Supplementation with Eupatilin during In Vitro Maturation Improves Porcine Oocyte Developmental Competence by Regulating Oxidative Stress and Endoplasmic Reticulum Stress
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection and IVM of Porcine Oocytes
2.2. Eupatilin Treatment
2.3. PA of Oocytes and In Vitro Culture (IVC)
2.4. Evaluation of Blastocyst Dimensions and Total Cell Counts
2.5. TUNEL Assay
2.6. Intracellular ROS and Glutathione (GSH) Level Assays
2.7. Measurement of Cathepsin B (CB) Activity
2.8. Immunofluorescence Staining
2.9. RNA Extraction and qRT-PCR Assay
2.10. Statistical Analysis
3. Results
3.1. Effects of Eupatilin Supplementation on Porcine Oocyte Maturation during IVM
3.2. Effects of Eupatilin Supplementation during IVM on Porcine Embryonic Developmental Capacity
3.3. Effects of Eupatilin Supplementation during IVM on Oxidative Stress Resistance in Porcine Oocytes
3.4. Effects of Eupatilin Supplementation during IVM on Apoptosis of Porcine Oocytes
3.5. Effects of Eupatilin Supplementation during IVM on DNA Double-Strand Breaks in Porcine Oocytes
3.6. Effects of Eupatilin Supplementation during IVM on ERS-Related Genes in Porcine Oocytes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Luo, D.; Zhang, J.B.; Li, S.P.; Liu, W.; Yao, X.R.; Guo, H.; Jin, Z.L.; Jin, Y.X.; Yuan, B.; Jiang, H.; et al. Imperatorin Ameliorates the Aging-Associated Porcine Oocyte Meiotic Spindle Defects by Reducing Oxidative Stress and Protecting Mitochondrial Function. Front. Cell Dev. Biol. 2020, 8, 592433. [Google Scholar] [CrossRef]
- Yao, X.; Jiang, H.; Li, Y.H.; Gao, Q.; Xu, Y.N.; Kim, N.H. Kaempferol alleviates the reduction of developmental competence during aging of porcine oocytes. Anim. Sci. J. Nihon Chikusan Gakkaiho 2019, 90, 1417–1425. [Google Scholar] [CrossRef] [PubMed]
- Jiang, W.J.; Liu, W.; Li, Y.H.; Jiang, H.; Xu, Y.N.; Kim, N.H. Citrinin impairs pig oocyte maturation by inducing oxidative stress and apoptosis. Toxicon Off. J. Int. Soc. Toxinology 2022, 205, 84–90. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Li, S.H.; Yang, S.J.; Li, X.Q.; Liu, L.; Ma, X.; Niu, D.; Duan, X. Exposure to phenanthrene affects oocyte meiosis by inducing mitochondrial dysfunction and endoplasmic reticulum stress. Cell Prolif. 2022, 56, e13335. [Google Scholar] [CrossRef] [PubMed]
- Ji, Y.M.; Zhang, K.H.; Pan, Z.N.; Ju, J.Q.; Zhang, H.L.; Liu, J.C.; Wang, Y.; Sun, S.C. High-dose zearalenone exposure disturbs G2/M transition during mouse oocyte maturation. Reprod. Toxicol. 2022, 110, 172–179. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; He, Q.K.; Xu, Z.R.; Xu, C.L.; Zhao, S.C.; Luo, Y.S.; Sun, X.; Qi, Z.Q.; Wang, H.L. Thiamethoxam Exposure Induces Endoplasmic Reticulum Stress and Affects Ovarian Function and Oocyte Development in Mice. J. Agric. Food Chem. 2021, 69, 1942–1952. [Google Scholar] [CrossRef]
- Cheong, J.H.; Hong, S.Y.; Zheng, Y.; Noh, S.H. Eupatilin Inhibits Gastric Cancer Cell Growth by Blocking STAT3-Mediated VEGF Expression. J. Gastric Cancer 2011, 11, 16–22. [Google Scholar] [CrossRef] [PubMed]
- Moscatelli, V.; Hnatyszyn, O.; Acevedo, C.; Megías, J.; Alcaraz, M.J.; Ferraro, G. Flavonoids from Artemisia copa with anti-inflammatory activity. Planta Medica 2006, 72, 72–74. [Google Scholar] [CrossRef]
- Jung, Y.; Kim, J.C.; Choi, Y.; Lee, S.; Kang, K.S.; Kim, Y.K.; Kim, S.N. Eupatilin with PPARα agonistic effects inhibits TNFα-induced MMP signaling in HaCaT cells. Biochem. Biophys. Res. Commun. 2017, 493, 220–226. [Google Scholar] [CrossRef]
- Kim, M.J.; Han, J.M.; Jin, Y.Y.; Baek, N.I.; Bang, M.H.; Chung, H.G.; Choi, M.S.; Lee, K.T.; Sok, D.E.; Jeong, T.S. In vitro antioxidant and anti-inflammatory activities of Jaceosidin from Artemisia princeps Pampanini cv. Sajabal. Arch. Pharmacal. Res. 2008, 31, 429–437. [Google Scholar] [CrossRef]
- Kim, J.S.; Lee, S.G.; Min, K.; Kwon, T.K.; Kim, H.J.; Nam, J.O. Eupatilin inhibits adipogenesis through suppression of PPARγ activity in 3T3-L1 cells. Biomed. Pharmacother. Biomed. Pharmacother. 2018, 103, 135–139. [Google Scholar] [CrossRef]
- Lee, D.C.; Oh, J.M.; Choi, H.; Kim, S.W.; Kim, S.W.; Kim, B.G.; Cho, J.H.; Lee, J.; Kim, J.S. Eupatilin Inhibits Reactive Oxygen Species Generation via Akt/NF-κB/MAPK Signaling Pathways in Particulate Matter-Exposed Human Bronchial Epithelial Cells. Toxics 2021, 9, 38. [Google Scholar] [CrossRef] [PubMed]
- Bai, D.; Sun, T.; Lu, F.; Shen, Y.; Zhang, Y.; Zhang, B.; Yu, G.; Li, H.; Hao, J. Eupatilin Suppresses OVA-Induced Asthma by Inhibiting NF-κB and MAPK and Activating Nrf2 Signaling Pathways in Mice. Int. J. Mol. Sci. 2022, 23, 1582. [Google Scholar] [CrossRef] [PubMed]
- Lu, X.; Deng, T.; Dong, H.; Han, J.; Yu, Y.; Xiang, D.; Nie, G.; Hu, B. Novel Application of Eupatilin for Effectively Attenuating Cisplatin-Induced Auditory Hair Cell Death via Mitochondrial Apoptosis Pathway. Oxidative Med. Cell. Longev. 2022, 2022, 1090034. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Wang, X.Q.; Liu, R.P.; Li, Y.H.; Yao, X.R.; Kim, N.H.; Xu, Y.N. Melatonin Supplementation during In Vitro Maturation of Porcine Oocytes Alleviates Oxidative Stress and Endoplasmic Reticulum Stress Induced by Imidacloprid Exposure. Animals 2023, 13, 2596. [Google Scholar] [CrossRef]
- Zhao, H.; Dong, Y.; Zhang, Y.; Wu, X.; Zhang, X.; Liang, Y.; Li, Y.; Zeng, F.; Shi, J.; Zhou, R.; et al. Supplementation of SDF1 during Pig Oocyte In Vitro Maturation Improves Subsequent Embryo Development. Molecules 2022, 27, 6830. [Google Scholar] [CrossRef]
- Qi, J.J.; Li, X.X.; Zhang, Y.; Diao, Y.F.; Hu, W.Y.; Wang, D.L.; Jiang, H.; Zhang, J.B.; Sun, B.X.; Liang, S. Supplementation with asiatic acid during in vitro maturation improves porcine oocyte developmental competence by regulating oxidative stress. Theriogenology 2021, 172, 169–177. [Google Scholar] [CrossRef]
- Li, J.; Wang, R.; Chen, Q.; Tian, Y.; Gao, L.; Lei, A. Salidroside improves porcine oocyte maturation and subsequent embryonic development by promoting lipid metabolism. Theriogenology 2022, 192, 89–96. [Google Scholar] [CrossRef] [PubMed]
- Paronetto, M.P.; Giorda, E.; Carsetti, R.; Rossi, P.; Geremia, R.; Sette, C. Functional interaction between p90Rsk2 and Emi1 contributes to the metaphase arrest of mouse oocytes. EMBO J. 2004, 23, 4649–4659. [Google Scholar] [CrossRef] [PubMed]
- Galloway, S.M.; McNatty, K.P.; Cambridge, L.M.; Laitinen, M.P.; Juengel, J.L.; Jokiranta, T.S.; McLaren, R.J.; Luiro, K.; Dodds, K.G.; Montgomery, G.W.; et al. Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nat. Genet. 2000, 25, 279–283. [Google Scholar] [CrossRef]
- Di Pasquale, E.; Beck-Peccoz, P.; Persani, L. Hypergonadotropic ovarian failure associated with an inherited mutation of human bone morphogenetic protein-15 (BMP15) gene. Am. J. Hum. Genet. 2004, 75, 106–111. [Google Scholar] [CrossRef]
- Alfonso-Pérez, T.; Hayward, D.; Holder, J.; Gruneberg, U.; Barr, F.A. MAD1-dependent recruitment of CDK1-CCNB1 to kinetochores promotes spindle checkpoint signaling. J. Cell Biol. 2019, 218, 1108–1117. [Google Scholar] [CrossRef]
- McEvoy, T.G.; Coull, G.D.; Broadbent, P.J.; Hutchinson, J.S.; Speake, B.K. Fatty acid composition of lipids in immature cattle, pig and sheep oocytes with intact zona pellucida. J. Reprod. Fertil. 2000, 118, 163–170. [Google Scholar] [CrossRef]
- Kalous, J.; Tetkova, A.; Kubelka, M.; Susor, A. Importance of ERK1/2 in Regulation of Protein Translation during Oocyte Meiosis. Int. J. Mol. Sci. 2018, 19, 698. [Google Scholar] [CrossRef]
- Jiang, W.J.; Hu, L.L.; Ren, Y.P.; Lu, X.; Luo, X.Q.; Li, Y.H.; Xu, Y.N. Podophyllotoxin affects porcine oocyte maturation by inducing oxidative stress-mediated early apoptosis. Toxicon Off. J. Int. Soc. Toxinology 2020, 176, 15–20. [Google Scholar] [CrossRef]
- Xiao, Y.; Yuan, B.; Hu, W.; Qi, J.; Jiang, H.; Sun, B.; Zhang, J.; Liang, S. Tributyltin Oxide Exposure During in vitro Maturation Disrupts Oocyte Maturation and Subsequent Embryonic Developmental Competence in Pigs. Front. Cell Dev. Biol. 2021, 9, 683448. [Google Scholar] [CrossRef]
- Hu, W.; Zhang, Y.; Wang, D.; Yang, T.; Qi, J.; Zhang, Y.; Jiang, H.; Zhang, J.; Sun, B.; Liang, S. Iron Overload-Induced Ferroptosis Impairs Porcine Oocyte Maturation and Subsequent Embryonic Developmental Competence in vitro. Front. Cell Dev. Biol. 2021, 9, 673291. [Google Scholar] [CrossRef]
- Liu, N.; Si, X.; Ji, Y.; Yang, Q.; Bai, J.; He, Y.; Jia, H.; Song, Z.; Chen, J.; Yang, L.; et al. l-Proline improves the cytoplasmic maturation of mouse oocyte by regulating glutathione-related redox homeostasis. Theriogenology 2022, 195, 159–167. [Google Scholar] [CrossRef] [PubMed]
- Du, L.; Chen, J.; Xing, Y.Q. Eupatilin prevents H2O2-induced oxidative stress and apoptosis in human retinal pigment epithelial cells. Biomed. Pharmacother. Biomed. Pharmacother. 2017, 85, 136–140. [Google Scholar] [CrossRef] [PubMed]
- Malhotra, J.D.; Kaufman, R.J. ER stress and its functional link to mitochondria: Role in cell survival and death. Cold Spring Harb. Perspect. Biol. 2011, 3, a004424. [Google Scholar] [CrossRef] [PubMed]
- Kato, H.; Nishitoh, H. Stress responses from the endoplasmic reticulum in cancer. Front. Oncol. 2015, 5, 93. [Google Scholar] [CrossRef] [PubMed]
- Guzel, E.; Arlier, S.; Guzeloglu-Kayisli, O.; Tabak, M.S.; Ekiz, T.; Semerci, N.; Larsen, K.; Schatz, F.; Lockwood, C.J.; Kayisli, U.A. Endoplasmic Reticulum Stress and Homeostasis in Reproductive Physiology and Pathology. Int. J. Mol. Sci. 2017, 18, 792. [Google Scholar] [CrossRef] [PubMed]
- Hetz, C.; Zhang, K.; Kaufman, R.J. Mechanisms, regulation and functions of the unfolded protein response. Nat. Rev. Mol. Cell Biol. 2020, 21, 421–438. [Google Scholar] [CrossRef] [PubMed]
- Qi, Z.; Chen, L. Endoplasmic Reticulum Stress and Autophagy. Adv. Exp. Med. Biol. 2019, 1206, 167–177. [Google Scholar] [CrossRef]









| Gene | Sequences 5′–3′ | Product Size (bp) | Accession Number |
|---|---|---|---|
| GAPDH | F: TTCCACGGCACAGTCAAG | 117 | NM_001206359.1 |
| R: ATACTCAGCACCAGCATCG | |||
| MOS | F: GGTGGTGGCCTACAATCTCC | 136 | NM_001113219.1 |
| R: TCAGCTTGTAGAGCGCGAAG | |||
| CCNB1 | F: CCAACTGGTTGGTGTCACTG | 195 | NM_001170768.1 |
| R: GCTCTCCGAAGAAAATGCAG | |||
| BMP15 | F: ATGCTGGAGTTGTACCAGCG | 87 | NM_001005155.2 |
| R: CTGAGAGGCCTTGCTCCATT | |||
| CAT | F: AACTGTCCCTTCCGTGCTA R: CCTGGGTGACATTATCTTCG | 83 | XM_021081498.1 |
| SIRT1 | F: GAGAAGGAAACAATGGGCCG R: ACCAAACAGAAGGTTATCTCGGT | 150 | NM_001145750.2 |
| SOD1 | F: CAAAGGATCAAGAGAGGCACG R: CGAGAGGGCGATCACAGAAT | 84 | NM_001190422.1 |
| BAX | F: GCTTCAGGGTTTCATCCAGGATCG R: ACTCGCTCAACTTCTTGGTAGATC | 107 | XM_003127290.5 |
| Caspase3 | F: TGTGGGATTGAGACGGACAG R: TTTCGCCAGGAATAGTAACCAGG | 116 | NM_214131.1 |
| GRP78 | F: CGGAGGAGGAGGACAAGAAGGAG R: ATATGACGGCGTGATGCGGTTG | 143 | XM_001927795.7 |
| IRE1 | F: ACCGTGGTGTCTCAGGATGTGG R: CCAGCCAATGAGCAGGAAGGTG | 126 | XM_005668695.3 |
| JNK | F: CTCGCTACTACAGAGCACCTG R: TTCTCCCATAATGCACCCCAC | 85 | XM_021073087.1 |
| ATF6 | F: GGAGTTAAGACAGCGCTTGG R: GAGATGTTCTGGAGGGGTGA | 142 | NM_001271738.1 |
| NANOG | F: TGTCTCTCCTCTTCCTTCCTCCATG R: TCCTCCTTCTCTGTGCTCTTCTCTG | 117 | NM_001129971.1 |
| OCT4 | F: CCTATGACTTCTGCGGAGGGA R: TTTGATGTCCTGGGACTCCTCG | 224 | XM_021097869.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Li, Y.-H.; Liu, R.-P.; Wang, X.-Q.; Zhu, M.-B.; Cui, X.-S.; Dai, Z.; Kim, N.-H.; Xu, Y.-N. Supplementation with Eupatilin during In Vitro Maturation Improves Porcine Oocyte Developmental Competence by Regulating Oxidative Stress and Endoplasmic Reticulum Stress. Animals 2024, 14, 449. https://doi.org/10.3390/ani14030449
Wang J, Li Y-H, Liu R-P, Wang X-Q, Zhu M-B, Cui X-S, Dai Z, Kim N-H, Xu Y-N. Supplementation with Eupatilin during In Vitro Maturation Improves Porcine Oocyte Developmental Competence by Regulating Oxidative Stress and Endoplasmic Reticulum Stress. Animals. 2024; 14(3):449. https://doi.org/10.3390/ani14030449
Chicago/Turabian StyleWang, Jing, Ying-Hua Li, Rong-Ping Liu, Xin-Qin Wang, Mao-Bi Zhu, Xiang-Shun Cui, Zhen Dai, Nam-Hyung Kim, and Yong-Nan Xu. 2024. "Supplementation with Eupatilin during In Vitro Maturation Improves Porcine Oocyte Developmental Competence by Regulating Oxidative Stress and Endoplasmic Reticulum Stress" Animals 14, no. 3: 449. https://doi.org/10.3390/ani14030449
APA StyleWang, J., Li, Y.-H., Liu, R.-P., Wang, X.-Q., Zhu, M.-B., Cui, X.-S., Dai, Z., Kim, N.-H., & Xu, Y.-N. (2024). Supplementation with Eupatilin during In Vitro Maturation Improves Porcine Oocyte Developmental Competence by Regulating Oxidative Stress and Endoplasmic Reticulum Stress. Animals, 14(3), 449. https://doi.org/10.3390/ani14030449

