First Report of Polymorphisms and Genetic Characteristics of Prion-like Protein Gene (PRND) in Cats
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Preparation
2.2. Genetic Analysis of the Feline PRND Gene
2.3. Statistical Analysis
2.4. In Silico Prediction of the Effects of Non-Synonymous SNPs in the Feline PRND Gene
2.5. Protein Structure Prediction of Feline Doppel
2.6. Genetic Linkage Analysis of PRNP and PRND Polymorphisms in Cats
3. Results
3.1. Investigation of PRND Polymorphisms in Cats
3.2. Predicting the Effects of Non-Synonymous SNPs on the Function and Properties of Feline Doppel
3.3. Investigation of Genetic Linkage Between Feline PRNP and PRND SNPs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Prusiner, S.B. Prions. Proc. Natl. Acad. Sci. USA 1998, 95, 13363–13383. [Google Scholar] [CrossRef] [PubMed]
- Collins, S.J.; Lawson, V.A.; Masters, C.L. Transmissible spongiform encephalopathies. Lancet 2004, 363, 51–61. [Google Scholar] [CrossRef] [PubMed]
- Mead, S.; Lloyd, S.; Collinge, J. Genetic Factors in Mammalian Prion Diseases. Annu. Rev. Genet. 2019, 53, 117–147. [Google Scholar] [CrossRef] [PubMed]
- Feline spongiform encephalopathy. BSAVA Scientific Committee. J. Small Anim. Pract. 1996, 37, 198.
- Aldhous, P. BSE: Spongiform encephalopathy found in cat. Nature 1990, 345, 194. [Google Scholar] [CrossRef][Green Version]
- Pattison, J. The emergence of bovine spongiform encephalopathy and related diseases. Emerg. Infect. Dis. 1998, 4, 390–394. [Google Scholar] [CrossRef]
- Qing, L.L.; Zhao, H.; Liu, L.L. Progress on low susceptibility mechanisms of transmissible spongiform encephalopathies. Dongwuxue Yanjiu 2014, 35, 436–445. [Google Scholar] [CrossRef]
- Lezmi, S.; Bencsik, A.; Monks, E.; Petit, T.; Baron, T. First case of feline spongiform encephalopathy in a captive cheetah born in France: PrP(sc) analysis in various tissues revealed unexpected targeting of kidney and adrenal gland. Histochem. Cell Biol. 2003, 119, 415–422. [Google Scholar] [CrossRef]
- Sigurdson, C.J.; Miller, M.W. Other animal prion diseases. Br. Med. Bull. 2003, 66, 199–212. [Google Scholar] [CrossRef]
- Kelly, D.F.; Wells, G.A.; Haritani, M.; Higgins, R.J.; Jeffrey, M. Neuropathological findings in cats with clinically suspect but histologically unconfirmed feline spongiform encephalopathy. Vet. Rec. 2005, 156, 472–477. [Google Scholar] [CrossRef]
- Bencsik, A.; Debeer, S.; Petit, T.; Baron, T. Possible case of maternal transmission of feline spongiform encephalopathy in a captive cheetah. PLoS ONE 2009, 4, e6929. [Google Scholar] [CrossRef] [PubMed]
- Aguilar-Calvo, P.; Garcia, C.; Espinosa, J.C.; Andreoletti, O.; Torres, J.M. Prion and prion-like diseases in animals. Virus Res. 2015, 207, 82–93. [Google Scholar] [CrossRef] [PubMed]
- Hilbe, M.M.; Soldati, G.G.; Zlinszky, K.K.; Wunderlin, S.S.; Ehrensperger, F.F. Immunohistochemical study of PrP(Sc) distribution in neural and extraneural tissues of two cats with feline spongiform encephalopathy. BMC Vet. Res. 2009, 5, 11. [Google Scholar] [CrossRef] [PubMed]
- Eiden, M.; Hoffmann, C.; Balkema-Buschmann, A.; Muller, M.; Baumgartner, K.; Groschup, M.H. Biochemical and immunohistochemical characterization of feline spongiform encephalopathy in a German captive cheetah. J. Gen. Virol. 2010, 91, 2874–2883. [Google Scholar] [CrossRef]
- Imran, M.; Mahmood, S. An overview of animal prion diseases. Virol. J. 2011, 8, 493. [Google Scholar] [CrossRef]
- Baylis, M.; Goldmann, W. The genetics of scrapie in sheep and goats. Curr. Mol. Med. 2004, 4, 385–396. [Google Scholar] [CrossRef]
- Corbiere, F.; Perrin-Chauvineau, C.; Lacroux, C.; Costes, P.; Thomas, M.; Bremaud, I.; Martin, S.; Lugan, S.; Chartier, C.; Schelcher, F.; et al. PrP-associated resistance to scrapie in five highly infected goat herds. J. Gen. Virol. 2013, 94, 241–245. [Google Scholar] [CrossRef]
- Hazards, E.P.o.B.; Ricci, A.; Allende, A.; Bolton, D.; Chemaly, M.; Davies, R.; Fernandez Escamez, P.S.; Girones, R.; Herman, L.; Koutsoumanis, K.; et al. Genetic resistance to transmissible spongiform encephalopathies (TSE) in goats. EFSA J. 2017, 15, e04962. [Google Scholar] [CrossRef]
- Jeong, B.H.; Kim, Y.S. Genetic studies in human prion diseases. J. Korean Med. Sci. 2014, 29, 623–632. [Google Scholar] [CrossRef]
- Jeong, B.H.; Lee, K.H.; Kim, N.H.; Jin, J.K.; Kim, J.I.; Carp, R.I.; Kim, Y.S. Association of sporadic Creutzfeldt-Jakob disease with homozygous genotypes at PRNP codons 129 and 219 in the Korean population. Neurogenetics 2005, 6, 229–232. [Google Scholar] [CrossRef]
- Petraroli, R.; Pocchiari, M. Codon 219 polymorphism of PRNP in healthy Caucasians and Creutzfeldt-Jakob disease patients. Am. J. Hum. Genet. 1996, 58, 888–889. [Google Scholar]
- Palmer, M.S.; Dryden, A.J.; Hughes, J.T.; Collinge, J. Homozygous prion protein genotype predisposes to sporadic Creutzfeldt-Jakob disease. Nature 1991, 352, 340–342. [Google Scholar] [CrossRef]
- Gelasakis, A.I.; Boukouvala, E.; Babetsa, M.; Katharopoulos, E.; Palaska, V.; Papakostaki, D.; Giadinis, N.D.; Loukovitis, D.; Langeveld, J.P.M.; Ekateriniadou, L.V. Polymorphisms of Codons 110, 146, 211 and 222 at the Goat PRNP Locus and Their Association with Scrapie in Greece. Animals 2021, 11, 2340. [Google Scholar] [CrossRef]
- Acutis, P.L.; Colussi, S.; Santagada, G.; Laurenza, C.; Maniaci, M.G.; Riina, M.V.; Peletto, S.; Goldmann, W.; Bossers, A.; Caramelli, M.; et al. Genetic variability of the PRNP gene in goat breeds from Northern and Southern Italy. J. Appl. Microbiol. 2008, 104, 1782–1789. [Google Scholar] [CrossRef][Green Version]
- Georgiadou, S.; Ortiz-Pelaez, A.; Simmons, M.M.; Windl, O.; Dawson, M.; Neocleous, P.; Papasavva-Stylianou, P. Goats with aspartic acid or serine at codon 146 of the PRNP gene remain scrapie-negative after lifetime exposure in affected herds in Cyprus. Epidemiol. Infect. 2017, 145, 326–328. [Google Scholar] [CrossRef]
- White, S.N.; Reynolds, J.O.; Waldron, D.F.; Schneider, D.A.; O’Rourke, K.I. Extended scrapie incubation time in goats singly heterozygous for PRNP S146 or K222. Gene 2012, 501, 49–51. [Google Scholar] [CrossRef]
- Goldmann, W.; Marier, E.; Stewart, P.; Konold, T.; Street, S.; Langeveld, J.; Windl, O.; Ortiz-Pelaez, A. Prion protein genotype survey confirms low frequency of scrapie-resistant K222 allele in British goat herds. Vet. Rec. 2016, 178, 168. [Google Scholar] [CrossRef]
- Vaccari, G.; Panagiotidis, C.H.; Acin, C.; Peletto, S.; Barillet, F.; Acutis, P.; Bossers, A.; Langeveld, J.; van Keulen, L.; Sklaviadis, T.; et al. State-of-the-art review of goat TSE in the European Union, with special emphasis on PRNP genetics and epidemiology. Vet. Res. 2009, 40, 48. [Google Scholar] [CrossRef]
- Barillet, F.; Mariat, D.; Amigues, Y.; Faugeras, R.; Caillat, H.; Moazami-Goudarzi, K.; Rupp, R.; Babilliot, J.M.; Lacroux, C.; Lugan, S.; et al. Identification of seven haplotypes of the caprine PrP gene at codons 127, 142, 154, 211, 222 and 240 in French Alpine and Saanen breeds and their association with classical scrapie. J. Gen. Virol. 2009, 90, 769–776. [Google Scholar] [CrossRef]
- Cinar, M.U.; Schneider, D.A.; Waldron, D.F.; O’Rourke, K.I.; White, S.N. Goats singly heterozygous for PRNP S146 or K222 orally inoculated with classical scrapie at birth show no disease at ages well beyond 6 years. Vet. J. 2018, 233, 19–24. [Google Scholar] [CrossRef]
- Papasavva-Stylianou, P.; Simmons, M.M.; Ortiz-Pelaez, A.; Windl, O.; Spiropoulos, J.; Georgiadou, S. Effect of Polymorphisms at Codon 146 of the Goat PRNP Gene on Susceptibility to Challenge with Classical Scrapie by Different Routes. J. Virol. 2017, 91, 22. [Google Scholar] [CrossRef]
- Papasavva-Stylianou, P.; Windl, O.; Saunders, G.; Mavrikiou, P.; Toumazos, P.; Kakoyiannis, C. PrP gene polymorphisms in Cyprus goats and their association with resistance or susceptibility to natural scrapie. Vet. J. 2011, 187, 245–250. [Google Scholar] [CrossRef]
- Acutis, P.L.; Martucci, F.; D’Angelo, A.; Peletto, S.; Colussi, S.; Maurella, C.; Porcario, C.; Iulini, B.; Mazza, M.; Dell’atti, L.; et al. Resistance to classical scrapie in experimentally challenged goats carrying mutation K222 of the prion protein gene. Vet. Res. 2012, 43, 8. [Google Scholar] [CrossRef]
- Maestrale, C.; Cancedda, M.G.; Pintus, D.; Masia, M.; Nonno, R.; Ru, G.; Carta, A.; Demontis, F.; Santucciu, C.; Ligios, C. Genetic and Pathological Follow-Up Study of Goats Experimentally and Naturally Exposed to a Sheep Scrapie Isolate. J. Virol. 2015, 89, 10044–10052. [Google Scholar] [CrossRef]
- Billinis, C.; Panagiotidis, C.H.; Psychas, V.; Argyroudis, S.; Nicolaou, A.; Leontides, S.; Papadopoulos, O.; Sklaviadis, T. Prion protein gene polymorphisms in natural goat scrapie. J. Gen. Virol. 2002, 83, 713–721. [Google Scholar] [CrossRef]
- Peoc’h, K.; Guerin, C.; Brandel, J.P.; Launay, J.M.; Laplanche, J.L. First report of polymorphisms in the prion-like protein gene (PRND): Implications for human prion diseases. Neurosci. Lett. 2000, 286, 144–148. [Google Scholar] [CrossRef]
- Xi, D.; Liu, Q.; Guo, J.; Yu, H.; Yang, Y.; He, Y.; Mao, H.; Gou, X.; Deng, W. Genetic variability of the coding region for the prion protein gene (PRNP) in gayal (Bos frontalis). Mol. Biol. Rep. 2012, 39, 2011–2020. [Google Scholar] [CrossRef]
- Sanchez-Garcia, J.; Fernandez-Funez, P. D159 and S167 are protective residues in the prion protein from dog and horse, two prion-resistant animals. Neurobiol. Dis. 2018, 119, 1–12. [Google Scholar] [CrossRef]
- Won, S.Y.; Kim, Y.C.; Kim, K.; Kim, A.D.; Jeong, B.H. The First Report of Polymorphisms and Genetic Features of the prion-like Protein Gene (PRND) in a Prion Disease-Resistant Animal, Dog. Int. J. Mol. Sci. 2019, 20, 1404. [Google Scholar] [CrossRef]
- Zoubeyda, K.; Imane, M.; Youcef, C.; Baaissa, B.; Suheil, G.S.; Michela, C.; Antonio, C.; Umberto, A.; Barbara, C.; Gabriele, V. Variability of the prion protein gene (PRNP) in Algerian dromedary populations. Animal Gene 2020, 17–18, 200106. [Google Scholar] [CrossRef]
- Jeong, M.J.; Kim, Y.C.; Jeong, B.H. The first report of single nucleotide polymorphisms in the open reading frame of the prion-like protein gene in rabbits. Front. Vet. Sci. 2024, 11, 1388339. [Google Scholar] [CrossRef]
- Kim, H.H.; Kim, Y.C.; Kim, K.; Kim, A.D.; Jeong, B.H. Novel Polymorphisms and Genetic Features of the Prion Protein Gene (PRNP) in Cats, Hosts of Feline Spongiform Encephalopathy. Genes 2020, 12, 13. [Google Scholar] [CrossRef]
- Kim, Y.C.; Kim, H.H.; Kim, K.; Kim, A.D.; Jeong, B.H. Novel Polymorphisms and Genetic Characteristics of the Shadow of Prion Protein Gene (SPRN) in Cats, Hosts of Feline Spongiform Encephalopathy. Viruses 2022, 14, 981. [Google Scholar] [CrossRef]
- Moore, R.C.; Lee, I.Y.; Silverman, G.L.; Harrison, P.M.; Strome, R.; Heinrich, C.; Karunaratne, A.; Pasternak, S.H.; Chishti, M.A.; Liang, Y.; et al. Ataxia in prion protein (PrP)-deficient mice is associated with upregulation of the novel PrP-like protein doppel. J. Mol. Biol. 1999, 292, 797–817. [Google Scholar] [CrossRef]
- Benvegnu, S.; Franciotta, D.; Sussman, J.; Bachi, A.; Zardini, E.; Torreri, P.; Govaerts, C.; Pizzo, S.; Legname, G. Prion protein paralog doppel protein interacts with alpha-2-macroglobulin: A plausible mechanism for doppel-mediated neurodegeneration. PLoS ONE 2009, 4, e5968. [Google Scholar] [CrossRef]
- Jeong, B.H.; Kim, N.H.; Choi, E.K.; Lee, C.; Song, Y.H.; Kim, J.I.; Carp, R.I.; Kim, Y.S. Polymorphism at 3′ UTR +28 of the prion-like protein gene is associated with sporadic Creutzfeldt-Jakob disease. Eur. J. Hum. Genet. 2005, 13, 1094–1097. [Google Scholar] [CrossRef]
- Croes, E.A.; Alizadeh, B.Z.; Bertoli-Avella, A.M.; Rademaker, T.; Vergeer-Drop, J.; Dermaut, B.; Houwing-Duistermaat, J.J.; Wientjens, D.P.; Hofman, A.; Van Broeckhoven, C.; et al. Polymorphisms in the prion protein gene and in the doppel gene increase susceptibility for Creutzfeldt-Jakob disease. Eur. J. Hum. Genet. 2004, 12, 389–394. [Google Scholar] [CrossRef]
- Kim, Y.C.; Jeong, B.H. Bovine spongiform encephalopathy (BSE) associated polymorphisms of the prion-like protein gene (PRND) in Korean dairy cattle and Hanwoo. J. Dairy Res. 2018, 85, 7–11. [Google Scholar] [CrossRef]
- Mesquita, P.; Batista, M.; Marques, M.R.; Santos, I.C.; Pimenta, J.; Silva Pereira, M.; Carolino, I.; Santos Silva, F.; Oliveira Sousa, M.C.; Gama, L.T.; et al. Prion-like Doppel gene polymorphisms and scrapie susceptibility in Portuguese sheep breeds. Anim. Genet. 2010, 41, 311–314. [Google Scholar] [CrossRef]
- Jeong, M.J.; Kim, Y.C.; Jeong, B.H. Prion-like protein gene (PRND) polymorphisms associated with scrapie susceptibility in Korean native black goats. PLoS ONE 2018, 13, e0206209. [Google Scholar] [CrossRef]
- Uboldi, C.; Del Vecchio, I.; Foti, M.G.; Azzalin, A.; Paulis, M.; Raimondi, E.; Vaccari, G.; Agrimi, U.; Di Guardo, G.; Comincini, S.; et al. Prion-like Doppel gene (PRND) in the goat: Genomic structure, cDNA, and polymorphisms. Mamm. Genome 2005, 16, 963–971. [Google Scholar] [CrossRef]
- Lee, J.-G. Genetic Variation and Disease 3; Worldscience: Warsaw, Poland, 2015. [Google Scholar]
- Hosking, L.; Lumsden, S.; Lewis, K.; Yeo, A.; McCarthy, L.; Bansal, A.; Riley, J.; Purvis, I.; Xu, C.F. Detection of genotyping errors by Hardy-Weinberg equilibrium testing. Eur. J. Hum. Genet. 2004, 12, 395–399. [Google Scholar] [CrossRef]
- Gomes, I.; Collins, A.; Lonjou, C.; Thomas, N.S.; Wilkinson, J.; Watson, M.; Morton, N. Hardy-Weinberg quality control. Ann. Hum. Genet. 1999, 63, 535–538. [Google Scholar] [CrossRef]
- Gabriel, S.B.; Schaffner, S.F.; Nguyen, H.; Moore, J.M.; Roy, J.; Blumenstiel, B.; Higgins, J.; DeFelice, M.; Lochner, A.; Faggart, M.; et al. The structure of haplotype blocks in the human genome. Science 2002, 296, 2225–2229. [Google Scholar] [CrossRef]
- Adzhubei, I.A.; Schmidt, S.; Peshkin, L.; Ramensky, V.E.; Gerasimova, A.; Bork, P.; Kondrashov, A.S.; Sunyaev, S.R. A method and server for predicting damaging missense mutations. Nat. Methods 2010, 7, 248–249. [Google Scholar] [CrossRef]
- Kumar, P.; Henikoff, S.; Ng, P.C. Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat. Protoc. 2009, 4, 1073–1081. [Google Scholar] [CrossRef]
- Tang, H.; Thomas, P.D. PANTHER-PSEP: Predicting disease-causing genetic variants using position-specific evolutionary preservation. Bioinformatics 2016, 32, 2230–2232. [Google Scholar] [CrossRef]
- Ittisoponpisan, S.; Islam, S.A.; Khanna, T.; Alhuzimi, E.; David, A.; Sternberg, M.J.E. Can Predicted Protein 3D Structures Provide Reliable Insights into whether Missense Variants Are Disease Associated? J. Mol. Biol. 2019, 431, 2197–2212. [Google Scholar] [CrossRef]
- Mirdita, M.; Schutze, K.; Moriwaki, Y.; Heo, L.; Ovchinnikov, S.; Steinegger, M. ColabFold: Making protein folding accessible to all. Nat. Methods 2022, 19, 679–682. [Google Scholar] [CrossRef]
- Won, S.Y.; Kim, Y.C.; Do, K.; Jeong, B.H. Absence of Strong Genetic Linkage Disequilibrium between Single Nucleotide Polymorphisms (SNPs) in the Prion Protein Gene (PRNP) and the Prion-Like Protein Gene (PRND) in the Horse, a Prion-Resistant Species. Genes 2020, 11, 518. [Google Scholar] [CrossRef]
- Comincini, S.; Foti, M.G.; Tranulis, M.A.; Hills, D.; Di Guardo, G.; Vaccari, G.; Williams, J.L.; Harbitz, I.; Ferretti, L. Genomic organization, comparative analysis, and genetic polymorphisms of the bovine and ovine prion Doppel genes (PRND). Mamm. Genome 2001, 12, 729–733. [Google Scholar] [CrossRef] [PubMed]
- Ardlie, K.G.; Kruglyak, L.; Seielstad, M. Patterns of linkage disequilibrium in the human genome. Nat. Rev. Genet. 2002, 3, 299–309. [Google Scholar] [CrossRef] [PubMed]
- Behrens, A.; Genoud, N.; Naumann, H.; Rulicke, T.; Janett, F.; Heppner, F.L.; Ledermann, B.; Aguzzi, A. Absence of the prion protein homologue Doppel causes male sterility. EMBO J. 2002, 21, 3652–3658. [Google Scholar] [CrossRef] [PubMed]
- Paisley, D.; Banks, S.; Selfridge, J.; McLennan, N.F.; Ritchie, A.M.; McEwan, C.; Irvine, D.S.; Saunders, P.T.; Manson, J.C.; Melton, D.W. Male infertility and DNA damage in Doppel knockout and prion protein/Doppel double-knockout mice. Am. J. Pathol. 2004, 164, 2279–2288. [Google Scholar] [CrossRef]
- Ferreira, L.M.; Garcia-Herreros, M.; Domingos, A.; Marques, C.C.; Mesquita, P.; Barbas, J.P.; Baptista, M.C.; Pimenta, J.; Horta, A.E.M.; Prates, J.A.M.; et al. Prion protein 2 (dublet) gene (PRND): Role in ovine semen capacitation, cryopreservation and fertility. Reprod. Fertil. Dev. 2017, 29, 985–997. [Google Scholar] [CrossRef]
- Moore, R.A.; Herzog, C.; Errett, J.; Kocisko, D.A.; Arnold, K.M.; Hayes, S.F.; Priola, S.A. Octapeptide repeat insertions increase the rate of protease-resistant prion protein formation. Protein Sci. 2006, 15, 609–619. [Google Scholar] [CrossRef]
Polymorphisms | Genotype Frequency, n (%) | Allele Frequency, n (%) | HWE | |||||
---|---|---|---|---|---|---|---|---|
c.–34C>T | CC | CT | TT | C | T | |||
206 | 4 | 0 | 416 | 4 | 0.89 | |||
(98.1) | (1.9) | (0) | (99.05) | (0.95) | ||||
c.–3A>G | AA | AG | GG | A | G | |||
188 | 19 | 3 | 395 | 25 | 0.01 | |||
(89.52) | (9.05) | (1.43) | (94.05) | (5.95) | ||||
c.66G>T/A | GG | GT | GA | TT | G | T | A | |
(S22S) | 122 | 73 | 1 | 14 | 317 | 101 | 1 | 0.5 * |
(58.1) | (34.76) | (0.48) | (6.67) | (75.71) | (24.05) | (0.24) | 0.96 ** | |
c.72C>T | CC | CT | TT | C | T | |||
(V24V) | 201 | 9 | 0 | 411 | 9 | 0.75 | ||
(95.71) | (4.29) | (0) | (97.86) | (2.14) | ||||
c.73A>G | AA | AG | GG | A | G | |||
(K25E) | 194 | 15 | 1 | 403 | 17 | 0.24 | ||
(92.38) | (7.14) | (0.48) | (95.95) | (4.05) | ||||
c.76G>A | GG | GA | AA | G | A | |||
(A26T) | 177 | 32 | 1 | 386 | 34 | 0.73 | ||
(84.29) | (15.24) | (0.48) | (91.9) | (8.10) | ||||
c.97A>G | AA | AG | GG | A | G | |||
(I33V) | 203 | 7 | 0 | 413 | 7 | 0.81 | ||
(96.67) | (3.33) | (0) | (98.33) | (1.67) | ||||
c.148C>T | CC | CT | TT | C | T | |||
(H50Y) | 206 | 3 | 1 | 415 | 5 | 0.00 | ||
(98.1) | (1.43) | (0.48) | (98.81) | (1.19) | ||||
c.251A>G | AA | AG | GG | A | G | |||
(Q84R) | 203 | 7 | 0 | 413 | 7 | 0.81 | ||
(96.67) | (3.33) | (0) | (98.33) | (1.67) | ||||
c.360G>A | GG | GA | AA | G | A | |||
(L120L) | 204 | 6 | 0 | 414 | 6 | 0.83 | ||
(97.14) | (2.86) | (0) | (98.57) | (1.43) | ||||
c.469C>A | CC | CA | AA | C | A | |||
(L157I) | 199 | 11 | 0 | 409 | 11 | 0.7 | ||
(94.76) | (5.24) | (0) | (97.38) | (2.62) | ||||
c.510A>G | AA | AG | GG | A | G | |||
(L170L) | 191 | 19 | 0 | 401 | 19 | 0.49 | ||
(90.95) | (9.05) | (0) | (95.48) | (4.52) | ||||
c.537+25G>A | GG | GA | AA | G | A | |||
202 | 8 | 0 | 412 | 8 | 0.78 | |||
(96.19) | (3.81) | (0) | (98.1) | (1.9) | ||||
c.537+41_537+42 insGTGAG | WT/WT | WT/INS | INS/INS | WT | INS | |||
193 | 17 | 0 | 403 | 17 | 0.54 | |||
(91.9) | (8.1) | (0) | (95.95) | (4.05) |
r2 | c. –34C>T | c. –3A>G | c.66G>T | c.72C>T | c.73A>G | c.76G>A | c.97A>G | c.148C>T | c.251A>G | c.360G>A | c.469C>A | c.510A>G | c.537+25 G>A | c.537+41_537+42 insGTGAG | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
D’ | |||||||||||||||
c.–34C>T | - | 0.001 | 0.003 | 0 | 0 | 0.001 | 0 | 0 | 0 | 0 | 0 | 0.203 | 0.495 | 0.228 | |
c.–3A>G | 1 | - | 0.02 | 0.346 | 0.666 | 0.006 | 0.268 | 0.116 | 0.268 | 0.229 | 0.002 | 0.003 | 0.001 | 0.003 | |
c.66G>T | 1 | 1 | - | 0.007 | 0.014 | 0.017 | 0.005 | 0.004 | 0.005 | 0.005 | 0.009 | 0.015 | 0.006 | 0.014 | |
c.72C>T | 1 | 1 | 1 | - | 0.519 | 0.002 | 0.051 | 0 | 0.051 | 0.011 | 0.001 | 0.001 | 0 | 0.001 | |
c.73A>G | 1 | 1 | 1 | 1 | - | 0.004 | 0.02 | 0.177 | 0.02 | 0.231 | 0.001 | 0.001 | 0.001 | 0.002 | |
c.76G>A | 1 | 1 | 0.785 | 1 | 1 | - | 0 | 0.001 | 0 | 0.001 | 0 | 0.004 | 0 | 0.004 | |
c.97A>G | 1 | 1 | 1 | 0.257 | 0.226 | 0.273 | - | 0 | 1 | 0 | 0 | 0.001 | 0 | 0.001 | |
c.148C>T | 1 | 0.781 | 1 | 1 | 0.778 | 1 | 1 | - | 0 | 0 | 0 | 0.001 | 0 | 0.001 | |
c.251A>G | 1 | 1 | 1 | 0.257 | 0.226 | 0.273 | 1 | 1 | - | 0 | 0 | 0.001 | 0 | 0.001 | |
c.360G>A | 1 | 1 | 1 | 0.131 | 0.821 | 1 | 1 | 1 | 1 | - | 0 | 0.002 | 0 | 0.001 | |
c.469C>A | 1 | 1 | 1 | 1 | 1 | 0.027 | 1 | 1 | 1 | 1 | - | 0 | 0.004 | 0 | |
c.510A>G | 1 | 1 | 1 | 1 | 0.779 | 1 | 1 | 1 | 1 | 0.085 | 0 | - | 0.307 | 0.89 | |
c.537+25 G>A | 1 | 1 | 1 | 1 | 1 | 0.521 | 1 | 1 | 1 | 1 | 0.078 | 0.865 | - | 0.345 | |
c.537+41_ 537+42ins GTGAG | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 0.011 | 1 | 0.866 | - |
c.–34C>T | c.–3A>G | c.66G>T | c.72C>T | c.73A>G | c.76G>A | c.97A>G | c.148C>T | c.251A>G | c.360G>A | c.469C>A | c.510A>G | c.537+25 G>A | c.537+41_537+42insGTGAG | n (%) | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ht1 | C | A | G | C | A | G | A | C | A | G | C | A | G | Wt | 231 (55) |
ht2 | C | A | T | C | A | G | A | C | A | G | C | A | G | Wt | 99 (23.6) |
ht3 | C | A | G | C | A | A | A | C | A | G | C | A | G | Wt | 32 (7.6) |
ht4 | C | A | G | C | A | G | A | C | A | G | C | G | G | Ins | 10 (2.4) |
ht5 | C | A | G | C | A | G | A | C | A | G | A | A | G | Wt | 9 (2.1) |
ht6 | C | G | G | T | G | G | A | C | A | G | C | A | G | Wt | 8 (1.9) |
ht7 | C | G | G | C | A | G | G | C | G | G | C | A | G | Wt | 7 (1.7) |
ht8 | C | G | G | C | G | G | A | T | A | G | C | A | G | Wt | 4 (1) |
ht9 | T | A | G | C | A | G | A | C | A | G | C | G | A | Ins | 4 (1) |
ht10 | C | G | G | C | G | G | A | C | A | A | C | A | G | Wt | 3 (0.7) |
ht11 | C | A | G | C | A | G | A | C | A | G | C | G | A | Ins | 1 (0.2) |
Other * | C | A | G | C | A | A | A | C | A | G | A | A | G | Wt | 12 (2.8) |
Variations | PolyPhen-2 | SIFT | PANTHER | Missense3D | ||||
---|---|---|---|---|---|---|---|---|
Score | Prediction | Score | Prediction | Score | Prediction | Score | Prediction | |
c.73A>G (K25E) | 0.001 | Benign | 0.17 | Tolerated | 0.27 | Probably benign | - | No structural damage detected |
c.76G>A (A26T) | 0.686 | Possibly damaging | 0.56 | Tolerated | 0.27 | Probably benign | - | No structural damage detected |
c.97A>G (I33V) | 0.082 | Benign | 0.48 | Tolerated | 0.27 | Probably benign | 35.26 | Clash |
c.148C>T (H50Y) | 0.295 | Benign | 0.22 | Tolerated | - | Not scored | - | No structural damage detected |
c.251A>G (Q84R) | 0.003 | Benign | 0 | Damaging | 0.27 | Probably benign | - | No structural damage detected |
c.469C>A (L157I) | 0.284 | Benign | 0 | Damaging | 0.27 | Probably benign | - | No structural damage detected |
PRNP c.201 C>T | PRNP c.214_240 delCCCCACGCCGGCGGAGGCTGGGGTCAG | |||
---|---|---|---|---|
PRND | r2 | D’ | r2 | D’ |
c.–34C>T | 0 | 0.276 | 0 | 1 |
c.–3A>G | 0.034 | 1 | 0.228 | 0.862 |
c.66G>T | 0.604 | 1 | 0.006 | 1 |
c.72C>T | 0.012 | 1 | 0.043 | 0.219 |
c.73A>G | 0.023 | 1 | 0.016 | 0.186 |
c.76G>A | 0.028 | 0.777 | 0.002 | 0.105 |
c.97A>G | 0.009 | 1 | 0.873 | 1 |
c.148C>T | 0.006 | 1 | 0 | 1 |
c.251A>G | 0.009 | 1 | 0.873 | 1 |
c.360G>A | 0.008 | 1 | 0 | 1 |
c.469C>A | 0.014 | 1 | 0.001 | 1 |
c.510A>G | 0.015 | 0.802 | 0.001 | 1 |
c.537+25G>A | 0.003 | 0.545 | 0 | 1 |
c.537+41_537+42insGTGAG | 0.013 | 0.77 | 0.001 | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jeong, M.-J.; Kim, Y.-C.; Jeong, B.-H. First Report of Polymorphisms and Genetic Characteristics of Prion-like Protein Gene (PRND) in Cats. Animals 2024, 14, 3438. https://doi.org/10.3390/ani14233438
Jeong M-J, Kim Y-C, Jeong B-H. First Report of Polymorphisms and Genetic Characteristics of Prion-like Protein Gene (PRND) in Cats. Animals. 2024; 14(23):3438. https://doi.org/10.3390/ani14233438
Chicago/Turabian StyleJeong, Min-Ju, Yong-Chan Kim, and Byung-Hoon Jeong. 2024. "First Report of Polymorphisms and Genetic Characteristics of Prion-like Protein Gene (PRND) in Cats" Animals 14, no. 23: 3438. https://doi.org/10.3390/ani14233438
APA StyleJeong, M.-J., Kim, Y.-C., & Jeong, B.-H. (2024). First Report of Polymorphisms and Genetic Characteristics of Prion-like Protein Gene (PRND) in Cats. Animals, 14(23), 3438. https://doi.org/10.3390/ani14233438