Investigating the Effects of Dietary Bile Acids on Production Performance and Lipid Metabolism in Late-Phase Laying Hens
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Birds, Diet, and Management
2.2. Laying Performance
2.3. Egg Quality
2.4. Sample Collection and Organ Indexes
2.5. Serum and Hepatic Lipid Accumulation
2.6. Assessment of Liver Injury
2.7. Gene Expression Assays
2.8. Statistical Analysis
3. Results
3.1. Effects of BA on Laying Performance
3.2. Effects of BA on Egg Quality
3.3. Effects of BA on Organ Indexes
3.4. Effects of BA on Liver Injury
3.5. Effects of BA Serum and Liver Lipid Levels
3.6. Genes Expressions Response to Dietary BAs in the Liver and Ileum
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tumova, E.; Gous, R.M. Interaction of hen production type, age, and temperature on laying pattern and egg quality. Poult. Sci. 2012, 91, 1269–1275. [Google Scholar] [CrossRef] [PubMed]
- Wei, F.; Yang, X.; Zhang, M.; Xu, C.; Hu, Y.; Liu, D. Akkermansia muciniphila enhances egg quality and the lipid profile of egg yolk by improving lipid metabolism. Front. Microbiol. 2022, 13, 927245. [Google Scholar] [CrossRef]
- Miao, Y.F.; Gao, X.N.; Xu, D.N.; Li, M.C.; Gao, Z.S.; Tang, Z.H.; Mhlambi, N.H.; Wang, W.J.; Fan, W.T.; Shi, X.Z.; et al. Protective effect of the new prepared Atractylodes macrocephala Koidz polysaccharide on fatty liver hemorrhagic syndrome in laying hens. Poult. Sci. 2021, 100, 938–948. [Google Scholar] [CrossRef] [PubMed]
- Shini, S.; Shini, A.; Bryden, W.L. Unravelling fatty liver haemorrhagic syndrome: 1. Oestrogen and inflammation. Avian Pathol. 2019, 49, 87–98. [Google Scholar] [CrossRef]
- Kuhla, A.; Blei, T.; Jaster, R.; Vollmar, B. Aging is associated with a shift of fatty metabolism toward lipogenesis. J. Gerontol. A Biol. Sci. Med. Sci. 2011, 66, 1192–1200. [Google Scholar] [CrossRef] [PubMed]
- Dongiovanni, P.; Lanti, C.; Riso, P.; Valenti, L. Nutritional therapy for nonalcoholic fatty liver disease. J. Nutr. Biochem. 2016, 29, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Zhang, X.; Du, P.; Wang, Z.; Luo, P.; Huang, Y.; Liu, Z.; Zhang, H.; Chen, W. Dietary herbaceous mixture supplementation reduced hepatic lipid deposition and improved hepatic health status in post-peak laying hens. Poult. Sci. 2022, 101, 101870. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Chiang, J.Y. Bile acid signaling in metabolic disease and drug therapy. Pharmacol. Rev. 2014, 66, 948–983. [Google Scholar] [CrossRef]
- Chiang, J.Y.L.; Ferrell, J.M. Discovery of farnesoid X receptor and its role in bile acid metabolism. Mol. Cell Endocrinol. 2022, 548, 111618. [Google Scholar] [CrossRef]
- Hofmann, A.F.; Hagey, L.R. Bile acids: Chemistry, pathochemistry, biology, pathobiology, and therapeutics. Cell Mol. Life Sci. 2008, 65, 2461–2483. [Google Scholar] [CrossRef]
- McGlone, E.A.-O.; Bloom, S.R. Bile acids and the metabolic syndrome. Ann. Clin. Biochem. 2019, 56, 326–337. [Google Scholar] [CrossRef] [PubMed]
- Xiang, J.; Zhang, Z.; Xie, H.; Zhang, C.; Bai, Y.; Cao, H.; Che, Q.; Guo, J.; Su, Z.A.-O. Effect of different bile acids on the intestine through enterohepatic circulation based on FXR. Gut Microbes. 2021, 13, 1949095. [Google Scholar] [CrossRef] [PubMed]
- Parks, D.J.; Blanchard, S.G.; Bledsoe, R.K.; Chandra, G.; Consler, T.G.; Kliewer, S.A.; Stimmel, J.B.; Willson, T.M.; Zavacki, A.M.; Moore, D.D.; et al. Bile acids: Natural ligands for an orphan nuclear receptor. Science 1999, 284, 1365–1368. [Google Scholar] [CrossRef] [PubMed]
- Matsubara, T.; Li, F.; Gonzalez, F.J. FXR signaling in the enterohepatic system. Mol. Cell Endocrinol. 2013, 368, 17–29. [Google Scholar] [CrossRef] [PubMed]
- Inagaki, T.; Choi, M.; Moschetta, A.; Peng, L.; Cummins, C.L.; McDonald, J.G.; Luo, G.; Jones, S.A.; Goodwin, B.; Richardson, J.A.; et al. Fibroblast growth factor 15 functions as an enterohepatic signal to regulate bile acid homeostasis. Cell Metab. 2005, 2, 217–225. [Google Scholar] [CrossRef] [PubMed]
- Polin, D.; Wing, T.L.; Ki, P.; Pell, K.E. The effect of bile acids and lipase on absorption of tallow in young chicks. Poult. Sci. 1980, 59, 2738–2743. [Google Scholar] [CrossRef]
- Ge, X.K.; Wang, A.A.; Ying, Z.X.; Zhang, L.G.; Su, W.P.; Cheng, K.; Feng, C.C.; Zhou, Y.M.; Zhang, L.L.; Wang, T. Effects of diets with different energy and bile acids levels on growth performance and lipid metabolism in broilers. Poult. Sci. 2019, 98, 887–895. [Google Scholar] [CrossRef]
- Yang, B.; Huang, S.; Zhao, G.; Ma, Q. Dietary supplementation of porcine bile acids improves laying performance, serum lipid metabolism and cecal microbiota in late-phase laying hens. Anim. Nutr. 2022, 14, 283–292. [Google Scholar] [CrossRef]
- Sun, L.; Xin, Q.; Jiao, H.; Wang, X.; Zhao, J.; Li, H.; Zhou, Y.; Cao, A.; Wang, J.; Lin, H. Effect of exogenous bile salts supplementation on the performance and hepatic lipid metabolism of aged laying hens. J. Anim. Sci. 2023, 101, skad334. [Google Scholar] [CrossRef]
- Li, W.; Zhang, Y.; Yang, J.; Xu, H.; Ye, R.; Wu, J.; Cao, M.; Zhao, C.; Yang, B.; Liu, C.; et al. Effect of bile acids supplementation in fatty liver hemorrhagic syndrome, production performance, physiological and quality characteristics of laying hen eggs. Animals 2024, 14, 1910. [Google Scholar] [CrossRef]
- Xiao, G.; Zheng, L.; Yan, X.; Gong, L.; Yang, Y.; Qi, Q.; Zhang, X.; Zhang, H. Effects of dietary essential oils supplementation on egg quality, biochemical parameters, and gut microbiota of late-laying hens. Animals 2022, 12, 2561. [Google Scholar] [CrossRef] [PubMed]
- NY/T 33-2004; China National Standard. Feeding Standard of Chicken. Ministry of Agriculture: Beijing, China, 2004.
- Kui, H.; Li, P.; Wang, T.; Luo, Y.; Ning, C.; Li, M.; Liu, S.; Zhu, Q.; Li, J.; Li, D.; et al. Dynamic mRNA expression during chicken ovarian follicle development. G3 2024, 14, jakd237. [Google Scholar] [CrossRef] [PubMed]
- Lu, Z.; Zeng, N.; Jiang, S.; Wang, X.; Yan, H.; Gao, C. Dietary replacement of soybean meal by fermented feedstuffs for aged laying hens: Effects on laying performance, egg quality, nutrient digestibility, intestinal health, follicle development, and biological parameters in a long-term feeding period. Poult. Sci. 2023, 102, 102478. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.; Huang, S.; Yang, N.; Cao, A.; Zhao, L.; Zhang, J.; Zhao, G.; Ma, Q. Porcine bile acids promote the utilization of fat and vitamin A under low-fat diets. Front. Nutr. 2022, 9, 1005195. [Google Scholar] [CrossRef] [PubMed]
- Kraus, A.; Zita, L. The effect of age and genotype on quality of eggs in brown egg-laying hybrids. Acta Univ. Agric. Silvic. Mendel. Brun. 2019, 67, 407–414. [Google Scholar] [CrossRef]
- Roberts, J.R. Factors affecting egg internal quality and egg shell quality in laying hens. J. Poult. Sci. 2004, 41, 161–177. [Google Scholar] [CrossRef]
- Kowalska, E.; Kucharska-Gaca, J.; Kuźniacka, J.; Lewko, L.; Gornowicz, E.; Biesek, J.; Adamski, M. Egg quality depending on the diet with different sources of protein and age of the hens. Sci. Rep. 2021, 11, 2638. [Google Scholar] [CrossRef]
- Yang, B.; Huang, S.; Li, S.; Feng, Z.; Zhao, G.; Ma, Q. Safety evaluation of porcine bile acids in laying hens: Effects on laying performance, egg quality, blood parameters, organ indexes, and intestinal development. Front. Vet. Sci. 2022, 9, 895831. [Google Scholar] [CrossRef]
- Nabi, F.; Arain, M.A.; Rajput, N.; Alagawany, M.; Soomro, J.; Umer, M.; Soomro, F.; Wang, Z.; Ye, R.; Liu, J. Health benefits of carotenoids and potential application in poultry industry: A review. J. Anim. Physiol. Anim. Nutr. 2020, 104, 1809–1818. [Google Scholar] [CrossRef]
- Marchionatti, A.; Rivoira, M.; Rodriguez, V.; Perez, A.; Tolosa de Talamoni, N. Molecular mechanisms triggered by bile acids on intestinal Ca2+ absorption. Curr. Med. Chem. 2018, 25, 2122–2132. [Google Scholar] [CrossRef]
- Tu, Y.; Su, Y.; Li, G.; Zhang, X.; Tong, H. Expression of lipid metabolism-associated genes in male and female white feather chicken. J. Poult. Sci. 2016, 53, 118–123. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Burchat, N.; Akal, T.; Ntambi, J.M.; Trivedi, N.; Suresh, R.; Sampath, H. SCD1 is nutritionally and spatially regulated in the intestine and influences systemic postprandial lipid homeostasis and gut-liver crosstalk. Biochim. Biophys. Acta Mol. Cell Biol. Lipids. 2022, 1867, 159195. [Google Scholar] [CrossRef] [PubMed]
- Ntambi, J.M.; Miyazaki, M.; Stoehr, J.P.; Lan, H.; Kendziorski, C.M.; Yandell, B.S.; Song, Y.; Cohen, P.; Friedman, J.M.; Attie, A.D. Loss of stearoyl-CoA desaturase-1 function protects mice against adiposity. Proc. Natl. Acad. Sci. USA 2002, 99, 11482–11486. [Google Scholar] [CrossRef] [PubMed]
- Aljohani, A.M.; Syed, D.N.; Ntambi, J.M. Insights into stearoyl-CoA desaturase-1 regulation of systemic metabolism. Trends Endocrinol. Metab. 2017, 28, 831–842. [Google Scholar] [CrossRef]
- Miyazaki, M.; Flowers, M.T.; Sampath, H.; Chu, K.; Otzelberger, C.; Liu, X.; Ntambi, J.M. Hepatic stearoyl-CoA desaturase-1 deficiency protects mice from carbohydrate-induced adiposity and hepatic steatosis. Cell Metab. 2007, 6, 484–496. [Google Scholar] [CrossRef]
- Cui, Z.; Ning, Z.; Deng, X.; Du, X.; Amevor, F.K.; Liu, L.; Kang, X.; Tian, Y.; Wang, Y.; Li, D.; et al. Integrated proteomic and metabolomic analyses of chicken ovary revealed the crucial role of lipoprotein lipase on lipid metabolism and steroidogenesis during sexual maturity. Front. Physiol. 2022, 13, 885030. [Google Scholar] [CrossRef]
- Zhang, Z.; Ding, B.; He, H.; Wang, J.; Liu, X.; Guo, J.; Li, P.; Madigosky, S.R. The effect of bile salt diet supplementation on genes related to fat metabolism in yellow-feathered broilers. Vet. World. 2022, 15, 911–918. [Google Scholar] [CrossRef]
- Xu, J.; Li, X.; Yao, X.; Xie, S.; Chi, S.; Zhang, S.; Cao, J.; Tan, B. Protective effects of bile acids against hepatic lipid accumulation in hybrid grouper fed a high-lipid diet. Front. Nutr. 2022, 9, 813249. [Google Scholar] [CrossRef]
- Ticho, A.L.; Malhotra, P.; Dudeja, P.K.; Gill, R.K.; Alrefai, W.A. Intestinal absorption of bile acids in health and disease. Compr. Physiol. 2019, 10, 21–56. [Google Scholar]
- Coppola, C.P.; Gosche, J.R.; Arrese, M.; Ancowitz, B.; Madsen, J.; Vanderhoof, J.; Shneider, B.L. Molecular analysis of the adaptive response of intestinal bile acid transport after ileal resection in the rat. Gastroenterology 1998, 115, 1172–1178. [Google Scholar] [CrossRef]
- Feng, J.; Ma, H.; Yue, Y.; Wang, L.; Hao, K.; Zhang, Y.; Li, J.; Xiang, Y.; Min, Y. Saikosaponin a ameliorates diet-induced fatty liver via regulating intestinal microbiota and bile acid profile in laying hens. Poult. Sci. 2023, 102, 103155. [Google Scholar] [CrossRef] [PubMed]
- Russell, D.W. Fifty years of advances in bile acid synthesis and metabolism. J. Lipid Res. 2009, 50, S120–S125. [Google Scholar] [CrossRef] [PubMed]
Ingredients | Proportion (%) | Nutrient Levels | Proportion (%) |
---|---|---|---|
Corn | 65.80 | ME/(MJ/kg) | 2650 |
Soybean meal | 22.00 | CP | 14.8 |
Liquid methionine | 0.16 | Calcium | 3.85 |
Stone powder | 9.60 | Total phosphorus | 0.44 |
Dicalcium phosphate | 0.80 | Lysine | 0.77 |
Choline | 0.14 | Methionine | 0.36 |
Premix 1 | 1.50 | Threonine | 0.57 |
Total | 100 |
Gene # | Gene ID | Primer Sequences (5′-3′) | Product Size (bp) |
---|---|---|---|
ACACA | NM_205505.2 | F: TTGTGGCACAGAAGAGGGAAT | 143 |
R: AGTGAGGTCAAAGTTCCGCA | |||
FASN | NM_205155.4 | F: GCTAAGATGGCATTGCACGG | 135 |
R: TCCATTCAGTTCCAGACGGC | |||
GPAT | NM_001004401.2 | F: TGGACGTGCCCCATGTGAT | 101 |
R: TGCCTCGGATGACTCTCCAT | |||
MTTP | NM_001109784.3 | F: GCAGATGGACAGAGTTGGCT | 93 |
R: TTCCCTCTCCTCGCAGTGTA | |||
LDLR | NM_204452.1 | F: TTCGAGGACTCCGTGTTCTG | 100 |
R: GCAGAGATTCGGCCACGAC | |||
APOA1 | NM_205525.5 | F: TGAGGACATGGCTCCCTACTA | 141 |
R: CACTTGGCAGAGAACTGGTCC | |||
APOB1 | NM_001044633.2 | F: GCAGCTTTGCTCATCGTGAC | 119 |
R: AACGTCAGCAAATGTTGGGC | |||
LXRA | XM_040700552.2 | F: GTATATGCGCCGCAAGTGTC | 76 |
R: CAGAACATACTGCTCCCGCA | |||
SREBP2 | XM_040660556.2 | F: CTCGTGAATGGTGTGATCGTCCTC | 112 |
R: GCTTGCGGTGCCTCCAGAAC | |||
HMGCR | NM_204485.3 | F: AGGACCTGTTGTAAGGCTGC | 124 |
R: TAGGCGGGCAAACCTACTTG | |||
CYP7A1 | NM_001001753.2 | F: GCTCCGCATGTTCCTGAATG | 99 |
R: ATGGTGTTAGCTTGCGAGGC | |||
CYP7B1 | XM_025147742.3 | F: TGCGTGACGAGATTGACCAT | 121 |
R: TCGTTTAAGGCGCTCTCCAG | |||
FXR | NM_001396910.1 | F: CAACCTGGGCTTCTACCCTC | 145 |
R: GTGGCCCAGTCTAGGCTTTT | |||
PGC1α | NM_001006457.2 | F: GAGTGACATCGAGTGTGCTG | 143 |
R: ACTGGTCGCTGTACCACTTG | |||
CPT1A | XM_046918285.1 | F: GCTCACTACCGAGACATGGG | 92 |
R: GACCGGACGGTTTCAGTTCT | |||
ACOX1 | NM_001006205.2 | F: AGGAGATCGAGGCCTTAGTGA | 89 |
R: GGCTTGTTCATAGCGTTGGC | |||
LIPE | XM_040657096.1 | F: CCTTCTTCCTCACCACGGAC | 107 |
R: TTGGAGGTGTCTCAAAGGGC | |||
SCD | NM_204890.2 | F: TTAGGGCTCAATGCCACCTG | 90 |
R: GTTCTCCCGTGGGTTGATGT | |||
FGF19 | NM_204674.3 | F: CCGCTGTCTCACTTCTTACCC | 120 |
R: CGTTTCGAGAGGCGATGAGTA | |||
ASBT | NM_001319027.2 | F: GCTGTGGTTGGGGGAATACT | 137 |
R: CTGCTCCAAGACAGACCAGC | |||
FABP6 | NM_001277700.2 | F: GGACGCACCACGACTAATTC | 100 |
R: TCCCACCTTCCATTTTGACTGT | |||
SHP-1 | NM_001030893.3 | F: ACGCACTGAGCTACAGACAC | 105 |
R: AGGGAGCTTTCCAGACATGC | |||
LPL | NM_205282.2 | F: TCGCAGCATTGGGATTCAGA | 109 |
R: TTCAGCAATCAGGCGGAGAG | |||
β-actin | NM_205518.1 | F: GTCCACCGCAAATGCTTCTAA | 78 |
R: TGCGCATTTATGGGTTTTGTT |
Item | Ctrl | Low-BA | High-BA | p-Value |
---|---|---|---|---|
Egg-shaped index | 1.31 ± 0.01 | 1.31 ± 0.01 | 1.31 ± 0.01 | 0.950 |
Eggshell properties | ||||
Relative weight, % | 12.85 ± 0.22 b | 13.46 ± 0.14 a | 13.46 ± 0.21 a | 0.030 |
Thickness, mm | 0.32 ± 0.003 | 0.33 ± 0.002 | 0.32 ± 0.003 | 0.137 |
Strength, N | 37.03 ± 1.06 | 39.51 ± 1.00 | 38.13 ± 1.20 | 0.284 |
Yolk properties | ||||
Relative weight, % | 26.72 ± 0.34 | 27.07 ± 0.27 | 26.38 ± 0.31 | 0.260 |
Yolk index | 42.14 ± 0.45 | 41.49 ± 0.52 | 42.81 ± 0.54 | 0.189 |
Yolk color | 11.89 ± 0.11 b | 12.17 ± 0.07 a | 12.13 ± 0.09 ab | 0.045 |
Protein properties | ||||
Protein height, mm | 5.77 ± 0.25 | 5.28 ± 0.14 | 5.37 ± 0.18 | 0.142 |
Haugh unit | 73.36 ± 2.10 | 71.97 ± 1.25 | 70.96 ± 1.44 | 0.241 |
Item | Ctrl | Low-BA | High-BA | p-Value |
---|---|---|---|---|
Body weight, kg | 2.10 ± 0.07 | 2.13 ± 0.06 | 1.96 ± 0.05 | 0.165 |
Absolute weight, g | ||||
Heart | 7.06 ± 0.32 | 8.07 ± 0.72 | 7.23 ± 0.31 | 0.464 |
Liver | 33.51 ± 2.20 | 34.20 ± 1.99 | 32.29 ± 1.33 | 0.744 |
Spleen | 2.17 ± 0.21 | 2.10 ± 0.12 | 2.05 ± 0.09 | 0.984 |
Pancreas | 3.76 ± 0.29 | 3.69 ± 0.21 | 3.16 ± 0.13 | 0.127 |
Ovarian | 41.43 ± 3.63 | 37.45 ± 1.62 | 43.43 ± 2.76 | 0.292 |
Relative weight, % body weight | ||||
Heart | 0.34 ± 0.01 | 0.37 ± 0.03 | 0.36 ± 0.01 | 0.354 |
Liver | 1.58 ± 0.06 | 1.58 ± 0.06 | 1.52 ± 0.06 | 0.645 |
Spleen | 0.10 ± 0.007 | 0.10 ± 0.007 | 0.10 ± 0.004 | 0.886 |
Pancreas | 0.16 ± 0.01 | 0.17 ± 0.01 | 0.16 ± 0.01 | 0.681 |
Ovarian | 2.19 ± 0.22 | 1.78 ± 0.13 | 2.25 ± 0.13 | 0.102 |
Absolute intestinal length, cm | ||||
Duodenum | 22.55 ± 0.90 | 24.56 ± 0.60 | 22.50 ± 0.85 | 0.150 |
Jejunum | 44.90 ± 2.93 | 46.10 ± 2.12 | 50.60 ± 2.38 | 0.253 |
Ileum | 42.66 ± 1.41 | 37.78 ± 1.58 | 41.90 ± 2.12 | 0.132 |
Relative intestinal length, cm/kg body weight | ||||
Duodenum | 10.19 ± 0.38 | 11.08 ± 0.50 | 10.84 ± 0.47 | 0.358 |
Jejunum | 20.26 ± 1.20 | 21.23 ± 1.12 | 23.96 ± 0.92 | 0.070 |
Ileum | 19.31 ± 0.64 ab | 17.26 ± 0.77 b | 21.05 ± 1.22 a | 0.028 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, L.; Fan, K.; Xing, R.; Yin, J.; Si, X.; Zhang, H.; Huang, Y.; Chen, W. Investigating the Effects of Dietary Bile Acids on Production Performance and Lipid Metabolism in Late-Phase Laying Hens. Animals 2024, 14, 3554. https://doi.org/10.3390/ani14243554
Wang L, Fan K, Xing R, Yin J, Si X, Zhang H, Huang Y, Chen W. Investigating the Effects of Dietary Bile Acids on Production Performance and Lipid Metabolism in Late-Phase Laying Hens. Animals. 2024; 14(24):3554. https://doi.org/10.3390/ani14243554
Chicago/Turabian StyleWang, Longfei, Kefeng Fan, Ronghui Xing, Jixue Yin, Xuemeng Si, Huaiyong Zhang, Yanqun Huang, and Wen Chen. 2024. "Investigating the Effects of Dietary Bile Acids on Production Performance and Lipid Metabolism in Late-Phase Laying Hens" Animals 14, no. 24: 3554. https://doi.org/10.3390/ani14243554
APA StyleWang, L., Fan, K., Xing, R., Yin, J., Si, X., Zhang, H., Huang, Y., & Chen, W. (2024). Investigating the Effects of Dietary Bile Acids on Production Performance and Lipid Metabolism in Late-Phase Laying Hens. Animals, 14(24), 3554. https://doi.org/10.3390/ani14243554