Tea Polyphenols Mitigate TBBPA-Induced Renal Injury Through Modulation of ROS-PI3K/AKT-NF-κB Signalling in Carp (Cyprinus carpio)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Treatment
2.2. Culture and Treatment of Primary Renal Cells from Carp Kidney
2.3. Histological Analysis
2.4. TUNEL Analysis
2.5. Oxygen Radical Detection
2.6. AO/EB Staining
2.7. Antioxidant Enzyme Detection
2.8. Enzyme-Linked Immunosorbent Assay (ELISA)
2.9. Real-Time PCR
2.10. Western Blotting Assay
2.11. Statistical Analysis
3. Results
3.1. TPs Mitigated TBBPA-Induced Renal Injury
3.2. TPs Mitigated the Oxidative Stress Induced by TBBPA in Renal Tissue
3.3. TPs Mitigated TBBPA-Induced Renal Inflammatory Injury
3.4. TPs Mitigated TBBPA-Induced Activation of the PI3K/AKT/NF-κB Pathway
3.5. TPs Reduced TBBPA-Induced Renal Cell Apoptosis
3.6. TPs Mitigated TBBPA-Induced Renal Cell Necrosis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Song, Y.; Zhang, W. Balancing Growth and Sustainability in China’s Carp Aquaculture: Practices, Policies, and Sustainability Pathways. Sustainability 2025, 17, 5593. [Google Scholar] [CrossRef] [Scilit]
- Cao, J.; Chen, J.; Xie, L.; Wang, J.; Feng, C.; Song, J. Protective properties of sesamin against fluoride-induced oxidative stress and apoptosis in kidney of carp (Cyprinus carpio) via JNK signaling pathway. Aquat. Toxicol. 2015, 167, 180–190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Milla, S.; Wang, N.; Mandiki, S.N.; Kestemont, P. Corticosteroids: Friends or foes of teleost fish reproduction? Comp. Biochem. Physiol. Part A: Mol. Integr. Physiol. 2009, 153, 242–251. [Google Scholar] [CrossRef] [Scilit]
- Serradimigni, R.; Rojas, A.; Leong, C.; Pal, U.; Bryan, M.; Sharma, S.; Dasgupta, S. Flame retardant tetrabromobisphenol A (TBBPA) disrupts histone acetylation during zebrafish maternal-to-zygotic transition. J. Hazard. Mater. 2024, 480, 135845. [Google Scholar] [CrossRef] [Scilit]
- Abdallah, M.A.E. Environmental occurrence, analysis and human exposure to the flame retardant tetrabromobisphenol-A (TBBP-A)-A review. Environ. Int. 2016, 94, 235–250. [Google Scholar] [CrossRef] [Scilit]
- Ronisz, D.; Finne, E.F.; Karlsson, H.; Förlin, L. Effects of the brominated flame retardants hexabromocyclododecane (HBCDD), and tetrabromobisphenol A (TBBPA), on hepatic enzymes and other biomarkers in juvenile rainbow trout and feral eelpout. Aquat. Toxicol. 2004, 69, 229–245. [Google Scholar] [CrossRef] [Scilit]
- Anh, H.Q.; Minh, T.H.; Minh, P.D.; Nhat, T.M.; Minh, N.L.H.; Minh, T.B.; Takahashi, S. Analysis and Pollution Assessment of Brominated Flame Retardants (PBDEs, DBDPE, and BTPBE) in Settled Dust from E-waste and Vehicle Processing Areas in Northern Vietnam. VNU J. Sci. Nat. Sci. Technol. 2023, 39, 33–40. [Google Scholar] [CrossRef] [Scilit]
- Xu, S.; Sun, X.; Wu, J.; Li, K.; Li, X.; Zhang, Y.; Gao, X.J. TBBPA causes inflammation and cell death via the ROS/NF-κB pathway in the gastric mucosa. Ecotoxicol. Environ. Saf. 2023, 262, 115320. [Google Scholar] [CrossRef] [Scilit]
- Okeke, E.S.; Huang, B.; Mao, G.; Chen, Y.; Zhengjia, Z.; Qian, X.; Wu, X.; Feng, W. Review of the environmental occurrence, analytical techniques, degradation and toxicity of TBBPA and its derivatives. Environ. Res. 2022, 206, 112594. [Google Scholar] [CrossRef] [Scilit]
- Liu, K.; Li, J.; Yan, S.; Zhang, W.; Li, Y.; Han, D. A review of status of tetrabromobisphenol A (TBBPA) in China. Chemosphere 2016, 148, 8–20. [Google Scholar] [CrossRef] [Scilit]
- Birnbaum, L.S.; Staskal, D.F. Brominated flame retardants: Cause for concern? Env. Health Perspect 2004, 112, 9–17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, M.; Liang, D.; Liang, Y.; Chen, M.; Wang, F.; Wang, H.; Jiang, G. Assessing developmental toxicity and estrogenic activity of halogenated bisphenol A on zebrafish (Danio rerio). Chemosphere 2014, 112, 275–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, S.; Wang, S.; Liu, H.; Yan, Z. Tetrabromobisphenol A: Tissue distribution in fish, and seasonal variation in water and sediment of Lake Chaohu, China. Environ. Sci. Pollut. Res. 2012, 19, 4090–4096. [Google Scholar] [CrossRef] [Scilit]
- Qian, M.; Geng, Y.; Wang, J.-J.; Wang, H.-R.; Luo, J.-L.; Gao, X.-J. TBBPA caused multiple intestinal injuries via ROS/NF-κB signal in common carp. Aquat. Toxicol. 2025, 279, 107190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, D.; Yang, N.; Liu, H.; Yao, Y.; Xu, S. TBBPA causes apoptosis in grass carp hepatocytes involving destroyed ER-mitochondrial function. Chemosphere 2023, 341, 139974. [Google Scholar] [CrossRef] [Scilit]
- Fukuda, N.; Ito, Y.; Yamaguchi, M.; Mitumori, K.; Koizumi, M.; Hasegawa, R.; Kamata, E.; Ema, M. Unexpected nephrotoxicity induced by tetrabromobisphenol A in newborn rats. Toxicol. Lett. 2004, 150, 145–155. [Google Scholar] [CrossRef] [Scilit]
- Tada, Y.; Fujitani, T.; Yano, N.; Takahashi, H.; Yuzawa, K.; Ando, H.; Kubo, Y.; Nagasawa, A.; Ogata, A.; Kamimura, H. Effects of tetrabromobisphenol A, brominated flame retardant, in ICR mice after prenatal and postnatal exposure. Food Chem. Toxicol. 2006, 44, 1408–1413. [Google Scholar] [CrossRef] [Scilit]
- Liao, Y.; Wang, Y.; Lin, Y.; Xiao, Y.; Mohan, M.; Jaman, R.; Dong, H.; Zhu, J.; Li, X.; Zhang, C.; et al. Molecular mechanisms of tetrabromobisphenol A (TBBPA) toxicity: Insights from various biological systems. Ecotoxicol. Environ. Saf. 2024, 288, 117418. [Google Scholar] [CrossRef] [Scilit]
- Shi, X.; Zhu, W.; Chen, T.; Cui, W.; Li, X.; Xu, S. Paraquat induces apoptosis, programmed necrosis, and immune dysfunction in CIK cells via the PTEN/PI3K/AKT axis. Fish Shellfish Immunol. 2022, 130, 309–316. [Google Scholar] [CrossRef] [Scilit]
- Lihui, X.; Jinming, G.; Yalin, G.; Hemeng, W.; Hao, W.; Ying, C. Albicanol inhibits the toxicity of profenofos to grass carp hepatocytes cells through the ROS/PTEN/PI3K/AKT axis. Fish Shellfish Immunol. 2022, 120, 325–336. [Google Scholar] [CrossRef] [Scilit]
- Frei, B.; Higdon, J.V. Antioxidant Activity of Tea Polyphenols In Vivo: Evidence from Animal Studies. J. Nutr. 2003, 133, 3275S–3284S. [Google Scholar] [CrossRef] [Scilit]
- Xu, R.; Han, F.X.; Wang, H.R.; Wang, J.J.; Cai, Z.L.; Guo, M.Y. Tea polyphenols alleviate TBBPA-induced inflammation, ferroptosis and apoptosis via TLR4/NF-κB pathway in carp gills. Fish Shellfish Immunol. 2024, 146, 109382. [Google Scholar] [CrossRef] [Scilit]
- Zhao, X.; Shi, X.; Liu, Q.; Li, X. Tea polyphenols alleviates acetochlor-induced apoptosis and necroptosis via ROS/MAPK/NF-κB signaling in Ctenopharyngodon idellus kidney cells. Aquat. Toxicol. 2022, 246, 106153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mommsen, T.P.; Moon, T.W.; Walsh, P.J. Chapter 30—Hepatocytes: Isolation, maintenance and utilization. In Biochemistry and Molecular Biology of Fishes; Hochachka, P.W., Mommsen, T.P., Eds.; Elsevier: Amsterdam, The Netherlands, 1994; pp. 355–373. [Google Scholar]
- Qian, M.; Yang, J.; Xue, Y.; Wu, J.; Li, Z.; Luo, J.; Zhao, B.; Gao, X. Tea Polyphenol Protects the Immune Barrier and Inhibits TLR2/NF-κB/MLCK Signal Activation to Prevent Inflammatory Injury in the Intestines of Common Carp (Cyprinus carpio L.). Animals 2025, 15, 387. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, F.; Zhang, Q.; Cui, J.; Bao, B.; Deng, X.; Liu, L.; Guo, M.-Y. Polystyrene microplastics induce endoplasmic reticulum stress, apoptosis and inflammation by disrupting the gut microbiota in carp intestines. Environ. Pollut. 2023, 323, 121233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cui, J.; Xu, T.; Lv, H.; Guo, M.-Y. Zinc deficiency causes oxidative stress, endoplasmic reticulum stress, apoptosis and inflammation in hepatocytes in grass carp. Fish Shellfish Immunol. 2023, 139, 108905. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Q.; Wang, F.; Xu, S.; Cui, J.; Li, K.; Shiwen, X.; Guo, M.-Y. Polystyrene microplastics induce myocardial inflammation and cell death via the TLR4/NF-κB pathway in carp. Fish Shellfish Immunol. 2023, 135, 108690. [Google Scholar] [CrossRef] [Scilit]
- Xu, T.; Cui, J.; Xu, R.; Cao, J.; Guo, M.-Y. Microplastics induced inflammation and apoptosis via ferroptosis and the NF-κB pathway in carp. Aquat. Toxicol. 2023, 262, 106659. [Google Scholar] [CrossRef] [Scilit]
- Osako, M.; Kim, Y.-J.; Sakai, S.-I. Leaching of brominated flame retardants in leachate from landfills in Japan. Chemosphere 2004, 57, 1571–1579. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Z.; Zhao, F.; Cairang, Z.; Zhou, Z.; Du, Q.; Wang, J.; Zhao, F.; Wang, Q.; Li, Z.; Zhang, X. Role of dietary tea polyphenols on growth performance and gut health benefits in juvenile hybrid sturgeon (Acipenser baerii ♀ × A. schrenckii ♂). Fish Shellfish Immunol. 2023, 139, 108911. [Google Scholar] [CrossRef] [Scilit]
- Zhang, R.; Liu, L.L.; Wang, X.W.; Guo, C.Y.; Zhu, H. Dietary tea polyphenols induce changes in immune response and intestinal microbiota in Koi carp, cryprinus carpio. Aquaculture 2020, 516, 734636. [Google Scholar] [CrossRef] [Scilit]
- Ma, Y.-B.; Jiang, W.-D.; Wu, P.; Liu, Y.; Jiang, J.; Kuang, S.-Y.; Tang, L.; Zhou, X.-Q.; Feng, L. Tea polyphenol alleviate Aeromonas hydrophila—induced intestinal physical barrier damage in grass carp (Ctenopharyngodon idella). Aquaculture 2021, 544, 737067. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Zhao, A.; Wang, B.; Zhang, Y.; Han, Q.; Yang, E.; He, H.; Wei, C.; Yang, Y.; Xu, J.; et al. Assessing the human health risks from organophosphate esters: Exposure assessment via wild freshwater fish consumption. Food Chem. 2025, 492, 145339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, G.; Chadha, P. Toxic effects of aniline in liver, gills and kidney of freshwater fish Channa punctatus after acute exposure. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2024, 281, 109916. [Google Scholar] [CrossRef] [Scilit]
- Zhou, H.; Yin, N.; Faiola, F. Tetrabromobisphenol A (TBBPA): A controversial environmental pollutant. J. Environ. Sci. 2020, 97, 54–66. [Google Scholar] [CrossRef] [Scilit]
- Zhang, M.; Wang, S.; Sun, L.; Gan, L.; Lin, Y.; Shao, J.; Jiang, H.; Li, M. Ammonia induces changes in carbamoyl phosphate synthetase I and its regulation of glutamine synthesis and urea cycle in yellow catfish Pelteobagrus fulvidraco. Fish Shellfish Immunol. 2022, 120, 242–251. [Google Scholar] [CrossRef] [Scilit]
- Naiel, M.A.E.; El-Naby, A.S.A.; Samir, F.; Negm, S.S. Effects of dietary Thalassodendron Ciliatum supplementation on biochemical-immunological, antioxidant and growth indices of Oreochromis niloticus exposed to ammonia toxicity. Aquaculture 2024, 585, 740702. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Wang, X.; Chen, C.; An, J.; Shang, Y.; Li, H.; Xia, H.; Yu, J.; Wang, C.; Liu, Y.; et al. Regulation of TBBPA-induced oxidative stress on mitochondrial apoptosis in L02 cells through the Nrf2 signaling pathway. Chemosphere 2019, 226, 463–471. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Branicky, R.; Noë, A.; Hekimi, S. Superoxide dismutases: Dual roles in controlling ROS damage and regulating ROS signaling. J. Cell. Biol. 2018, 217, 1915–1928. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Q.; Wang, S.; Wang, F.; Guo, M.; Xu, S. TBBPA induces inflammation, apoptosis, and necrosis of skeletal muscle in mice through the ROS/Nrf2/TNF-α signaling pathway. Environ. Pollut. 2023, 317, 120745. [Google Scholar] [CrossRef] [Scilit]
- Yan, Z.; Zhong, Y.; Duan, Y.; Chen, Q.; Li, F. Antioxidant mechanism of tea polyphenols and its impact on health benefits. Anim. Nutr. 2020, 6, 115–123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahmed, N.A.; Radwan, N.M.; Ezz, H.S.A.; Salama, N.A. The antioxidant effect of Green Tea Mega EGCG against electromagnetic radiation-induced oxidative stress in the hippocampus and striatum of rats. Electromagn. Biol. Med. 2017, 36, 63–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Z.; Jiang, W.-J.; Wang, Y.-P.; Si, J.-Q.; Zeng, X.-S.; Li, L. CD36-mediated ROS/PI3K/AKT signaling pathway exacerbates cognitive impairment in APP/PS1 mice after noise exposure. Sci. Total Environ. 2024, 952, 175879. [Google Scholar] [CrossRef] [Scilit]
- Zha, L.; Chen, J.; Sun, S.; Mao, L.; Chu, X.; Deng, H.; Cai, J.; Li, X.; Liu, Z.; Cao, W. Soyasaponins can blunt inflammation by inhibiting the reactive oxygen species-mediated activation of PI3K/Akt/NF-kB pathway. PLoS ONE 2014, 9, e107655. [Google Scholar] [CrossRef] [Scilit]
- Zhang, M.; Jang, H.; Nussinov, R. The mechanism of PI3Kα activation at the atomic level. Chem. Sci. 2019, 10, 3671–3680. [Google Scholar] [CrossRef] [Scilit]
- Lv, H.; Wang, J.; Geng, Y.; Xu, T.; Han, F.; Gao, X.J.; Guo, M.Y. Green tea polyphenols inhibit TBBPA-induced lung injury via enhancing antioxidant capacity and modulating the NF-κB pathway in mice. Food Funct. 2024, 15, 3411–3419. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Li, Y.; Liu, S.; Yu, X.; Li, L.; Shi, C.; He, W.; Li, J.; Xu, L.; Hu, Z.; et al. Direct activation of RIP3/MLKL-dependent necrosis by herpes simplex virus 1 (HSV-1) protein ICP6 triggers host antiviral defense. Proc. Natl. Acad. Sci. USA 2014, 111, 15438–15443. [Google Scholar] [CrossRef] [Scilit]






| Gene | Forward Primer (5′→3′) | Reverse Primer (5′→3′) | Accession Number |
|---|---|---|---|
| PI3K | CGGGAAACGAGCTCAATCAT | CTCTCCAACAAATCCGCTCG | KY763989 |
| AKT | CAACGGATGCGTCGTCTTCA | GTGTGAGTCTCCAAACCCCT | JX307852 |
| IKB-α | GGCTACGCCAAAGACCTG | CGGACCTCGCCATTCATA | AK313421 |
| NF-κB p65 | GAAGAAGGATGTGGGAGATG | TGTTGTCGTAGATGGGCTGAG | MN167531 |
| IL-1β | CTTCCACCCTCACAAACACATTCAAC | AATATAGCGTCCAAGGCGTTCCATC | EU047716 |
| IL-6 | CCGCATGGACTCGCAAGACG | CGGTAGTTGATGTACTCGTCCTCC | KC858890 |
| TNF-α | TCATGGGAGTAAGGCTGGTATT | TCTTCAAAGGAATACAGGGGCT | LN593053 |
| Caspase-3 | GCTGTGCTTCGTTAGTGT | GAACCAAGAACCGCTCAT | JAEOAB010000019 |
| Bax | ATGCGTGAATAAGGAGATGA | AGACCGAAGACCGTTACT | KJ174685 |
| Bcl-2 | GATACCGCAAGATTCCATACCC | TCCTTTCTATCTCGTCTCCAG | KJ174686 |
| RIPK1 | GGCTGCGTCGTTTGATA | GTTGGCACCCACGTTCT | MN123251 |
| RIPK3 | CAACGATGCCGTCTATGA | GAAGGAGCTGTTTGGTGTCT | OY720469 |
| MLKL | CTGGCACAACAATCTGA | GAGACGCTGTAGAAGGAC | BC028141 |
| GAPDH | GTTACAAGGGAGAAGTTCACCAT | CCGGTAGACTCGACTACATACAG | AJ870982 |
| Name | Cat No. | Company | Dilution Times |
|---|---|---|---|
| p-PI3K | AF5905 | Beyotime Biotechnology Co., Ltd., Shanghai, China | 1:2000 |
| P-AKT | AA329 | Beyotime Biotechnology Co., Ltd., Shanghai, China | 1:1000 |
| NF-κB p65 | AF1234 | Beyotime Biotechnology Co., Ltd., Shanghai, China | 1:1000 |
| P-NF-κB p65 | AF5875 | Beyotime Biotechnology Co., Ltd., Shanghai, China | 1:1000 |
| IKB-α | AF1282 | Beyotime Biotechnology Co., Ltd., Shanghai, China | 1:1000 |
| p-IKB-α | AF1870 | Beyotime Biotechnology Co., Ltd., Shanghai, China | 1:1000 |
| Bax | WL01637 | Wanlei Life Sciences Co., Ltd., Shenyang, China | 1:500 |
| Bcl-2 | WL01556 | Wanlei Life Sciences Co., Ltd., Shenyang, China | 1:500 |
| Caspase-3 | WL04004 | Wanlei Life Sciences Co., Ltd., Shenyang, China | 1:500 |
| RIPK3 | 47928T | Cell Signaling Technology, Inc., Boston, MA, USA | 1:1000 |
| p-RIPK3 | 93654T | Cell Signaling Technology, Inc., Boston, MA, USA | 1:1000 |
| MLKL | 14993T | Cell Signaling Technology, Inc., Boston, MA, USA | 1:1000 |
| p-MLKL | 3733T | Cell Signaling Technology, Inc., Boston, MA, USA | 1:1000 |
| GAPDH | WL01114 | Wanlei Life Sciences Co., Ltd., Shenyang, China | 1:1000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, F.; Xu, R.; Wang, H.; Gao, X.; Guo, M. Tea Polyphenols Mitigate TBBPA-Induced Renal Injury Through Modulation of ROS-PI3K/AKT-NF-κB Signalling in Carp (Cyprinus carpio). Animals 2025, 15, 2307. https://doi.org/10.3390/ani15152307
Han F, Xu R, Wang H, Gao X, Guo M. Tea Polyphenols Mitigate TBBPA-Induced Renal Injury Through Modulation of ROS-PI3K/AKT-NF-κB Signalling in Carp (Cyprinus carpio). Animals. 2025; 15(15):2307. https://doi.org/10.3390/ani15152307
Chicago/Turabian StyleHan, Fuxin, Ran Xu, Hongru Wang, Xuejiao Gao, and Mengyao Guo. 2025. "Tea Polyphenols Mitigate TBBPA-Induced Renal Injury Through Modulation of ROS-PI3K/AKT-NF-κB Signalling in Carp (Cyprinus carpio)" Animals 15, no. 15: 2307. https://doi.org/10.3390/ani15152307
APA StyleHan, F., Xu, R., Wang, H., Gao, X., & Guo, M. (2025). Tea Polyphenols Mitigate TBBPA-Induced Renal Injury Through Modulation of ROS-PI3K/AKT-NF-κB Signalling in Carp (Cyprinus carpio). Animals, 15(15), 2307. https://doi.org/10.3390/ani15152307

