Mathias, P.C.d.F.; Miranda, G.D.S.; Barella, L.F.; Miranda, R.A.; Pavanello, A.; Martins, I.P.; Facchi, J.C.; Costermani, H.d.O.; de Lima, T.A.L.; de Oliveira, J.C. Cholinergic-Pathway-Weakness-Associated Pancreatic Islet Dysfunction: A Low-Protein-Diet Imprint Effect on Weaned Rat Offspring. J. Dev. Origins Health Dis. 2020, 11, 484–491. [Google Scholar] [CrossRef] [Scilit]
- Zheng, Y.; Ren, W.; Zhang, L.; Zhang, Y.; Liu, D.; Liu, Y. A Review of the Pharmacological Action of Astragalus Polysaccharide. Front. Pharmacol. 2020, 11, 349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hernández, F.; López, M.; Martínez, S.; Megías, M.D.; Catalá, P.; Madrid, J. Effect of Low-Protein Diets and Single Sex on Production Performance, Plasma Metabolites, Digestibility, and Nitrogen Excretion in 1-to 48-Day-Old Broilers. Poult. Sci. 2012, 91, 683–692. [Google Scholar] [CrossRef] [Scilit]
- Saleh, A.A.; Amber, K.A.; Soliman, M.M.; Soliman, M.Y.; Morsy, W.A.; Shukry, M.; Alzawqari, M.H. Effect of Low Protein Diets with Amino Acids Supplementation on Growth Performance, Carcass Traits, Blood Parameters and Muscle Amino Acids Profile in Broiler Chickens under High Ambient Temperature. Agriculture 2021, 11, 185. [Google Scholar] [CrossRef] [Scilit]
- Ahmadi, M.; Yaghobfar, A.; Tabatabaei, S.H. Study of Effects Difference Levels of Crude Protein and Amino Acid of Diet on Intestinal Morphological and Blood Biological Parameters of Poultry. Biological Forum 2015, 7, 666–670. [Google Scholar]
- Luo, J.; Yang, H.; Song, B.-L. Mechanisms and Regulation of Cholesterol Homeostasis. Nat. Rev. Mol. Cell Biol. 2020, 21, 225–245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siddiqui, H.; Yevstigneyev, N.; Madani, G.; McCormick, S. Approaches to Visualising Endocytosis of LDL-Related Lipoproteins. Biomolecules 2022, 12, 158. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Ingredients | Basic Diet | Low-Protein Diet |
|---|---|---|
| Corn | 632 | 672 |
| Soybean meal | 230 | 163 |
| Wheat bran | 33.5 | 57.5 |
| Calcium dihydrogen phosphate | 6.30 | 6.30 |
| Limestone | 91.2 | 91.7 |
| Sodium chloride | 3.00 | 3.00 |
| DL-Methionine (990 g/kg) | 1.50 | 1.80 |
| L-lysine HCl | 0.00 | 1.60 |
| L-threonine | 0.00 | 0.90 |
| L-tryptophan | 0.00 | 0.40 |
| 1 Premix | 2.50 | 2.50 |
| 2 Nutrient components | ||
| ME (MJ/kg) | 11.0 | 11.0 |
| Crude protein | 154 | 132 |
| Crude fiber | 25.9 | 24.3 |
| Calcium | 35.5 | 35.5 |
| Total phosphorus | 5.00 | 4.90 |
| Nonphytate phosphorus | 2.42 | 2.36 |
| Methionine | 3.86 | 3.88 |
| Lysine | 7.81 | 7.81 |
| Threonine | 5.85 | 5.91 |
| Tryptophan | 1.81 | 1.83 |
| Target Genes | Primer Sequences (5′−3′) | Size/bp | Accession No. |
|---|---|---|---|
| FSHR | F:ACATTCCCACCAATGCCACA R:AGTGCACCTTATGGACGACG | 300 | NM_205079.1 |
| LHR | F:GGGCTTTCCCAAGCCTACAT R:TGGTGTCTTTATTGGCGGCT | 133 | NM_204936.1 |
| ESR1 | F:GCTCTCACCCTTCATCCAT R:GACATCCTCTCACGAATGC | 150 | NC 006090.3 |
| ESR2 | F:AGAGAACGCTGTGGGTAT R:TAGGACGACTCACCAACA | 187 | NC 006092.3 |
| β-actin | F:TGGATGATGATATTGCTGC R:ATCTTCTCCATATCATCCC | 253 | K02173 |
| SOD1 | F:TTGTCTGATGGAGATCATGGCTTC R:TGCTTGCCTTCAGGATTAAAGTGAG | 98 | NM_205064.1 |
| Nrf2 | F:GGGACGGTGACACAGGAACAAC R:TCCACAGCGGGAAATCAGAAAGATC | 93 | NM_205117.1 |
| GPx | F:ACGGCGCATCTTCCAAAG R:TGTTCCCCCAACCATTTCTC | 288 | NM_001277853 |
| TNF-α | F:GCCCAGTTCAGATGAGTTGCC R:AAGAGGCCACCACACGACAG | 100 | NC_052545.1 |
| IL-1β | F:TGCCTGCAGAAGAAGCCTCG R:GACGGGCTCAAAAACCTCCT | 204 | NC_052553.1 |
| IL-10 | F-CAGACCAGCACCAGTCATCA R-TCCCGTTCTCATCCATCTTCTC | 163 | NM_001004414.2 |
| IFN-γ | F:TGATGGCGTGAAGAAGGTG R:GACTGGCTCCTTTTCCTTTTG | 150 | AJ012245 |
| SREBP2 | F:TGGGCGACATAGACGAGATG R:CACCGCCACCCTGGAAG | 102 | XM 015289037 |
| HMGCR | F:TTGGATAGAGGGAAGAGGGAAG R:TTGGATAGAGGGAAGAGGGAAG | 137 | NM 204485.3 |
| LDLR | F:CATCAGCTTCGGGAACCCTC R:CTGTGCACACTCCGCTGT | 96 | NM 204452.1 |
| Items 1 | CON | HB | HL | HLA | SEM 2 | p-Value |
|---|---|---|---|---|---|---|
| EPR (%) | 83.30 a | 73.27 c | 76.22 bc | 78.79 ab | 0.992 | <0.001 |
| Breakage rate (%) | 0.17 | 0.34 | 0.36 | 0.24 | 0.040 | 0.318 |
| Mortality (%) | 0 | 0.15 | 0.11 | 0.14 | 0.046 | 0.674 |
| ADFI (g) | 103.14 | 106.04 | 101.70 | 100.50 | 0.775 | 0.059 |
| Average egg weight (g) | 64.67 | 63.22 | 63.69 | 63.45 | 0.848 | 0.364 |
| FCR (g/g) | 1.95 b | 2.30 a | 2.11 b | 2.04 b | 0.035 | <0.001 |
| Items 1 | CON | HB | HL | HLA | SEM 2 | p-Value |
|---|---|---|---|---|---|---|
| SWF | 33.00 a | 26.65 b | 31.00 a | 30.13 a | 0.654 | 0.001 |
| BYF | 6.38 | 6.88 | 6.88 | 7.00 | 0.265 | 0.857 |
| GF | 5.25 | 5.00 | 5.00 | 5.25 | 0.188 | 0.118 |
| Items 1 | CON | HB | HL | HLA | SEM 2 | p-Value |
|---|---|---|---|---|---|---|
| Albumen height (mm) | 6.66 | 6.80 | 6.68 | 6.68 | 0.129 | 0.312 |
| Haugh unit | 78.91 | 82.40 | 78.25 | 84.20 | 1.051 | 0.138 |
| Yolk color | 5.17 c | 5.85 bc | 6.38 ab | 6.46 a | 0.131 | <0.001 |
| Yolk ratio (%) | 26.29 | 25.48 | 25.43 | 25.39 | 0.002 | 0.115 |
| Eggshell strength (N) | 4.17 | 4.05 | 4.11 | 4.19 | 0.110 | 0.971 |
| Shell thickness (mm) | 0.29 | 0.29 | 0.29 | 0.27 | 0.005 | 0.324 |
| Egg shape index | 1.31 | 1.29 | 1.32 | 1.30 | 0.005 | 0.507 |
| Items 1 | CON | HB | HL | HLA | SEM 2 | p-Value |
|---|---|---|---|---|---|---|
| ACTH (pg/mL) | 40.0 b | 68.3 a | 39.4 b | 43.0 b | 2.36 | <0.001 |
| CORT (ng/mL) | 69.5 c | 86.5 a | 80.3 b | 73.9 c | 1.47 | <0.001 |
| E2 (pg/mL) | 376 | 373 | 366 | 381 | 3.45 | 0.195 |
| FSH (mIU/mL) | 12.25 a | 8.39 b | 11.70 a | 12.53 a | 0.49 | 0.005 |
| LH (mIU/mL) | 14.20 | 13.71 | 13.38 | 13.57 | 0.56 | 0.055 |
| P4 (pmol/mL) | 1.20 | 1.23 | 1.20 | 1.27 | 0.03 | 0.151 |
| Items 1 | CON | HB | HL | HLA | SEM 2 | p-Value |
|---|---|---|---|---|---|---|
| T-SOD (U/mL) | 143.66 a | 126.51 c | 133.49 b | 137.21 ab | 1.593 | <0.001 |
| MDA (nmol/mL) | 234.24 c | 338.78 a | 329.64 a | 289.27 b | 8.231 | <0.001 |
| GPx (U/mL) | 95.53 a | 85.48 c | 88.89 b | 91.93 ab | 0.973 | <0.001 |
| T-AOC (U/mL) | 6.28 | 5.76 | 6.41 | 6.41 | 0.116 | 0.145 |
| Items 1 | CON | HB | HL | HLA | SEM 2 | p-Value |
|---|---|---|---|---|---|---|
| IgA (μg/mL) | 157.83 b | 139.11 c | 144.97 c | 256.07 a | 8.69 | <0.001 |
| IgG (mg/mL) | 2.14 b | 2.01 c | 2.11 b | 2.62 a | 0.05 | <0.001 |
| IgM (μg/mL) | 651.80 b | 482.49 d | 582.76 c | 671.91 a | 13.55 | <0.001 |
| Items 1 | CON | HB | HL | HLA | SEM 2 | p-Value |
|---|---|---|---|---|---|---|
| IL-1β (pg/mL) | 473.35 c | 598.33 a | 511.92 b | 496.64 b | 8.89 | <0.001 |
| IL-2 (pg/mL) | 236.64 | 254.43 | 256.30 | 232.06 | 5.18 | 0.259 |
| IL-6 (pg/mL) | 21.88 | 26.62 | 24.61 | 21.00 | 0.86 | 0.074 |
| IL-10 (pg/mL) | 48.46 b | 45.60 b | 44.45 b | 61.64 a | 1.40 | <0.001 |
| MCP-1 (ng/mL) | 0.58 | 0.50 | 0.59 | 0.53 | 0.02 | 0.152 |
| TNF-α (pg/mL) | 45.89 | 53.03 | 53.35 | 48.21 | 6.34 | 0.127 |
| IFN-γ (pg/mL) | 66.00 | 63.88 | 69.09 | 70.84 | 8.32 | 0.253 |
| Items 1 | CON | HB | HL | HLA | SEM 2 | p-Value |
|---|---|---|---|---|---|---|
| T-CHO (mmol/L) | 2.51 c | 3.91 a | 3.28 b | 3.00 b | 0.29 | <0.001 |
| HDL-C (mmol/L) | 0.54 b | 0.60 ab | 0.63 a | 0.59 ab | 0.01 | 0.041 |
| LDL-C (mmol/L) | 1.26 b | 1.42 a | 1.33 ab | 1.26 b | 0.02 | 0.019 |
| TG (mmol/L) | 12.63 c | 20.33 a | 16.41 b | 17.96 b | 0.60 | <0.001 |
| AST/(U/L) | 24.17 a | 24.83 a | 18.83 b | 20.67 b | 0.72 | 0.004 |
| ALT (U/L) | 180.35 | 186.82 | 185.01 | 174.02 | 5.98 | 0.313 |
| TP (g/L) | 52.50 | 55.68 | 54.28 | 56.17 | 0.72 | 0.279 |
| ALB (g/L) | 14.39 | 15.33 | 15.30 | 14.99 | 0.25 | 0.522 |
| GLB (g/L) | 38.00 | 38.00 | 39.00 | 39.33 | 0.45 | 0.657 |
| A/G | 0.38 | 0.41 | 0.39 | 0.38 | 0.01 | 0.791 |
| GLU (mmol/L) | 6.04 d | 7.17 c | 7.95 a | 7.67 b | 0.14 | <0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, W.; Wan, X.; Wang, Z.; Yang, H. Effects of Low-Protein Amino Acid-Balanced Diets and Astragalus Polysaccharides on Production Performance, Antioxidants, Immunity, and Lipid Metabolism in Heat-Stressed Laying Hens. Animals 2025, 15, 2385. https://doi.org/10.3390/ani15162385
Liu W, Wan X, Wang Z, Yang H. Effects of Low-Protein Amino Acid-Balanced Diets and Astragalus Polysaccharides on Production Performance, Antioxidants, Immunity, and Lipid Metabolism in Heat-Stressed Laying Hens. Animals. 2025; 15(16):2385. https://doi.org/10.3390/ani15162385
Chicago/Turabian StyleLiu, Wenfeng, Xiaoli Wan, Zhiyue Wang, and Haiming Yang. 2025. "Effects of Low-Protein Amino Acid-Balanced Diets and Astragalus Polysaccharides on Production Performance, Antioxidants, Immunity, and Lipid Metabolism in Heat-Stressed Laying Hens" Animals 15, no. 16: 2385. https://doi.org/10.3390/ani15162385
APA StyleLiu, W., Wan, X., Wang, Z., & Yang, H. (2025). Effects of Low-Protein Amino Acid-Balanced Diets and Astragalus Polysaccharides on Production Performance, Antioxidants, Immunity, and Lipid Metabolism in Heat-Stressed Laying Hens. Animals, 15(16), 2385. https://doi.org/10.3390/ani15162385

