Polymorphisms of TXK and PLCE1 Genes and Their Correlation Analysis with Growth Traits in Ashidan Yaks
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals and Traits
2.2. DNA Sample Extraction
2.3. Genetic Typing
2.4. SNPs Validation
2.5. Statistical Analysis
3. Results
3.1. Genotyping Results and Genetic Parameters of TXK and PLCE1 Loci in Ashidan Yaks
3.2. Association Analysis of SNPs in TXK and PLCE1 Genes with Growth Traits in Ashidan Yaks
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A

References
- Li, R.; Wang, S.Q.; Xu, S.Y.; Huang, J.P.; Wang, F.Q.; Ma, Z.J.; Dang, R.H.; Lan, X.Y.; Chen, H.; Lei, C.Z. Novel Y-chromosome polymorphisms in C hinese domestic yak. Anim. Genet. 2014, 45, 449–452. [Google Scholar] [CrossRef]
- Zhu, X.; Li, L.; Tian, B.; Zhang, P.; Wang, J. Synergistic Effect of Yak Dung Fiber and Yak Dung Ash on the Mechanical and Shrinkage Properties of Cement Mortar. Materials 2023, 16, 719. [Google Scholar] [CrossRef] [PubMed]
- Wu, M.; Zhao, H.; Tang, X.; Zhao, W.; Yi, X.; Li, Q.; Sun, X. Organization and Complexity of the Yak (Bos Grunniens) Immunoglobulin Loci. Front. Immunol. 2022, 13, 876509. [Google Scholar] [CrossRef] [PubMed]
- Guo, S.; Yu, T.; Wang, X.; Zhao, S.; Zhao, E.; Ainierlitu; Ba, T.; Gan, M.; Dong, C.; Naerlima; et al. Whole-genome resequencing reveals the uniqueness of Subei yak. J. Anim. Sci. 2024, 102, skae152. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.; Ge, F.; Ren, W.; Zhang, Y.; Wu, X.; Zhang, Q.; Ma, X.; Bao, P.; Guo, X.; Chu, M.; et al. Copy number variation of the HPGDS gene in the Ashidan yak and its associations with growth traits. Gene 2021, 772, 145382. [Google Scholar] [CrossRef]
- Peng, W.; Fu, C.; Shu, S.; Wang, G.; Wang, H.; Yue, B.; Zhang, M.; Liu, X.; Liu, Y.; Zhang, J.; et al. Whole-genome resequencing of major populations revealed domestication-related genes in yaks. BMC Genom. 2024, 25, 69. [Google Scholar] [CrossRef]
- Sivalingam, J.; Vineeth, M.R.; Surya, T.; Singh, K.; Dixit, S.P.; Niranjan, S.K.; Tantia, M.S.; Gupta, I.D.; Ravikumar, D. Genomic divergence reveals unique populations among Indian Yaks. Sci. Rep. 2020, 10, 3636. [Google Scholar] [CrossRef]
- Bejarano, D.H.; Martínez, R.A.; Rocha, J.F. Genome-wide association study for growth traits in Blanco Orejinegro and Romosinuano cattle. Trop. Anim. Health Prod. 2023, 55, 358. [Google Scholar] [CrossRef]
- Kostusiak, P.; Slósarz, J.; Gołębiewski, M.; Grodkowski, G.; Puppel, K. Polymorphism of Genes and Their Impact on Beef Quality. Curr. Issues Mol. Biol. 2023, 45, 4749–4762. [Google Scholar] [CrossRef]
- Cai, X.; Mipam, T.D.; Zhao, F.F.; Sun, L. SNPs detected in the yak MC4R gene and their association with growth traits. Animal 2015, 9, 1097–1103. [Google Scholar] [CrossRef]
- Jiang, H.; Chai, Z.-X.; Cao, H.-W.; Zhang, C.-F.; Zhu, Y.; Zhang, Q.; Xin, J.-W. Genome-wide identification of SNPs associated with body weight in yak. BMC Genom. 2022, 23, 833. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Zhang, Q.; Wang, X.; Zhang, Y.; Zhao, X. Yak FOXO1 and FOXO3 SNPs and association with production traits, and their promotes cells apoptosis via RNAi. Gene 2020, 743, 144592. [Google Scholar] [CrossRef] [PubMed]
- Gomez-Rodriguez, J.; Kraus, Z.J.; Schwartzberg, P.L. Tec family kinases Itk and Rlk/Txk in T lymphocytes: Cross-regulation of cytokine production and T-cell fates. FEBS J. 2011, 278, 1980–1989. [Google Scholar] [CrossRef] [PubMed]
- Mano, H.; Yamashita, Y.; Miyazato, A.; Miura, Y.; Ozawa, K. Tec protein-tyrosine kinase is an effector molecule of Lyn protein-tyrosine kinase. FEBS J. 1996, 10, 637–642. [Google Scholar] [CrossRef] [PubMed]
- Berg, L.J.; Finkelstein, L.D.; Lucas, J.A.; Schwartzberg, P.L. Tec family kinases in T lymphocyte development and function. Annu. Rev. Immunol. 2005, 23, 549–600. [Google Scholar] [CrossRef]
- Abril-Parreño, L.; Carthy, T.R.; Keogh, K.; Štiavnická, M.; O’Meara, C.; Lonergan, P.; Kenny, D.A.; Fair, S. Genome-wide association study reveals candidate markers related to field fertility and semen quality traits in Holstein-Friesian bulls. Animal 2023, 17, 100841. [Google Scholar] [CrossRef] [PubMed]
- Jung, E.J.; Park, H.B.; Lee, J.B.; Yoo, C.K.; Kim, B.M.; Kim, H.I.; Cho, I.C.; Lim, H.T. Genome-wide association study identifies quantitative trait loci affecting hematological traits in an F2 intercross between Landrace and Korean native pigs. Anim. Genet. 2014, 45, 534–541. [Google Scholar] [CrossRef]
- Dadousis, C.; Somavilla, A.; Ilska, J.J.; Johnsson, M.; Batista, L.; Mellanby, R.J.; Headon, D.; Gottardo, P.; Whalen, A.; Wilson, D.; et al. A genome-wide association analysis for body weight at 35 days measured on 137,343 broiler chickens. Genet. Sel. Evol. 2021, 53, 70. [Google Scholar] [CrossRef]
- Tarsani, E.; Kranis, A.; Maniatis, G.; Avendano, S.; Hager-Theodorides, A.L.; Kominakis, A. Discovery and characterization of functional modules associated with body weight in broilers. Sci. Rep. 2019, 9, 9125. [Google Scholar] [CrossRef]
- Jahuey-Martínez, F.J.; Parra-Bracamonte, G.M.; Sifuentes-Rincón, A.M.; Martínez-González, J.C.; Gondro, C.; García-Pérez, C.A.; López-Bustamante, L.A. Genomewide association analysis of growth traits in Charolais beef cattle1. J. Anim. Sci. 2016, 94, 4570–4582. [Google Scholar] [CrossRef]
- Yuan, J.; Jia, B.; Yan, H. Research progress of PLCE1 and its single nucleotide polymorphism function. Chin. Med. Innov. 2015, 12, 148–151. [Google Scholar]
- Araya, R.; Riquelme, M.A.; Brandan, E.; Sáez, J.C. The formation of skeletal muscle myotubes requires functional membrane receptors activated by extracellular ATP. Brain Res. Rev. 2004, 47, 174–188. [Google Scholar] [CrossRef] [PubMed]
- Lan, G.; Jin, S.; Li, X.; Liu, X.; Li, G.; Dong, X. Screening and functional analysis of differentially expressed genes in the pectoral muscle transcriptome of plateau rainspot pigeon and Jensen pigeon. Zhejiang Agric. J. 2022, 34, 507–516. [Google Scholar]
- Rajawat, D.; Ghildiyal, K.; Sonejita Nayak, S.; Sharma, A.; Parida, S.; Kumar, S.; Ghosh, A.K.; Singh, U.; Sivalingam, J.; Bhushan, B.; et al. Genome-wide mining of diversity and evolutionary signatures revealed selective hotspots in Indian Sahiwal cattle. Gene 2024, 901, 148178. [Google Scholar] [CrossRef]
- Rahman, J.U.; Kumar, D.; Singh, S.P.; Shahi, B.N.; Ghosh, A.K.; Verma, M.K.; Pathak, A.; Dar, A.H.; Kumar, A.; Sharma, R.K. Genome-wide identification and annotation of SNPs and their mapping in candidate genes related to milk production and fertility traits in Badri cattle. Trop. Anim. Health Prod. 2023, 55, 117. [Google Scholar] [CrossRef]
- GB/T 43842-2024; Technical Specification for Performance Testing of Yak. National Livestock Standardization Technical Committee: Beijing, China, 2024.
- Ma, X.; Yang, G.; Zhang, J.; Ma, R.; Shen, J.; Feng, F.; Yu, D.; Huang, C.; Ma, X.; La, Y.; et al. Association between Single Nucleotide Polymorphisms of PRKD1 and KCNQ3 Gene and Milk Quality Traits in Gannan Yak (Bos grunniens). Foods 2024, 13, 781. [Google Scholar] [CrossRef] [PubMed]
- Yang, G.; Zhang, J.; Ma, X.; Ma, R.; Shen, J.; Liu, M.; Yu, D.; Feng, F.; Huang, C.; Ma, X.; et al. Polymorphisms of CCSER1 Gene and Their Correlation with Milk Quality Traits in Gannan Yak (Bos grunniens). Foods 2023, 12, 4318. [Google Scholar] [CrossRef]
- Tippmann, H.-F. Analysis for free: Comparing programs for sequence analysis. Brief. Bioinform. 2004, 5, 82–87. [Google Scholar] [CrossRef]
- Shah, A.M.; Bano, I.; Qazi, I.H.; Matra, M.; Wanapat, M. “The Yak”-A remarkable animal living in a harsh environment: An overview of its feeding, growth, production performance, and contribution to food security. Front. Vet. Sci. 2023, 10, 1086985. [Google Scholar] [CrossRef]
- Feng, F.; Yang, G.; Ma, X.; Zhang, J.; Huang, C.; Ma, X.; La, Y.; Yan, P.; Zhandui, P.; Liang, C. Polymorphisms within the PRKG1 Gene of Gannan Yaks and Their Association with Milk Quality Characteristics. Foods 2024, 13, 1913. [Google Scholar] [CrossRef]
- Yang, R. Identification of Risk Factors for Sarcopenia and Its Roles in Koreans Through Genome Wide Association Study. Master’s Thesis, Graduate School of Convergence Technology, Seoul National University, Seoul, Republic of Korea, 2017. [Google Scholar]
- Lopes, L.O.; Cury, S.S.; de Moraes, D.; Oliveira, J.S.; de Oliveira, G.; Cabral-Marques, O.; Fernandez, G.J.; Hirata, M.H.; Wang, D.-Z.; Dal-Pai-Silva, M.; et al. The Impact of miR-155-5p on Myotube Differentiation: Elucidating Molecular Targets in Skeletal Muscle Disorders. Int. J. Mol. Sci. 2024, 25, 1777. [Google Scholar] [CrossRef] [PubMed]
- Zhao, C.; Raza, S.H.A.; Khan, R.; Sabek, A.; Khan, S.; Ullah, I.; Memon, S.; El-Aziz, A.H.A.; Shah, M.A.; Shijun, L.; et al. Genetic variants in MYF5 affected growth traits and beef quality traits in Chinese Qinchuan cattle. Genomics 2020, 112, 2804–2812. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.-Q.; Qi, Z.-Y.; Han, Y.-C.; Liu, X.; Sun, Y.-G. Detection of SNPs in SMAD4 gene and its association with growth traits in yak. J. Northwest A F Univ.—Nat. Sci. Ed. 2023, 51, 1–8. [Google Scholar]

| SNPs | Primer Sequence (5′-3′) | Product Size |
|---|---|---|
| g.55,999,531C>T | F: GGAAGTGTTGATGTGGTTGGAT | 445 bp |
| R: TGAAGAGAGCCAGGGAGAAAC | ||
| g.342,350T>G | F: CACCTCCCCAACTCTTCCTA | 380 bp |
| R: GGCTTCTGTCTATGGGGTCA |
| SNPs | Genotypic Frequencies | Allelic Frequencies | He | Ne | P | PIC | |||
|---|---|---|---|---|---|---|---|---|---|
| g.55,999,531C>T | CC | CT | TT | C | T | 0.474 | 1.905 | 0.102 | 0.475 |
| 0.397 | 0.474 | 0.129 | 0.634 | 0.366 | |||||
| g.342,350T>G | TT | TG | GG | T | G | 0.409 | 1.693 | 0.366 | 0.426 |
| 0.487 | 0.409 | 0.104 | 0.692 | 0.308 | |||||
| Month of Age | Growth Traits | Genotype (Mean ± SD) | p-Value | ||
|---|---|---|---|---|---|
| CC (92) | CT (110) | TT (30) | |||
| 6 | BW (kg) | 83.69 ± 10.09 | 86.10 ± 10.32 | 81.60 ± 11.46 | 0.07 |
| WH (cm) | 94.16 ± 5.15 | 94.79 ± 5.49 | 93.60 ± 6.46 | 0.51 | |
| BL (cm) | 93.40 ± 7.94 b | 91.43 ± 6.78 ab | 89.97 ± 7.43 a | 0.04 * | |
| CG (cm) | 123.51 ± 6.87 | 124.38 ± 8.73 | 123.30 ± 8.72 | 0.69 | |
| 12 | BW (kg) | 81.74 ± 12.07 | 82.85 ± 11.53 | 82.59 ± 12.44 | 0.77 |
| WH (cm) | 90.41 ± 3.85 | 90.88 ± 4.51 | 89.93 ± 4.38 | 0.51 | |
| BL (cm) | 95.62 ± 4.37 | 96.19 ± 6.01 | 95.83 ± 4.33 | 0.75 | |
| CG (cm) | 116.66 ± 4.71 ab | 118.20 ± 5.10 b | 115.93 ± 5.80 a | 0.03 * | |
| 18 | BW (kg) | 121.39 ± 12.00 | 120.50 ± 12.93 | 121.04 ± 13.25 | 0.91 |
| WH (cm) | 99.87 ± 5.41 | 100.01 ± 4.81 | 100.77 ± 4.89 | 0.76 | |
| BL (cm) | 101.59 ± 5.61 | 101.81 ± 5.45 | 102.36 ± 6.92 | 0.83 | |
| CG (cm) | 137.61 ± 8.62 | 138.32 ± 10.88 | 138.09 ± 12.35 | 0.73 | |
| 30 | BW (kg) | 155.51 ± 15.05 | 152.87 ± 16.16 | 153.35 ± 18.36 | 0.60 |
| WH (cm) | 102.23 ± 6.03 | 102.17 ± 5.07 | 101.84 ± 6.18 | 0.95 | |
| BL (cm) | 112.31 ± 5.64 | 113.21 ± 6.06 | 111.91 ± 6.14 | 0.54 | |
| CG (cm) | 146.44 ± 7.43 | 147.38 ± 8.41 | 148.90 ± 7.81 | 0.43 | |
| Month of Age | Growth Traits | Genotype (Mean ± SD) | p-Value | ||
|---|---|---|---|---|---|
| TT (113) | TG (95) | GG (24) | |||
| 6 | BW (kg) | 84.75 ± 10.91 | 84.29 ± 9.90 | 85.00 ± 10.89 | 0.93 |
| WH (cm) | 94.31 ± 0.52 | 94.03 ± 0.56 | 96.17 ± 1.12 | 0.23 | |
| BL (cm) | 91.73 ± 0.70 | 92.00 ± 0.76 | 93.46 ± 1.52 | 0.59 | |
| CG (cm) | 123.97 ± 8.44 | 123.73 ± 8.28 | 124.17 ± 6.61 | 0.96 | |
| 12 | BW (kg) | 81.66 ± 13.43 | 81.37 ± 13.63 | 82.25 ± 11.07 | 0.95 |
| WH (cm) | 90.62 ± 4.22 | 90.49 ± 4.44 | 90.63 ± 3.60 | 0.97 | |
| BL (cm) | 96.36 ± 2.73 | 95.55 ± 5.10 | 95.25 ± 5.99 | 0.44 | |
| CG (cm) | 116.96 ± 5.35 | 117.51 ± 4.83 | 117.92 ± 5.03 | 0.61 | |
| 18 | BW (kg) | 107.04 ± 22.89 | 117.93 ± 22.67 | 124.35 ± 15.32 | 0.41 |
| WH (cm) | 101.97 ± 5.27b | 101.73 ± 6.16b | 104.68 ± 4.12a | 0.03 * | |
| BL (cm) | 102.58 ± 5.91 | 100.98 ± 5.39 | 101.27 ± 5.46 | 0.14 | |
| CG (cm) | 137.52 ± 9.90 | 137.77 ± 9.85 | 141.45 ± 12.17 | 0.25 | |
| 30 | BW (kg) | 153.27 ± 23.83 | 152.96 ± 15.59 | 152.88 ± 16.07 | 0.99 |
| WH (cm) | 100.00 ± 5.38 | 99.81 ± 4.99 | 101.24 ± 3.54 | 0.59 | |
| BL (cm) | 113.13 ± 5.83 | 112.20 ± 6.32 | 112.05 ± 4.26 | 0.58 | |
| CG (cm) | 146.67 ± 18.09 | 145.87 ± 7.88 | 145.82 ± 7.58 | 0.93 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, J.; Zha, X.; Yang, G.; Ma, X.; La, Y.; Wu, X.; Guo, X.; Chu, M.; Bao, P.; Yan, P.; et al. Polymorphisms of TXK and PLCE1 Genes and Their Correlation Analysis with Growth Traits in Ashidan Yaks. Animals 2024, 14, 3506. https://doi.org/10.3390/ani14233506
Zhang J, Zha X, Yang G, Ma X, La Y, Wu X, Guo X, Chu M, Bao P, Yan P, et al. Polymorphisms of TXK and PLCE1 Genes and Their Correlation Analysis with Growth Traits in Ashidan Yaks. Animals. 2024; 14(23):3506. https://doi.org/10.3390/ani14233506
Chicago/Turabian StyleZhang, Juanxiang, Xita Zha, Guowu Yang, Xiaoming Ma, Yongfu La, Xiaoyun Wu, Xian Guo, Min Chu, Pengjia Bao, Ping Yan, and et al. 2024. "Polymorphisms of TXK and PLCE1 Genes and Their Correlation Analysis with Growth Traits in Ashidan Yaks" Animals 14, no. 23: 3506. https://doi.org/10.3390/ani14233506
APA StyleZhang, J., Zha, X., Yang, G., Ma, X., La, Y., Wu, X., Guo, X., Chu, M., Bao, P., Yan, P., & Liang, C. (2024). Polymorphisms of TXK and PLCE1 Genes and Their Correlation Analysis with Growth Traits in Ashidan Yaks. Animals, 14(23), 3506. https://doi.org/10.3390/ani14233506

