Characterization of Three Novel Papillomavirus Genomes in Vampire Bats (Desmodus rotundus)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bat Capture and Sample Collection
2.2. High-Throughput Sequencing
2.3. Bioinformatic Analysis
2.4. Papillomaviridae Conventional PCR Screening
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Simmons, N.B.; Cirranello, A.L. Bat Species of the World: A Taxonomic and Geographic Database; Version 1.6; Available online: https://batnames.org/ (accessed on 10 September 2024).
 - Ramírez-fráncel, L.A.; García-herrera, L.V.; Losada-prado, S.; Reinoso-flórez, G.; Sánchez-hernández, A.; Estrada-villegas, S.; Lim, B.K.; Guevara, G. Bats and Their Vital Ecosystem Services: A Global Review. Integr. Zool. 2022, 17, 2–23. [Google Scholar] [CrossRef] [PubMed]
 - Quintela, F.M.; Da Rosa, C.A.; Feijó, A. Updated and Annotated Checklist of Recent Mammals from Brazil. An. Acad. Bras. Cienc. 2020, 92, 20191004. [Google Scholar] [CrossRef] [PubMed]
 - Nogueira, M.R.; de Lima, I.P.; Moratelli, R.; Tavares, V.D.C.; Gregorin, R.; Peracchi, A.L. Checklist of Brazilian Bats, with Comments on Original Records. Check List 2014, 10, 808–821. [Google Scholar] [CrossRef]
 - Kuzmin, I.V.; Rupprecht, C.E. Bat Rabies, 2nd ed.; Academic Press: Oxford, UK, 2007; pp. 259–307. [Google Scholar]
 - Apoorva; Singh, S.K. A Tale of Endurance: Bats, Viruses and Immune Dynamics. Future Microbiol. 2024, 19, 841–856. [Google Scholar] [CrossRef]
 - de Souza, W.M.; Fumagalli, M.J.; Carrera, J.P.; de Araujo, J.; Cardoso, J.F.; de Carvalho, C.; Durigon, E.L.; Queiroz, L.H.; Faria, N.R.; Murcia, P.R.; et al. Paramyxoviruses from Neotropical Bats Suggest a Novel Genus and Nephrotropism. Infect. Genet. Evol. 2021, 95, 105041. [Google Scholar] [CrossRef]
 - Jones, K.E.; Patel, N.G.; Levy, M.A.; Storeygard, A.; Balk, D.; Gittleman, J.L.; Daszak, P. Global Trends in Emerging Infectious Diseases. Nature 2008, 451, 990–993. [Google Scholar] [CrossRef]
 - Meadows, A.J.; Stephenson, N.; Madhav, N.K.; Oppenheim, B. Historical Trends Demonstrate a Pattern of Increasingly Frequent and Severe Spillover Events of High-Consequence Zoonotic Viruses. BMJ Glob. Health 2023, 8, e012026. [Google Scholar] [CrossRef]
 - Ellwanger, J.H.; Fearnside, P.M.; Ziliotto, M.; María Valverde-Villegas, J.; Beatriz, A.; Da Veiga, G.; Vieira, G.F.; Bach, E.; Cardoso, J.C.; Müller, F.D.; et al. Synthesizing the Connections between Environmental Disturbances and Zoonotic Spillover. An. Acad. Bras. Ciências 2022, 94, e20211530. [Google Scholar] [CrossRef]
 - Van Doorslaer, K. Revisiting Papillomavirus Taxonomy: A Proposal for Updating the Current Classification in Line with Evolutionary Evidence. Viruses 2022, 14, 2308. [Google Scholar] [CrossRef]
 - Van Doorslaer, K.; Chen, Z.; Bernard, H.U.; Chan, P.K.S.; Desalle, R.; Dillner, J.; Forslund, O.; Haga, T.; McBride, A.A.; Villa, L.L.; et al. ICTV Virus Taxonomy Profile: Papillomaviridae. J. Gen. Virol. 2018, 99, 989–990. [Google Scholar] [CrossRef]
 - Kraberger, S.; Austin, C.; Farkas, K.; Desvignes, T.; Postlethwait, J.H.; Fontenele, R.S.; Schmidlin, K.; Bradley, R.W.; Warzybok, P.; Van Doorslaer, K.; et al. Discovery of Novel Fish Papillomaviruses: From the Antarctic to the Commercial Fish Market. Virology 2022, 565, 65–72. [Google Scholar] [CrossRef] [PubMed]
 - Alves, C.D.B.T.; Weber, M.N.; Guimarães, L.L.B.; Cibulski, S.P.; da Silva, F.R.C.; Daudt, C.; Budaszewski, R.F.; Silva, M.S.; Mayer, F.Q.; Bianchi, R.M.; et al. Canine Papillomavirus Type 16 Associated to Squamous Cell Carcinoma in a Dog: Virological and Pathological Findings. Braz. J. Microbiol. 2020, 51, 2087–2094. [Google Scholar] [CrossRef] [PubMed]
 - Daudt, C.; Da Silva, F.R.C.; Lunardi, M.; Alves, C.B.D.T.; Weber, M.N.; Cibulski, S.P.; Alfieri, A.F.; Alfieri, A.A.; Canal, C.W. Papillomaviruses in Ruminants: An Update. Transbound. Emerg. Dis. 2018, 65, 1381–1395. [Google Scholar] [CrossRef] [PubMed]
 - Carpenter, J.L.; Kreider, J.W.; Alroy, J.; Schmidt, G.M. Cutaneous Xanthogranuloma and Viral Papilloma on an Eyelid of a Cat. Vet. Dermatol. 1992, 3, 187–190. [Google Scholar] [CrossRef]
 - Cubie, H.A. Diseases Associated with Human Papillomavirus Infection. Virology 2013, 445, 21–34. [Google Scholar] [CrossRef]
 - Correa, R.M.; Baena, A.; Valls, J.; Colucci, M.C.; Mendoza, L.; Rol, M.; Wiesner, C.; Ferrera, A.; Fellner, M.D.; González, J.V.; et al. Distribution of Human Papillomavirus Genotypes by Severity of Cervical Lesions in HPV Screened Positive Women from the ESTAMPA Study in Latin America. PLoS ONE 2022, 17, e0272205. [Google Scholar] [CrossRef]
 - Peh, W.L.; Middleton, K.; Christensen, N.; Nicholls, P.; Egawa, K.; Sotlar, K.; Brandsma, J.; Percival, A.; Lewis, J.; Liu, W.J.; et al. Life Cycle Heterogeneity in Animal Models of Human Papillomavirus-Associated Disease. J. Virol. 2002, 76, 10401–10416. [Google Scholar] [CrossRef]
 - Munday, J.S.; Hanlon, E.M.; Howe, L.; Squires, R.A.; French, A.F. Feline Cutaneous Viral Papilloma Associated with Human Papillomavirus Type 9. Vet. Pathol. 2007, 44, 924–927. [Google Scholar] [CrossRef]
 - Da Silva, M.A.R.; Carvalho, C.C.R.; Coutinho, L.C.A.; Reis, M.C.; De Aragão Batista, M.V.; De Castro, R.S.; Dos Anjos, F.B.R.; De Freitas, A.C. Co-Infection of Bovine Papillomavirus and Feline-Associated Papillomavirus in Bovine Cutaneous Warts. Transbound. Emerg. Dis. 2012, 59, 539–543. [Google Scholar] [CrossRef]
 - Orbell, G.M.B.; Young, S.; Munday, J.S. Cutaneous Sarcoids in Captive African Lions Associated with Feline Sarcoid-Associated Papillomavirus Infection. Vet. Pathol. 2011, 48, 1176–1179. [Google Scholar] [CrossRef]
 - Nasir, L.; Campo, M.S. Bovine Papillomaviruses: Their Role in the Aetiology of Cutaneous Tumours of Bovids and Equids. Vet. Dermatol. 2008, 19, 243–254. [Google Scholar] [CrossRef] [PubMed]
 - Lunardi, M.; De Alcântara, B.K.; Otonel, R.A.A.; Rodrigues, W.B.; Alfieri, A.F.; Alfieri, A.A. Bovine Papillomavirus Type 13 DNA in Equine Sarcoids. J. Clin. Microbiol. 2013, 51, 2167–2171. [Google Scholar] [CrossRef] [PubMed]
 - Van Dyk, E.; Bosman, A.-M.; Van Wilpe, E.; Williams, J.H.; Bengis, R.G.; Van Heerden, J.; Venter, E.H. Detection and Characterisation of Papillomavirus in Skin Lesions of Giraffe and Sable Antelope in South Africa. J. South Afr. Vet. Assoc. 2011, 82, 80–85. [Google Scholar] [CrossRef] [PubMed]
 - Daudt, C.; Da Silva, F.R.C.; Streck, A.F.; Weber, M.N.; Mayer, F.Q.; Cibulski, S.P.; Canal, C.W. How Many Papillomavirus Species Can Go Undetected in Papilloma Lesions? OPEN. Nat. Publ. Gr. 2016, 6, 36480. [Google Scholar] [CrossRef][Green Version]
 - Murahwa, A.T.; Meiring, T.L.; Mbulawa, Z.Z.A.; Williamson, A.L. Discovery, Characterisation and Genomic Variation of Six Novel Gammapapillomavirus Types from Penile Swabs in South Africa. Papillomavirus Res. 2019, 7, 102–111. [Google Scholar] [CrossRef]
 - Paietta, E.N.; Kraberger, S.; Regney, M.; Custer, J.M.; Ehmke, E.; Yoder, A.D.; Varsani, A. Interspecies Papillomavirus Type Infection and a Novel Papillomavirus Type in Red Ruffed Lemurs (Varecia rubra). Viruses 2023, 16, 37. [Google Scholar] [CrossRef]
 - Tatiane Sauthier, J.; Daudt, C.; Roberto Chaves da Silva, F.; Diniz Beduschi Travassos Alves, C.; Quoos Mayer, F.; Michel Bianchi, R.; Driemeier, D.; Silva Araujo Streit, R.; Christian Staats, C.; Wageck Canal, C.; et al. The Genetic Diversity of “Papillomavirome” in Bovine Teat Papilloma Lesions. Anim. Microbiome 2021, 3, 51. [Google Scholar] [CrossRef]
 - Bianchi, R.M.; Beduschi, C.D.; Alves, T.; Schwertz, I.C.; Panziera, W.; De Lorenzo, C.; Soares Da Silva, F.; Santana De Cecco, B.; Daudt, C.; Chaves, F.R.; et al. Molecular and Pathological Characterization of Teat Papillomatosis in Dairy Cows in Southern Brazil. Braz. J. Microbiol. 2020, 51, 369–375. [Google Scholar] [CrossRef]
 - da Silva, F.R.C.; Daudt, C.; Cibulski, S.P.; Weber, M.N.; Varela, A.P.M.; Mayer, F.Q.; Roehe, P.M.; Canal, C.W. Genome Characterization of a Bovine Papillomavirus Type 5 from Cattle in the Amazon Region, Brazil. Virus Genes 2017, 53, 130–133. [Google Scholar] [CrossRef]
 - Tse, H.; Tsang, A.K.L.; Tsoi, H.W.; Leung, A.S.P.; Ho, C.C.; Lau, S.K.P.; Woo, P.C.Y.; Yuen, K.Y. Identification of a Novel Bat Papillomavirus by Metagenomics. PLoS ONE 2012, 7, e43986. [Google Scholar] [CrossRef]
 - García-Pérez, R.; Ibáñez, C.; Godínez, J.M.; Aréchiga, N.; Garin, I.; Pérez-Suárez, G.; De Paz, O.; Juste, J.; Echevarría, J.E.; Bravo, I.G. Novel Papillomaviruses in Free-Ranging Iberian Bats: No Virus–Host Co-Evolution, No Strict Host Specificity, and Hints for Recombination. Genome Biol. Evol. 2014, 6, 94–104. [Google Scholar] [CrossRef] [PubMed]
 - Bolatti, E.M.; Zorec, T.M.; Montani, M.E.; Hošnjak, L.; Chouhy, D.; Viarengo, G.; Casal, P.E.; Barquez, R.M.; Poljak, M.; Giri, A.A. A Preliminary Study of the Virome of the South American Free-Tailed Bats (Tadarida brasiliensis) and Identification of Two Novel Mammalian Viruses. Viruses 2020, 12, 422. [Google Scholar] [CrossRef] [PubMed]
 - Mishra, N.I.; Fagbo, S.F.; Alagaili, A.N.; Nitido, A.; Williams, S.H.; Ng, J.; Lee, B.; Durosinlorun, A.; Garcia, J.A.; Jain, K.; et al. A Viral Metagenomic Survey Identifies Known and Novel Mammalian Viruses in Bats from Saudi Arabia. PLoS ONE 2019, 14, e0214227. [Google Scholar] [CrossRef] [PubMed]
 - Mendenhall, I.H.; Low, D.; Wen, H.; Jayakumar, J.; Gunalan, V.; Wang, L.; Mauer-Stroh, S.; Su, Y.C.F.; Smith, G.J.D.; Sg, G.J.D.S. Diversity and Evolution of Viral Pathogen Community in Cave Nectar Bats (Eonycteris spelaea). Viruses 2019, 11, 250. [Google Scholar] [CrossRef]
 - Finoketti, F.; Nunes, R.; Santos, D.; Alves, A.; Campos, S.; Luís, A.; Zani, S.; Mosca Barboza, C.; Marcélia, E.S.F.; de Cassia Pardo de Souza, T.; et al. Detection of Adenovirus, Papillomavirus and Parvovirus in Brazilian Bats of the Species Artibeus lituratus and Sturnira lilium. Arch. Virol. 2019, 164, 1015–1025. [Google Scholar] [CrossRef]
 - Bolatti, E.M.; Viarengo, G.; Zorec, T.M.; Cerri, A.; Montani, M.E.; Hosnjak, L.; Casal, P.E.; Bortolotto, E.; Di Domenica, V.; Chouhy, D.; et al. Viral Metagenomic Data Analyses of Five New World Bat Species from Argentina: Identification of 35 Novel DNA Viruses. Microorganisms 2022, 10, 266. [Google Scholar] [CrossRef]
 - Yinda, C.K.; Rector, A.; Zeller, M.; Conceição-Neto, N.; Heylen, E.; Maes, P.; Ghogomu, S.M.; Van Ranst, M.; Matthijnssens, J. A Single Bat Species in Cameroon Harbors Multiple Highly Divergent Papillomaviruses in Stool Identified by Metagenomics Analysis. Virol. Rep. 2016, 6, 74–80. [Google Scholar] [CrossRef][Green Version]
 - Salmier, A.; Tirera, S.; De Thoisy, B.; Franc, A.; Darcissac, E.; Donato, D.; Bouchier, C.; Lacoste, V.; Lavergne, A. Virome Analysis of Two Sympatric Bat Species (Desmodus rotundus and Molossus molossus) in French Guiana. PLoS ONE 2017, 12, e0186943. [Google Scholar] [CrossRef]
 - Wang, J.; Moore, N.E.; Murray, Z.L.; McInnes, K.; White, D.J.; Tompkins, D.M.; Hall, R.J. Discovery of Novel Virus Sequences in an Isolated and Threatened Bat Species, the New Zealand Lesser Short-Tailed Bat (Mystacina tuberculata). J. Gen. Virol. 2015, 96, 2442–2452. [Google Scholar] [CrossRef]
 - Geldenhuys, M.; Mortlock, M.; Weyer, J.; Bezuidt, O.; Seamark, E.C.J.; Kearney, T.; Gleasner, C.; Erkkila, T.H.; Cui, H.; Markotter, W. A Metagenomic Viral Discovery Approach Identifies Potential Zoonotic and Novel Mammalian Viruses in Neoromicia Bats within South Africa. PLoS ONE 2018, 13, e0194527. [Google Scholar] [CrossRef]
 - King, K.; Larsen, B.B.; Gryseels, S.; Richet, C.; Kraberger, S.; Jackson, R.; Worobey, M.; Harrison, J.S.; Varsani, A.; Van Doorslaer, K. Coevolutionary Analysis Implicates Toll-Like Receptor 9 in Papillomavirus Restriction. MBio 2022, 13, e00054-22. [Google Scholar] [CrossRef] [PubMed]
 - Buigues, J.; Viñals, A.; Martínez-Recio, R.; Monrós, J.S.; Sanjuán, R.; Cuevas, J.M. Full-Genome Sequencing of Dozens of New DNA Viruses Found in Spanish Bat Feces. Microbiol. Spectr. 2024, 12, e00675-24. [Google Scholar] [CrossRef] [PubMed]
 - do Sul, R.G. Secretaria da Agricultura, Pecuária, Produção Sustentável e Irrigação. In Programa Nacional de Controle da Raiva dos Herbívoros (PNCRH). Available online: https://www.agricultura.rs.gov.br/pncrh-rs (accessed on 10 December 2024).
 - Bioinformatics Software OmicsBox. Available online: https://www.biobam.com/omicsbox/ (accessed on 15 July 2024).
 - Trifinopoulos, J.; Nguyen, L.T.; von Haeseler, A.; Minh, B.Q. W-IQ-TREE: A Fast Online Phylogenetic Tool for Maximum Likelihood Analysis. Nucleic Acids Res. 2016, 44, W232–W235. [Google Scholar] [CrossRef] [PubMed]
 - Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
 - Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; Von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast Model Selection for Accurate Phylogenetic Estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef]
 - Hoang, D.T.; Chernomor, O.; Von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol. Biol. Evol. 2018, 35, 518–522. [Google Scholar] [CrossRef]
 - Rambaut, A. FigTree v1.4: Tree Figure Drawing Tool. 2009. Available online: http://tree.bio.ed.ac.uk/software/figtree (accessed on 11 October 2024).
 - Van Doorslaer, K.; Li, Z.; Xirasagar, S.; Maes, P.; Kaminsky, D.; Liou, D.; Sun, Q.; Kaur, R.; Huyen, Y.; McBride, A.A. The Papillomavirus Episteme: A Major Update to the Papillomavirus Sequence Database. Nucleic Acids Res. 2017, 45, D499. [Google Scholar] [CrossRef]
 - Sambrook, J.; Russell, D.W. Molecular Cloning: A Laboratory Manual, 3rd ed.; United States Cold Spring Harbor Laboratory Press: Long Island, NY, USA, 2001; Volume 1, p. 126. [Google Scholar]
 - Birkenheuer, A.J.; Levy, M.G.; Breitschwerdt, E.B. Development and Evaluation of a Seminested PCR for Detection and Differentiation of Babesia gibsoni (Asian Genotype) and B. Canis DNA in Canine Blood Samples. J. Clin. Microbiol. 2003, 41, 4172–4177. [Google Scholar] [CrossRef]
 - Doorbar, J. The E4 Protein; Structure, Function and Patterns of Expression. Virology 2013, 445, 80–98. [Google Scholar] [CrossRef]
 - Tan, C.W.; Yang, X.; Anderson, D.E.; Wang, L.F. Bat Virome Research: The Past, the Present and the Future. Curr. Opin. Virol. 2021, 49, 68–80. [Google Scholar] [CrossRef]
 - Simmonds, P.; Adams, M.J.; Benk, M.; Breitbart, M.; Brister, J.R.; Carstens, E.B.; Davison, A.J.; Delwart, E.; Gorbalenya, A.E.; Harrach, B.; et al. Virus Taxonomy in the Age of Metagenomics. Nat. Rev. Microbiol. 2017, 15, 161–168. [Google Scholar] [CrossRef] [PubMed]
 - McKnight, C.A.; Wise, A.G.; Maes, R.K.; Howe, C.; Rector, A.; Van Ranst, M.; Kiupel, M. Papillomavirus-Associated Basosquamous Carcinoma in an Egyptian Fruit Bat (Rousettus aegyptiacus). J. Zoo Wildl. Med. 2006, 37, 193–196. [Google Scholar] [CrossRef] [PubMed]
 - Antonsson, A.; McMillan, N.A.J. Papillomavirus in Healthy Skin of Australian Animals. J. Gen. Virol. 2006, 87, 3195–3200. [Google Scholar] [CrossRef] [PubMed]
 - Savini, F.; Dal Molin, E.; Gallina, L.; Casà, G.; Scagliarini, A. Papillomavirus in Healthy Skin and Mucosa of Wild Ruminants in the Italian Alps. J. Wildl. Dis. 2016, 52, 82–87. [Google Scholar] [CrossRef]
 - Van Doorslaer, K.; Ould M’hamed Ould Sidi, A.; Zanier, K.; Rybin, V.; Deryckère, F.; Rector, A.; Burk, R.D.; Lienau, E.K.; van Ranst, M.; Travé, G. Identification of Unusual E6 and E7 Proteins within Avian Papillomaviruses: Cellular Localization, Biophysical Characterization, and Phylogenetic Analysis. J. Virol. 2009, 83, 8759–8770. [Google Scholar] [CrossRef]
 - Antonsson, A.; Erfurt, C.; Hazard, K.; Holmgren, V.; Simon, M.; Kataoka, A.; Hossain, S.; Håkangård, C.; Hansson, B.G. Prevalence and Type Spectrum of Human Papillomaviruses in Healthy Skin Samples Collected in Three Continents. J. Gen. Virol. 2003, 84, 1881–1886. [Google Scholar] [CrossRef]
 - Bernard, H.U.; Burk, R.D.; Chen, Z.; van Doorslaer, K.; Hausen, H.Z.; de Villiers, E.M. Classification of Papillomaviruses (PVs) Based on 189 PV Types and Proposal of Taxonomic Amendments. Virology 2010, 401, 70–79. [Google Scholar] [CrossRef]
 - Maes, P.; Sijmons, S.; Stevens, H.; Van Ranst, M. Complete Genome Sequence of a Papillomavirus Isolated from the European Mole. Genome Announc. 2013, 1, e00530-13. [Google Scholar] [CrossRef]
 - De Villiers, E.M.; Fauquet, C.; Broker, T.R.; Bernard, H.U.; Zur Hausen, H. Classification of Papillomaviruses. Virology 2004, 324, 17–27. [Google Scholar] [CrossRef]
 



| D. rotundus PVs | Primer Sequence | Product Size | Tm | 
|---|---|---|---|
| DrPV-1 F | 5′ TTGCTCACAGTGGGTCATCC 3′ | 421 nt | 60 °C | 
| DrPV-1 R | 5′ CTGGCTCTTCTCCAGCACAA 3′ | 55 °C | |
| DrPV-2 F | 5′ TCTGTGGCTGGCAATCCATT 3′ | 496 nt | 60 °C | 
| DrPV-2 R | 5′ TACCACGGGCCATATCCTCA 3′ | 60.1 °C | |
| DrPV-3 F | 5′ TTGCCCGCCATTTCTTTGTG 3′ | 494 nt | 60 °C | 
| DrPV-3 R | 5′ CAGAGTGTCAGTTGGGGGAC 3′ | 60 °C | 
| Virus | Genome Length | CG% | Coverage (Reads) | BLASTX Best Hit: L1% Identity | Query Cover (%) | 
|---|---|---|---|---|---|
| DrPV-1 | 8165 bp | 43.1 | 3968 | Rhinolophus bat papillomavirus 1 (WXG28025.1) 66.18% | 92 | 
| DrPV-2 | 7579 bp | 44.7 | 2165 | Taphozous bat papillomavirus 1 (ID: WXG28296.1) 60.56% | 94 | 
| DrPV-3 | 7561 bp | 43.9 | 5549 | Taphozous bat papillomavirus 1 (ID: WXG28300.1) 61.19% | 97 | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
de Camargo, L.J.; Alves, R.S.; dos Santos, R.N.; Baumbach, L.F.; Olegário, J.d.C.; Rabaioli, V.; Silva, M.d.O.; Witt, A.A.; Godinho, F.M.; Salvato, R.S.; et al. Characterization of Three Novel Papillomavirus Genomes in Vampire Bats (Desmodus rotundus). Animals 2024, 14, 3604. https://doi.org/10.3390/ani14243604
de Camargo LJ, Alves RS, dos Santos RN, Baumbach LF, Olegário JdC, Rabaioli V, Silva MdO, Witt AA, Godinho FM, Salvato RS, et al. Characterization of Three Novel Papillomavirus Genomes in Vampire Bats (Desmodus rotundus). Animals. 2024; 14(24):3604. https://doi.org/10.3390/ani14243604
Chicago/Turabian Stylede Camargo, Laura Junqueira, Raquel Silva Alves, Raíssa Nunes dos Santos, Letícia Ferreira Baumbach, Juliana do Canto Olegário, Vitória Rabaioli, Matheus de Oliveira Silva, André Alberto Witt, Fernanda Marques Godinho, Richard Steiner Salvato, and et al. 2024. "Characterization of Three Novel Papillomavirus Genomes in Vampire Bats (Desmodus rotundus)" Animals 14, no. 24: 3604. https://doi.org/10.3390/ani14243604
APA Stylede Camargo, L. J., Alves, R. S., dos Santos, R. N., Baumbach, L. F., Olegário, J. d. C., Rabaioli, V., Silva, M. d. O., Witt, A. A., Godinho, F. M., Salvato, R. S., Weber, M. N., da Silva, M. S., Daudt, C., Budaszewski, R. d. F., & Canal, C. W. (2024). Characterization of Three Novel Papillomavirus Genomes in Vampire Bats (Desmodus rotundus). Animals, 14(24), 3604. https://doi.org/10.3390/ani14243604
        
