Tree Shade Improves Milking Performance, Apparent Digestibility, Antioxidant Capacity, and Immunity of Dairy Cows in Open Sheds
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of Experimental Cowsheds
2.2. Experimental Design
2.3. Physiological Parameters Measurement
2.4. Milk Sampling and Analysis
2.5. Feed and Fecal Sampling and Analysis
2.6. Blood Sampling and Measurement
2.6.1. Blood Sampling
2.6.2. Serum Biochemistry
2.6.3. Gene Expression
2.7. Statistical Analysis
3. Results
3.1. Changes of Ambient Temperature and Relative Humidity in Cowsheds
3.2. Effects of Shade on Physiological Parameters and Milking Performance in Dairy Cows
3.3. Effects of Shade on Apparent Nutrient Digestibility in Dairy Cows
3.4. Effects of Shade on Antioxidant Enzyme Activities in Serum of Dairy Cows
3.5. Effects of Shade on Immune Property in Serum of Dairy Cows
3.6. Effects of Shade on Gene Expression in Serum of Dairy Cows
4. Discussion
4.1. Effects of Tree Shades on Physiology Properties in Dairy Cows
4.2. Effects of Tree Shades on Milking Performance and Apparent Digestibility in Dairy Cows
4.3. Effects of Tree Shades on HSPs and Antioxidant Capacity in Dairy Cows
4.4. Effects of Tree Shades on Immunity in Dairy Cows
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- He, Q. Effects of Heat Stress on Performance and Nutritional Metabolism of Dairy Cows in Different Lactation Stages. Master’s Thesis, Southwest University, Chongqing, China, 2012. [Google Scholar]
- Tu, P.; Yeh, Y.; Chen, Y.; Shiau, J.; Lin, T.; Banhazi, T.; Yang, M. Stage-specific milk yield losses and associated sweating, respiration, and rectal temperature responses under varying temperature-humidity index thresholds in lactating and dry cows. J. Dairy Sci. 2025, 108, 2023–2035. [Google Scholar] [CrossRef] [PubMed]
- Sammad, A.; Umer, S.; Shi, R.; Zhu, H.; Zhao, X.; Wang, Y. Dairy cow reproduction under the influence of heat stress. J. Anim. Physiol. Anim. Nutr. 2020, 104, 978–986. [Google Scholar] [CrossRef] [PubMed]
- Held-Montaldo, R.; Cartes, D.; Sepúlveda-Varas, P. Behavioral changes in dairy cows with metritis in seasonal calving pasture-based dairy system. J. Dairy Sci. 2021, 104, 12066–12078. [Google Scholar] [CrossRef]
- Müschner-Siemens, T.; Hoffmann, G.; Ammon, C.; Amon, T. Daily rumination time of lactating dairy cows under heat stress conditions. J. Therm. Biol. 2020, 88, 102484. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Guo, M.; Liang, Y.; Zhou, F.; Zhang, H.; Li, M.; Yang, Z.; Karrow, N.; Mao, Y. Breed-specific responses and ruminal microbiome shifts in dairy cows under heat stress. Animals 2025, 15, 817. [Google Scholar] [CrossRef]
- Dikmen, S.; Larson, C.C.; De Vries, A.; Hansen, P.J. Effectiveness of tunnel ventilation as dairy cow housing in hot climates: Rectal temperatures during heat stress and seasonal variation in milk yield. Trop. Anim. Health Prod. 2020, 52, 2687–2693. [Google Scholar] [CrossRef]
- Mammi, L.M.E.; Palmonari, A.; Fustini, M.; Cavallini, D.; Canestrari, G.; Chapman, J.; McLean, D.; Formigoni, A. Immunomodulant feed supplement to support dairy cows health and milk quality evaluated in Parmigiano Reggiano cheese production. Anim. Feed Sci. Technol. 2018, 242, 21–30. [Google Scholar] [CrossRef]
- Besteiro, R.; Fouz, R.; Diéguez, F.J. Influence of Heat Stress on Milk Production, Milk Quality, and Somatic Cell Count in Galicia (NW Spain). Animals 2025, 15, 945. [Google Scholar] [CrossRef]
- Gunn, K.M.; Holly, M.A.; Veith, T.L.; Buda, A.R.; Prasad, R.; Rotz, C.A.; Soder, K.J.; Stoner, A.M.K. Projected heat stress challenges and abatement opportunities for U.S. milk production. PLoS ONE 2019, 14, e214665. [Google Scholar] [CrossRef]
- Zhao, W.; Choi, C.; Li, D.; Yan, G.; Li, H.; Shi, Z. Effects of airspeed on the respiratory rate, rectal temperature, and immunity parameters of dairy calves housed individually in an Axial-Fan-Ventilated Barn. Animals 2021, 11, 354. [Google Scholar] [CrossRef]
- Calegari, F.; Calamari, L.; Frazzi, E. Cooling systems of the resting area in free stall dairy barn. Int. J. Biometeorol. 2016, 60, 605–614. [Google Scholar] [CrossRef] [PubMed]
- Edwards-Callaway, L.N.; Cramer, M.C.; Cadaret, C.N.; Bigler, E.J.; Engle, T.E.; Wagner, J.J.; Clark, D.L. Impacts of shade on cattle well-being in the beef supply chain. J. Anim. Sci. 2021, 99, skaa375. [Google Scholar] [CrossRef] [PubMed]
- Teixeira, B.E.; Nascimento, S.T.; Mos, J.; de Oliveira, E.M.; Dos Santos, V.M.; Maia, A.S.C.; Fonsêca, V.F.C.; Passos, B.M.; Murata, L.S. The potential of natural shade provided by Brazilian savanna trees for thermal comfort and carbon sink. Sci. Total Environ. 2022, 845, 157324. [Google Scholar] [CrossRef]
- Reis, N.S.; Ferreira, I.C.; Mazocco, L.A.; Souza, A.C.B.; Pinho, G.A.S.; da Fonseca Neto, Á.M.; Malaquias, J.V.; Macena, F.A.; Muller, A.G.; Martins, C.F.; et al. Shade modifies behavioral and physiological responses of low to medium production dairy cows at pasture in an integrated crop-livestock-forest system. Animals 2021, 11, 2411. [Google Scholar] [CrossRef]
- Schütz, K.E.; Cox, N.R.; Matthews, L.R. How important is shade to dairy cattle? Choice between shade or lying following different levels of lying deprivation. Appl. Anim. Behav. Sci. 2008, 114, 307–318. [Google Scholar] [CrossRef]
- Ripamonti, A.; Foggi, G.; Mantino, A.; Turini, L.; Turini, L.; Goracci, J.; Silvi, A.; Finocchi, M.; Mele, M. Beef cattle performance and hair cortisol accumulation in silvopastoral and pastoral systems: A 2-year assessment. Animal 2025, 19, 101425. [Google Scholar] [CrossRef]
- Cheng, H.F.; Liu, K.; Hu, N. Influence of solar radiation on heat transfer of building envelope in Hefei. J. Anhui Inst. Archit. Ind. 2016, 24, 47–50. [Google Scholar]
- Wang, H.; Cui, L.Y. Calculation algorithm of solar altitude angle and azimuth angle. Electron. Technol. Softw. Eng. 2015, 17, 167. [Google Scholar]
- National Research Council. Nutrient Requirements of Dairy Cattle; The National Academies Press: Washington, DC, USA, 2001. [Google Scholar]
- Dißmann, L.; Heinicke, J.; Jensen, K.C.; Amon, T.; Hoffmann, G. How should the respiration rate be counted in cattle? Vet. Res. Commun. 2022, 46, 1221–1225. [Google Scholar] [CrossRef]
- Yan, P.; Li, R. Domestic Animal Environmental Hygiology, 4th ed.; Higher Education Press: Beijing, China, 2003. [Google Scholar]
- Cavallini, D.; Mammi, L.M.E.; Fustini, M.; Palmonari, A.; Heinrichs, A.J.; Formigoni, A. Effects of ad libitum or restricted access to total mixed ration with supplemental long hay on production, intake, and rumination. J. Dairy Sci. 2018, 101, 10922–10928. [Google Scholar] [CrossRef]
- Tyrrell, H.F.; Reid, J.T. Prediction of the energy value of cow’s milk. J. Dairy Sci. 1965, 48, 1215–1223. [Google Scholar] [CrossRef] [PubMed]
- Silva, S.N.; Chabrillat, T.; Kerros, S.; Guillaume, S. Effects of plant extract supplementations or monensin on nutrient intake, digestibility, ruminal fermentation and metabolism in dairy cows. Anim. Feed Sci. Tech. 2021, 275, 114886. [Google Scholar] [CrossRef]
- Cavallini, D.; Palmonari, A.; Mammi, L.; Ghiaccio, F.; Canestrari, G.; Formigoni, A. Evaluation of fecal sampling time points to estimate apparent nutrient digestibility in lactating Holstein dairy cows. Front. Vet. Sci. 2022, 9, 1065258. [Google Scholar] [CrossRef] [PubMed]
- Masebo, N.T.; Marliani, G.; Cavallini, D.; Accorsi, P.; Di Pietro, M.; Beltrame, A.; Gentile, A.; Jacinto, J. Health and welfare assessment of beef cattle during the adaptation period in a specialized commercial fattening unit. Res. Vet. Sci. 2023, 158, 50–55. [Google Scholar] [CrossRef]
- Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef] [PubMed]
- Keulen, J.V.; Young, B.A. Evaluation of acid-Insoluble ash as a natural marker in ruminant digestibility studies. J. Anim. Sci. 1977, 44, 282–287. [Google Scholar] [CrossRef]
- Seyedin, S.; Mojtahedi, M.; Farhangfar, S.H.; Ghavipanje, N. Partial substitution of alfalfa hay by Berberis vulgaris leaf modulated the growth performance, meat quality and antioxidant status of fattening lambs. Vet. Med. Sci. 2022, 8, 2605–2615. [Google Scholar] [CrossRef]
- Geng, C.; Feng, X.; Luan, J.; Ji, S.; Jin, Y.; Zhang, M. Improved tenderness of beef from bulls supplemented with active dry yeast is related to matrix metalloproteinases and reduced oxidative stress. Animal 2022, 16, 100517. [Google Scholar] [CrossRef]
- Misra, H.P.; Fridovich, I. Superoxide dismutase and peroxidase: A positive activity stain applicable to polyacrylamide gel electropherograms. Arch. Biochem. Biophys. 1977, 183, 511–515. [Google Scholar] [CrossRef]
- Cavallini, D.; Mammi, L.; Buonaiuto, G.; Palmonari, A.; Valle, E.; Formigoni, A. Immune-metabolic-inflammatory markers in Holstein cows exposed to a nutritional and environmental stressing challenge. J. Anim. Physiol. Anim. Nutr. 2021, 105, 42–55. [Google Scholar] [CrossRef]
- Kumar, S.; Bass, B.E.; Bandrick, M.; Loving, C.L.; Brockmeier, S.L.; Looft, T.; Trachsel, J.; Madson, D.M.; Thomas, M.; Casey, T.A.; et al. Fermentation products as feed additives mitigate some ill-effects of heat stress in pigs. J. Anim. Sci. 2017, 95, 279–290. [Google Scholar] [CrossRef] [PubMed]
- Tao, S.; Connor, E.; Bubolz, J.; Thompson, I.; Amaral, B.D.; Hayen, M.; Dahl, G. Short communication: Effect of heat stress during the dry period on gene expression in mammary tissue and peripheral blood mononuclear cells. J. Dairy Sci. 2013, 96, 378–383. [Google Scholar] [CrossRef]
- Rocha-Martins, M.; Njaine, B.; Silveira, M.S. Avoiding pitfalls of internal controls: Validation of reference genes for analysis by qRT-PCR and Western blot throughout rat retinal development. PLoS ONE 2012, 7, e43028. [Google Scholar] [CrossRef]
- Bas, A.; Forsberg, G.; Hammarstrom, S.; Hammarstrom, M.L. Utility of the housekeeping genes 18S rRNA, beta-actin and glyceraldehyde-3-phosphate-dehydrogenase for normalization in real-time quantitative reverse transcriptase-polymerase chain reaction analysis of gene expression in human T lymphocytes. Scand. J. Immunol. 2004, 59, 566–573. [Google Scholar] [CrossRef]
- Morse, D.L.; Carroll, D.; Weberg, L.; Borgstrom, M.C.; Ranger-Moore, J.; Gillies, R.J. Determining suitable internal standards for mRNA quantification of increasing cancer progression in human breast cells by real-time reverse transcriptase polymerase chain reaction. Anal. Biochem. 2005, 342, 69–77. [Google Scholar] [CrossRef]
- Gujar, G.; Choudhary, V.K.; Vivek, P. Characterization of thermo-physiological, hematological, and molecular changes in response to seasonal variations in two tropically adapted native cattle breeds of Bos indicus lineage in hot arid ambience of Thar Desert. Int. J. Biometeorol. 2022, 66, 1515–1529. [Google Scholar] [CrossRef] [PubMed]
- Gujar, G.; Tiwari, M.; Yadav, N.; Monika. Heat stress adaptation in cows—Physiological responses and underlying molecular mechanisms. J. Therm. Biol. 2023, 118, 103740. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Ye, T.; Li, Z.; Li, J.; Jamil, A.M.; Zhou, Y.; Hua, G.; Liang, A.; Deng, T.; Yang, L. Identifying hub genes for heat tolerance in water buffalo (Bubalus bubalis) using transcriptome data. Front. Genet. 2019, 10, 209. [Google Scholar] [CrossRef]
- Hong, X.; Wei, T.; Jia, B.; Ma, C.; Jia, Y.; Yan, P. Environmental evaluation and heat insulation performance of beef cattle shed in Lingbi region of Anhui province. Anim. Husb. Vet. Med. 2012, 44, 28–33. [Google Scholar]
- Rhoads, M.; Rhoads, R.; VanBaale, M.; Collier, R.; Sanders, S.; Weber, W.; Crooker, B.; Baumgard, L. Effects of heat stress and plane of nutrition on lactating Holstein cows: I. Production, metabolism, and aspects of circulating somatotropin. J. Dairy Sci. 2009, 92, 1986–1997. [Google Scholar] [CrossRef]
- Polsky, L.; von Keyserlingk, M.A.G. Invited review: Effects of heat stress on dairy cattle welfare. J. Dairy Sci. 2017, 100, 8645–8657. [Google Scholar] [CrossRef] [PubMed]
- West, J.W. Effects of heat-stress on production in dairy cattle. J. Dairy Sci. 2003, 86, 2131–2144. [Google Scholar] [CrossRef] [PubMed]
- Domingos, H.G.T.; Maia, A.S.C.; Souza, J.B.F., Jr.; Silva, R.B.; Vieira, F.M.C.; Silva, R.G. Effect of shade and water sprinkling on physiological responses and milk yields of Holstein cows in a semi-arid region. Livest. Sci. 2013, 154, 169–174. [Google Scholar] [CrossRef]
- Bucklin, R.A.; Turner, L.W.; Beede, D.K.; Bray, D.R.; Hemken, R.W. Methods to relieve heat stress for dairy cows in hot, humid climates. Appl. Eng. Agric. 1991, 7, 241–247. [Google Scholar] [CrossRef]
- Abreu, A.S.; Fischer, V.; Stumpf, M.T.; McManus, C.M.; González, F.H.D.; da Silva, J.B.S.; Heisler, G. Natural tree shade increases milk stability of lactating dairy cows during the summer in the subtropics. J. Dairy Res. 2020, 87, 444–447. [Google Scholar] [CrossRef]
- Uyeno, Y.; Sekiguchi, Y.; Tajima, K.; Takenaka, A.; Kurihara, M.; Kamagata, Y. An Rrna-based analysis for evaluating the effect of heat stress on the rumen microbial composition of Holstein heifers. Anaerobe 2010, 1, 27–33. [Google Scholar] [CrossRef]
- Gallardo-Soler, A.; Macias-Garcia, B.; Garcia-Marin, L.J.; Bragado, M.J.; González-Fernández, L. Effect of boar semen supplementation with recombinant heat shock proteins during summer. Anim. Reprod. Sci. 2019, 211, 106227. [Google Scholar] [CrossRef] [PubMed]
- Bagath, M.; Krishnan, G.; Devaraj, C.; Rashamol, V.P.; Pragna, P.; Lees, A.M.; Sejian, V. The impact of heat stress on the immune system in dairy cattle: A review. Res. Vet. Sci. 2019, 126, 94–102. [Google Scholar] [CrossRef]
- Singh, K.M.; Singh, S.; Ganguly, I.; Nachiappan, R.K.; Ganguly, A.; Venkataramanan, R.; Chopra, A.; Narula, H.K. Association of heat stress protein 90 and 70 gene polymorphism with adaptability traits in Indian sheep (Ovis aries). Cell Stress Chaperon. 2017, 22, 675–684. [Google Scholar] [CrossRef]
- Orellana Rivas, R.M.; Marins, T.N.; Weng, X.; Monteiro, A.P.A.; Guo, J.; Gao, J.; Chen, Y.-C.; Woldemeskel, M.; Bernard, J.; Tomlinson, D. Effects of evaporative cooling and dietary zinc source on heat shock responses and mammary gland development in lactating dairy cows during summer. J. Dairy Sci. 2021, 104, 5021–5033. [Google Scholar] [CrossRef]
- Arnal, M.E.; Lallès, J.P. Gut epithelial inducible heat-shock proteins and their modulation by diet and the microbiota. Nutr. Rev. 2016, 74, 181–197. [Google Scholar] [CrossRef] [PubMed]
- Yu, M.-F.; Zhao, X.-M.; Cai, H.; Yi, J.-M.; Hua, G.-H. Dihydropyridine enhances the antioxidant capacities of lactating dairy cows under heat stress condition. Animals 2020, 10, 1812. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Gao, S.; Wang, K.; Xu, J.; Sanz-Fernandez, M.; Baumgard, L.; Bu, D. Effects of source on bioavailability of selenium, antioxidant status, and performance in lactating dairy cows during oxidative stress-inducing conditions. J. Dairy Sci. 2019, 102, 311–319. [Google Scholar] [CrossRef]
- Asea, A.; Rehli, M.; Kabingu, E.; Boch, J.A.; Bare, O.; Auron, P.E.; Stevenson, M.A.; Calderwood, S.K. Novel signal transduction pathway utilized by extracellular HSP70: Role of toll-like receptor (TLR) 2 and TLR4. J. Biol. Chem. 2002, 277, 15028–15034. [Google Scholar] [CrossRef] [PubMed]
- Ding, T.; Ge, S. Metabolic regulation of type 2 immune response during tissue repair and regeneration. J. Leukoc. Biol. 2022, 112, 1013–1023. [Google Scholar] [CrossRef]
- Xiao, Z.; Hu, X.; Jarjour, W.; Zheng, S. The role of B7 family members in the generation of Immunoglobulin. J. Leukoc. Biol. 2021, 109, 377–382. [Google Scholar] [CrossRef]
- Xu, H.; Huang, W.; Hou, Q.; Kwok, L.-Y.; Sun, Z.; Ma, H.; Zhao, F.; Lee, Y.-K.; Zhang, H. The effects of probiotics administration on the milk production, milk components and fecal bacteria microbiota of dairy cows. Sci. Bull. 2017, 62, 767–774. [Google Scholar] [CrossRef]





| Ingredient | % of DM | Chemical Composition | % of DM |
|---|---|---|---|
| Whole corn silage | 40.62 | NEI, MJ/kg | 6.75 |
| Oaten hay | 15.39 | CP | 14.08 |
| Steam flaked Corn | 14.41 | NDF | 40.43 |
| Soybean meal | 12.85 | ADF | 25.40 |
| Soybean hull | 11.55 | Ca | 0.64 |
| Cotton meal | 3.90 | P | 0.30 |
| Limestone | 0.10 | ||
| CaHPO4 | 0.15 | ||
| NaCl | 0.50 | ||
| NaHCO3 | 0.15 | ||
| Premix (1) | 0.45 | ||
| Total | 100.00 |
| Genes | Primer | Sequences(3′→5′) |
|---|---|---|
| SOD | Forward | TGCAGGTCCTCACTTTAATCC |
| Reverse | CAGCGTTGCCAGTCTTTGT | |
| HSP60 | Forward | GTAGCCGTTACTATGGGG |
| Reverse | TCCTTGGCAATAGAGCGT | |
| HSP70 | Forward | GACAAGTGCCAGGAGGTGATT |
| Reverse | AGTCTGCTGATGATGGGGTTA | |
| HSP90 | Forward | CCAGTACATGGAGGGCTTCA |
| Reverse | TCCTCTTCCTCGTATTCCTTCA | |
| IL-4 | Forward | AGTGCTGGTCTGCTTACTGG |
| Reverse | CTTTCTCGTTGTGAGGATGT | |
| GAPDH | Forward | AGGGCTGCTTTTAATTCTGGC |
| Reverse | TGACTGTGCCGTTGAACTTGC |
| Items | Early-Hot Season | Hot Season | Late-Hot Season | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CG | SG | SEM | p-Value | CG | SG | SEM | p-Value | CG | SG | SEM | p-Value | |
| Dry matter intake, kg | 20.30 | 20.49 | 0.16 | 0.32 | 18.42 | 20.05 | 0.24 | 0.02 | 22.28 | 22.79 | 0.32 | 0.18 |
| Milk yield, kg | 31.53 | 31.61 | 0.43 | 0.87 | 28.71 | 30.18 | 0.04 | 0.04 | 31.48 | 31.77 | 0.63 | 0.67 |
| 4% fat-corrected milk, kg | 27.71 | 27.93 | 0.40 | 0.59 | 28.19 | 29.65 | 0.08 | 0.03 | 28.54 | 28.50 | 0.50 | 0.95 |
| Milk composition | ||||||||||||
| Fat, % | 3.19 | 3.23 | 0.02 | 0.08 | 3.87 | 3.89 | 0.18 | 0.92 | 3.38 | 3.31 | 0.03 | 0.06 |
| Protein, % | 3.23 | 3.27 | 0.07 | 0.66 | 3.25 | 3.37 | 0.09 | 0.24 | 3.33 | 3.29 | 0.03 | 0.30 |
| Lactose, % | 5.35 | 5.35 | 0.03 | 1.00 | 5.25 | 5.23 | 0.02 | 0.45 | 5.14 | 5.10 | 0.02 | 0.20 |
| Total solid, % | 13.74 | 13.49 | 0.39 | 0.57 | 17.42 | 17.29 | 0.08 | 0.19 | 13.49 | 13.25 | 0.11 | 0.10 |
| Somatic cell count, ×104 ml | 7.11 | 6.52 | 0.89 | 0.54 | 20.70 | 20.26 | 0.84 | 0.63 | 9.11 | 8.07 | 1.05 | 0.38 |
| Urea nitrogen, mg/dl | 10.73 | 9.73 | 0.18 | 0.07 | 11.08 | 9.70 | 0.42 | 0.03 | 7.94 | 7.76 | 0.17 | 0.35 |
| Final days in milk | 217 | 219 | 4.32 | 0.67 | 274 | 268 | 3.64 | 0.23 | 240 | 247 | 3.59 | 0.14 |
| Items | Early-Hot Season | Hot Season | Late-Hot Season | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CG | SG | SEM | p-Value | CG | SG | SEM | p-Value | CG | SG | SEM | p-Value | |
| Dry matter, % | 76.0 | 76.4 | 0.50 | 0.47 | 74.5 | 75.4 | 0.42 | 0.24 | 75.6 | 77.0 | 0.94 | 0.23 |
| Crude protein, % | 75.6 | 75.6 | 0.84 | 0.91 | 65.7 | 68.0 | 0.72 | 0.03 | 75.2 | 76.0 | 0.50 | 0.25 |
| Ether extract, % | 77.7 | 77.1 | 0.49 | 0.29 | 73.8 | 74.4 | 0.42 | 0.26 | 77.8 | 77.6 | 0.91 | 0.86 |
| Neutral detergent fiber, % | 65.7 | 66.4 | 0.56 | 0.33 | 60.0 | 64.5 | 1.11 | 0.02 | 63.1 | 66.5 | 1.22 | 0.06 |
| Acid detergent fiber, % | 53.3 | 52.1 | 0.56 | 0.11 | 44.1 | 49.0 | 1.22 | 0.02 | 51.6 | 54.3 | 1.70 | 0.18 |
| Calcium, % | 32.7 | 32.7 | 0.50 | 0.94 | 28.1 | 29.2 | 0.46 | 0.08 | 31.8 | 32.3 | 0.99 | 0.69 |
| Phosphorus, % | 56.3 | 55.6 | 0.44 | 0.18 | 51.7 | 52.2 | 0.31 | 0.21 | 53.9 | 54.3 | 0.66 | 0.58 |
| Ash, % | 44.0 | 45.7 | 0.68 | 0.06 | 39.8 | 41.7 | 0.92 | 0.11 | 41.5 | 43.0 | 0.93 | 0.17 |
| Antioxidant Parameters | Early-Hot Season | Hot-Season | Late-Hot Season | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CG | SG | SEM | p-Value | CG | SG | SEM | p-Value | CG | SG | SEM | p-Value | |
| T-AOC, U/ml | 11.84 | 12.16 | 0.67 | 0.65 | 7.81 | 9.20 | 0.36 | 0.02 | 6.60 | 7.42 | 0.44 | 0.14 |
| SOD, U/ml | 71.70 | 73.87 | 1.90 | 0.32 | 52.99 | 61.55 | 1.98 | 0.02 | 44.75 | 50.40 | 1.21 | 0.02 |
| GSH-ST, U/L | 14.32 | 14.80 | 0.39 | 0.29 | 12.02 | 12.48 | 0.18 | 0.28 | 9.24 | 9.88 | 0.42 | 0.21 |
| MDA, nmol/ml | 3.19 | 2.83 | 0.20 | 0.14 | 4.25 | 4.43 | 0.05 | 0.21 | 6.23 | 5.89 | 0.14 | 0.07 |
| Immune Parameters | Early-Hot Season | Hot-Season | Late-Hot Season | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CG | SG | SEM | p-Value | CG | SG | SEM | p-Value | CG | SG | SEM | p-Value | |
| IgA, g/L | 0.91 | 0.85 | 0.05 | 0.26 | 0.60 | 0.60 | 0.01 | 0.91 | 0.52 | 0.59 | 0.04 | 0.22 |
| IgG, g/L | 13.15 | 12.44 | 0.33 | 0.10 | 6.92 | 8.17 | 0.41 | 0.04 | 8.66 | 9.56 | 0.73 | 0.33 |
| IgM, g/L | 3.70 | 3.51 | 0.13 | 0.20 | 1.35 | 1.61 | 0.09 | 0.04 | 0.98 | 1.06 | 0.04 | 0.20 |
| IL-4, g/L | 11.75 | 12.51 | 0.30 | 0.07 | 7.63 | 8.33 | 0.20 | 0.03 | 5.28 | 6.38 | 0.34 | 0.03 |
| IL-6, g/L | 132.06 | 130.32 | 1.01 | 0.16 | 164.41 | 165.01 | 3.02 | 0.86 | 181.05 | 175.79 | 5.32 | 0.38 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, J.; Zhou, Y.; Feng, M.; Song, L.; Liu, Y.; Yang, H.; Zhang, L.; Zhang, A.; Zhao, X.; Sun, X.; et al. Tree Shade Improves Milking Performance, Apparent Digestibility, Antioxidant Capacity, and Immunity of Dairy Cows in Open Sheds. Animals 2025, 15, 1673. https://doi.org/10.3390/ani15111673
Li J, Zhou Y, Feng M, Song L, Liu Y, Yang H, Zhang L, Zhang A, Zhao X, Sun X, et al. Tree Shade Improves Milking Performance, Apparent Digestibility, Antioxidant Capacity, and Immunity of Dairy Cows in Open Sheds. Animals. 2025; 15(11):1673. https://doi.org/10.3390/ani15111673
Chicago/Turabian StyleLi, Jianjie, Yinghao Zhou, Man Feng, Lianjie Song, Yuqing Liu, Haitong Yang, Lu Zhang, Ao Zhang, Xinnian Zhao, Xinsheng Sun, and et al. 2025. "Tree Shade Improves Milking Performance, Apparent Digestibility, Antioxidant Capacity, and Immunity of Dairy Cows in Open Sheds" Animals 15, no. 11: 1673. https://doi.org/10.3390/ani15111673
APA StyleLi, J., Zhou, Y., Feng, M., Song, L., Liu, Y., Yang, H., Zhang, L., Zhang, A., Zhao, X., Sun, X., Gao, Y., & Guo, J. (2025). Tree Shade Improves Milking Performance, Apparent Digestibility, Antioxidant Capacity, and Immunity of Dairy Cows in Open Sheds. Animals, 15(11), 1673. https://doi.org/10.3390/ani15111673
