In Vitro Analysis of LPS-Induced miRNA Differences in Bovine Endometrial Cells and Study of Related Pathways
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. RNA Extraction, RT-PCR, and RT-qPCR
2.3. Cell Viability Assay
2.4. Flow Cytometry
2.5. miRNA Data Analysis
2.6. Go and KEGG Analysis
2.7. Statistical Analysis
3. Results
3.1. In Vitro Endometritis Model
3.2. Detection of LPS-Induced Cell Apoptosis by Flow Cytometry
3.3. MiRNA Length Distribution
3.4. Differential miRNA Expression Analysis
3.5. GO Enrichment and KEGG Pathway Analyses of Differentially Expressed miRNA Target Genes
3.6. Target Gene Prediction of Differentially Expressed miRNAs and Verification
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Suleymanov, S.M.; Usha, B.V.; Vatnikov, Y.A.; Sotnikova, E.D.; Kulikov, E.V.; Parshina, V.I.; Bolshakova, M.V.; Lyshko, M.U.; Romanova, E.V. Structural uterine changes in postpartum endometritis in cows. Vet. World 2018, 11, 1473–1478. [Google Scholar] [CrossRef] [PubMed]
- Azawi, O. Postpartum uterine infection in cattle. Anim. Reprod. Sci. 2008, 105, 187–208. [Google Scholar] [CrossRef] [PubMed]
- Zahid, A.; Eiza, N.U.; Khalid, M.; Irshad, H.U.; Shabbir, M.A.B.; Ali, A.; Chaudhry, T.H.; Ahmed, S.; Maan, M.K.; Huang, L. Targeting inflammation for the treatment of endometritis in bovines. Microb. Pathog. 2024, 188, 106536. [Google Scholar] [CrossRef] [PubMed]
- Magata, F. Lipopolysaccharide-induced mechanisms of ovarian dysfunction in cows with uterine inflammatory diseases. J. Reprod. Dev. 2020, 66, 311–317. [Google Scholar] [CrossRef]
- Kasimanickam, V.; Owen, K.; Kasimanickam, R. Detection of genes encoding multidrug resistance and biofilm virulence factor in uterine pathogenic bacteria in postpartum dairy cows. Theriogenology 2016, 85, 173–179. [Google Scholar] [CrossRef]
- Paiano, R.; Moreno, L.; Gomes, V.; Parra, B.; Barbosa, M.; Sato, M.; Bonilla, J.; Pugliesi, G.; Baruselli, P.; Moreno, A. Assessment of the main pathogens associated with clinical and subclinical endometritis in cows by culture and MALDI-TOF mass spectrometry identification. J. Dairy Sci. 2022, 105, 3367–3376. [Google Scholar] [CrossRef]
- Ajevar, G.; Muthu, S.; Sarkar, M.; Kumar, H.; Das, G.K.; Krishnaswamy, N. Transcriptional profile of endometrial TLR4 and 5 genes during the estrous cycle and uterine infection in the buffalo (Bubalus bubalis). Vet. Res. Commun. 2014, 38, 171–176. [Google Scholar] [CrossRef]
- Tiwari, A.; Singh, P.; Jaitley, P.; Sharma, S.; Prakash, A.; Mandil, R.; Choudhury, S.; Gangwar, N.K.; Garg, S.K. Eucalyptus robusta leaves methanolic extract suppresses inflammatory mediators by specifically targeting TLR4/TLR9, MPO, COX2, iNOS and inflammatory cytokines in experimentally-induced endometritis in rats. J. Ethnopharmacol. 2018, 213, 149–158. [Google Scholar] [CrossRef]
- Zhang, H.; Wu, Z.M.; Yang, Y.P.; Shaukat, A.; Yang, J.; Guo, Y.F.; Zhang, T.; Zhu, X.Y.; Qiu, J.X.; Deng, G.Z.; et al. Catalpol ameliorates LPS-induced endometritis by inhibiting inflammation and TLR4/NF-κB signaling. J. Zhejiang Univ. Sci. B 2019, 20, 816–827, Erratum in J. Zhejiang Univ. Sci. B 2020, 21, 341. [Google Scholar] [CrossRef]
- He, P.A.R.; Chen, H.; Wei, H.; Cao, J. Activation of alpha7 nicotinic acetylcholine receptor protects bovine endometrial tissue against LPS-induced inflammatory injury via JAK2/STAT3 pathway and COX-2 derived prostaglandin E2. Eur. J. Pharmacol. 2021, 900, 174067. [Google Scholar]
- Li, T.; Hai, L.; Liu, B.; Mao, W.; Liu, K.; Li, Q.; Guo, Y.; Jia, Y.; Bao, H.; Cao, J. TLR2/4 promotes PGE(2) production to increase tissue damage in Escherichia coli-infected bovine endometrial explants via MyD88/p38 MAPK pathway. Theriogenology 2020, 152, 129–138. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.; Liu, B.; Mao, W.; Gao, R.; Feng, S.; Qian, Y.; Wu, J.; Zhang, S.; Gao, L.; Fu, C.; et al. PGE(2) downregulates LPS-induced inflammatory responses via the TLR4-NF-κB signaling pathway in bovine endometrial epithelial cells. Prostaglandins Leukot. Essent. Fat. Acids 2018, 129, 25–31. [Google Scholar] [CrossRef] [PubMed]
- Seese, M.H.; Steelman, A.J.; Erdman, J.W. The Impact of LPS on Inflammatory Responses in Alpha-Tocopherol Deficient Mice. Curr. Dev. Nutr. 2024, 8, 104416. [Google Scholar] [CrossRef] [PubMed]
- Chei, S.; Oh, H.-J.; Lee, K.; Jin, H.; Lee, J.-Y.; Lee, B.-Y. Dietary Silk Peptide Inhibits LPS-Induced Inflammatory Responses by Modulating Toll-Like Receptor 4 (TLR4) Signaling. Biomolecules 2020, 10, 771. [Google Scholar] [CrossRef]
- Kiyan, Y.; Tkachuk, S.; Rong, S.; Gorrasi, A.; Ragno, P.; Dumler, I.; Haller, H.; Shushakova, N. TLR4 Response to LPS Is Reinforced by Urokinase Receptor. Front. Immunol. 2020, 11, 573550. [Google Scholar] [CrossRef]
- Hines, D.J.; Choi, H.B.; Hines, R.M.; Phillips, A.G.; MacVicar, B.A. Prevention of LPS-induced microglia activation, cytokine production and sickness behavior with TLR4 receptor interfering peptides. PLoS ONE 2013, 8, e60388. [Google Scholar] [CrossRef]
- Haddad, J.J. The role of inflammatory cytokines and NF-kappaB/MAPK signaling pathways in the evolution of familial Mediterranean fever: Current clinical perspectives and potential therapeutic approaches. Cell Immunol. 2009, 260, 6–13. [Google Scholar] [CrossRef]
- Guo, J.; Chen, L.; Luo, N.; Li, C.; Chen, R.; Qu, X.; Liu, M.; Kang, L.; Cheng, Z. LPS/TLR4-mediated stromal cells acquire an invasive phenotype and are implicated in the pathogenesis of adenomyosis. Sci. Rep. 2016, 6, 21416. [Google Scholar] [CrossRef]
- Fu, Y.; Liu, B.; Feng, X.; Liu, Z.; Liang, D.; Li, F.; Li, D.; Cao, Y.; Feng, S.; Zhang, X.; et al. Lipopolysaccharide increases Toll-like receptor 4 and downstream Toll-like receptor signaling molecules expression in bovine endometrial epithelial cells. Vet. Immunol. Immunopathol. 2013, 151, 20–27. [Google Scholar] [CrossRef]
- Hyakushima, N.; Mitsuzawa, H.; Nishitani, C.; Sano, H.; Kuronuma, K.; Konishi, M.; Himi, T.; Miyake, K.; Kuroki, Y. Interaction of soluble form of recombinant extracellular TLR4 domain with MD-2 enables lipopolysaccharide binding and attenuates TLR4-mediated signaling. J. Immunol. 2004, 173, 6949–6954. [Google Scholar] [CrossRef]
- Viriyakosol, S.; Tobias, P.S.; Kirkland, T.N. Mutational analysis of membrane and soluble forms of human MD-2. J. Biol. Chem. 2006, 281, 11955–11964. [Google Scholar] [CrossRef] [PubMed]
- Lewis, B.P.; Burge, C.B.; Bartel, D.P. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 2005, 120, 15–20. [Google Scholar] [CrossRef] [PubMed]
- Ha, M.; Kim, V.N. Regulation of microRNA biogenesis. Nat. Rev. Mol. Cell Biol. 2014, 15, 509–524. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Kuek, V.; Liu, Y.; Tickner, J.; Yuan, Y.; Chen, L.; Zeng, Z.; Shao, M.; He, W.; Xu, J. MiR-214 is an important regulator of the musculoskeletal metabolism and disease. J. Cell. Physiol. 2018, 234, 231–245. [Google Scholar] [CrossRef]
- Jiang, K.; Yang, J.; Yang, C.; Zhang, T.; Shaukat, A.; Yang, X.; Dai, A.; Wu, H.; Deng, G. miR-148a suppresses inflammation in lipopolysaccharide-induced endometritis. J. Cell. Mol. Med. 2020, 24, 405–417. [Google Scholar] [CrossRef]
- Zhao, G.; Zhang, T.; Wu, H.; Jiang, K.; Qiu, C.; Deng, G. MicroRNA let-7c Improves LPS-Induced Outcomes of Endometritis by Suppressing NF-κB Signaling. Inflammation 2019, 42, 650–657. [Google Scholar] [CrossRef]
- Zhao, G.; Jiang, K.; Yang, Y.; Zhang, T.; Wu, H.; Shaukat, A.; Qiu, C.; Deng, G. The Potential Therapeutic Role of miR-223 in Bovine Endometritis by Targeting the NLRP3 Inflammasome. Front. Immunol. 2018, 9, 1916. [Google Scholar] [CrossRef]
- Salilew-Wondim, D.; Ibrahim, S.; Gebremedhn, S.; Tesfaye, D.; Heppelmann, M.; Bollwein, H.; Pfarrer, C.; Tholen, E.; Neuhoff, C.; Schellander, K.; et al. Clinical and subclinical endometritis induced alterations in bovine endometrial transcriptome and miRNome profile. BMC Genom. 2016, 17, 218. [Google Scholar] [CrossRef]
- Kelly, P.; Meade, K.G.; O’Farrelly, C. Non-canonical Inflammasome-Mediated IL-1β Production by Primary Endometrial Epithelial and Stromal Fibroblast Cells Is NLRP3 and Caspase-4 Dependent. Front. Immunol. 2019, 10, 102. [Google Scholar] [CrossRef]
- Swangchan-Uthai, T.; Lavender, C.R.; Cheng, Z.; Fouladi-Nashta, A.A.; Wathes, D.C. Time course of defense mechanisms in bovine endometrium in response to lipopolysaccharide. Biol. Reprod. 2012, 87, 135. [Google Scholar] [CrossRef]
- Gautam, G.; Nakao, T. Prevalence of urovagina and its effects on reproductive performance in Holstein cows. Theriogenology 2009, 71, 1451–1461. [Google Scholar] [CrossRef] [PubMed]
- Gilbert, R.O.; Shin, S.T.; Guard, C.L.; Erb, H.N.; Frajblat, M. Prevalence of endometritis and its effects on reproductive performance of dairy cows. Theriogenology 2005, 64, 1879–1888. [Google Scholar] [CrossRef] [PubMed]
- Wira, C.R.; Grant-Tschudy, K.S.; Crane-Godreau, M.A. Epithelial cells in the female reproductive tract: A central role as sentinels of immune protection. Am. J. Reprod. Immunol. 2005, 53, 65–76. [Google Scholar] [CrossRef] [PubMed]
- Davies, D.; Meade, K.G.; Herath, S.; Eckersall, P.D.; Gonzalez, D.; O White, J.; Conlan, R.S.; O’Farrelly, C.; Sheldon, I.M. Toll-like receptor and antimicrobial peptide expression in the bovine endometrium. Reprod. Biol. Endocrinol. 2008, 6, 53. [Google Scholar] [CrossRef] [PubMed]
- Herath, S.; Lilly, S.T.; Santos, N.R.; O Gilbert, R.; Goetze, L.; E Bryant, C.; O White, J.; Cronin, J.; Sheldon, I.M. Expression of genes associated with immunity in the endometrium of cattle with disparate postpartum uterine disease and fertility. Reprod. Biol. Endocrinol. 2009, 7, 55. [Google Scholar] [CrossRef]
- Lecchi, C.; Dilda, F.; Sartorelli, P.; Ceciliani, F. Widespread expression of SAA and Hp RNA in bovine tissues after evaluation of suitable reference genes. Vet. Immunol. Immunopathol. 2012, 145, 556–562. [Google Scholar] [CrossRef]
- Young-Speirs, M.; Drouin, D.; Cavalcante, P.A.; Barkema, H.W.; Cobo, E.R. Host defense cathelicidins in cattle: Types, production, bioactive functions and potential therapeutic and diagnostic applications. Int. J. Antimicrob. Agents 2018, 51, 813–821. [Google Scholar] [CrossRef]
- Gabler, C.; Fischer, C.; Drillich, M.; Einspanier, R.; Heuwieser, W. Time-dependent mRNA expression of selected pro-inflammatory factors in the endometrium of primiparous cows postpartum. Reprod. Biol. Endocrinol. 2010, 8, 152. [Google Scholar] [CrossRef]
- Zhang, Z.; Guo, Y.; Liu, Y.; Li, C.; Guo, M.; Deng, G. IFN-τ Displays Anti-Inflammatory Effects on Staphylococcus aureus Endometritis via Inhibiting the Activation of the NF-κB and MAPK Pathways in Mice. BioMed Res. Int. 2017, 2017, 2350482. [Google Scholar]
- Cheong, S.; Nydam, D.; Galvão, K.; Crosier, B.; Gilbert, R. Cow-level and herd-level risk factors for subclinical endometritis in lactating Holstein cows. J. Dairy Sci. 2011, 94, 762–770. [Google Scholar] [CrossRef]
- Yang, L.; Huang, W.; Yang, C.; Ma, T.; Hou, Q.; Sun, Z.; Zhang, H. Using PacBio sequencing to investigate the effects of treatment with lactic acid bacteria or antibiotics on cow endometritis. Electron. J. Biotechnol. 2021, 51, 67–78. [Google Scholar] [CrossRef]
- Li, R.; Maimai, T.; Yao, H.; Liu, X.; He, Z.; Xiao, C.; Wang, Y.; Xie, G. Protective effects of polydatin on LPS-induced endometritis in mice. Microb. Pathog. 2019, 137, 103720. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Zhao, Y.F.; Yang, J.; Jing, H.Y.; Liang, W.; Chen, M.Y.; Yang, M.; Wang, Y.; Guo, M.Y. Selenium alleviates lipopolysaccharide-induced endometritis via regulating the recruitment of TLR4 into lipid rafts in mice. Food Funct. 2020, 11, 200–210. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Deng, G.; Ma, X.; Zhang, T.; Guo, S.; Zhou, Q.; Yang, C. MiR-495–3p attenuates cell pyroptosis and endometritis through inhibiting the activation of NLRP3 inflammasome in bovine. Mol. Immunol. 2023, 163, 75–85. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.; Jiang, K.; Yin, N.; Ma, X.; Zhao, G.; Qiu, C.; Deng, G. Thymol mitigates lipopolysaccharide-induced endometritis by regulating the TLR4- and ROS-mediated NF-κB signaling pathways. Oncotarget 2017, 8, 20042–20055. [Google Scholar] [CrossRef]
- Dong, J.; Ji, B.; Jiang, Y.; Fei, F.; Guo, L.; Liu, K.; Cui, L.; Meng, X.; Li, J.; Wang, H. A20 Alleviates the Inflammatory Response in Bovine Endometrial Epithelial Cells by Promoting Autophagy. Animals 2024, 14, 2876. [Google Scholar] [CrossRef]
- Zhao, Y.; Zhang, Y.; Sun, M.; Li, B.; Li, Y.; Hua, S. Cecropin A Alleviates LPS-Induced Oxidative Stress and Apoptosis of Bovine Endometrial Epithelial Cells. Animals 2024, 14, 768. [Google Scholar] [CrossRef]
- Zhang, C.; Hsu, A.C.-Y.; Pan, H.; Gu, Y.; Zuo, X.; Dong, B.; Wang, Z.; Zheng, J.; Lu, J.; Zheng, R.; et al. Columbianadin Suppresses Lipopolysaccharide (LPS)-Induced Inflammation and Apoptosis through the NOD1 Pathway. Molecules 2019, 24, 549. [Google Scholar] [CrossRef]
- Fu, M.; Wang, J.; Xu, D.; Cao, N.; Li, W.; Li, F.; Liu, Z.; Li, Y.; Zhu, C.; Huang, Y.; et al. Polysaccharide of Atractylodes macrocephala Koidz alleviates LPS-induced proliferation, differentiation inhibition and excessive apoptosis in chicken embryonic myogenic cells. Vet. Med. Sci. 2024, 10, e1412. [Google Scholar] [CrossRef]
- Lopera-Vasquez, R.; Hamdi, M.; Maillo, V.; Gutierrez-Adan, A.; Bermejo-Alvarez, P.; Ramírez, M.; Yáñez-Mó, M.; Rizos, D. Effect of bovine oviductal extracellular vesicles on embryo development and quality in vitro. Reproduction 2017, 153, 461–470. [Google Scholar] [CrossRef]
- Huang, Y.; Zhang, C.; Wang, Y.; Sun, X. Identification and analysis of miRNAs in the normal and fatty liver from the Holstein dairy cow. Anim. Biotechnol. 2022, 33, 468–479. [Google Scholar] [CrossRef] [PubMed]
- Lv, C.; Li, Z.; Wang, Q.; Wang, Y.; Zhao, X.; Zhang, Y. miRNA-150_R-1 mediates the HIF-1/ErbB signaling pathway to regulate the adhesion of endometrial epithelial cells in cows experiencing retained placenta. Front. Vet. Sci. 2022, 9, 1037880. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Bissonnette, N.; Griebel, P.; Dudemaine, P.-L.; Do, D.N.; Mao, Y.; Ibeagha-Awemu, E.M. PSVI-14 Differentially expressed microRNAs with potential regulatory roles in ileum of Holstein cows with subclinical Johne’s disease. J. Anim. Sci. 2019, 97, 206–207. [Google Scholar] [CrossRef]
- Wang, X.P.; Luoreng, Z.M.; Zan, L.S.; Raza, S.H.A.; Li, F.; Li, N.; Liu, S. Expression patterns of miR-146a and miR-146b in mastitis infected dairy cattle. Mol. Cell. Probes 2016, 30, 342–344. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Zhang, C.-L.; Liao, X.-X.; Chen, D.; Wang, W.-Q.; Zhu, Y.-H.; Geng, X.-H.; Ji, D.-J.; Mao, Y.-J.; Gong, Y.-C.; et al. Transcriptome microRNA profiling of bovine mammary glands infected with Staphylococcus aureus. Int. J. Mol. Sci. 2015, 16, 4997–5013. [Google Scholar] [CrossRef]
- Chen, N.; Ma, B.; Guo, S.; Yin, B.; Zhang, J.; Deng, G. microRNA-196b alleviates lipopolysaccharide-induced inflammatory injury by targeting NRAS. Mol. Immunol. 2022, 147, 10–20. [Google Scholar] [CrossRef]
- Huang, Z.; Chen, Y.; Yang, C.; Ma, B.; Guo, S.; Zhang, J.; Chen, N.; Umar, T.; Yin, B.; Deng, G. Enhanced expression of miR-26a ameliorates lipopolysaccharide-induced endometritis by targeting MAP3K8 to inactivate MAPK signaling pathway. J. Reprod. Immunol. 2022, 154, 103751. [Google Scholar] [CrossRef]
- Liang, Y.; Shen, T.; Ming, Q.; Han, G.; Zhang, Y.; Liang, J.; Zhu, D. Alpinetin ameliorates inflammatory response in LPS-induced endometritis in mice. Int. Immunopharmacol. 2018, 62, 309–312. [Google Scholar] [CrossRef]







| Gene Name | Primer Sequences | Gene Bank ID | Tm (°C) | Length (up) | 
|---|---|---|---|---|
| β-actin | F: CATCACCATCGGCAATGAGC | NM_173979.3 | 60 | 156 | 
| R: AGCACCGTGTTGGCGTAGAG | ||||
| TNF-α | F: ACGGTGTGAAGCTGGAAGACAAC | NM_173966.3 | 60 | 127 | 
| R:CTGATGGTGTGGGTGAGGAACAAG | ||||
| IL-1β | F: AACCGAGAAGTGGTGTTCTGCAT | NM_174093.1 | 60 | 159 | 
| R: GACTTTGGGGTCTACTTCCTCC | ||||
| IL-6 | F: ATGCTTCCAATCTGGGTTC | NM_173923.2 | 60 | 269 | 
| R: TGAGGATAATCTTTGCGTTC | ||||
| IL-8 | F: TTCCACACCTTTCCACCCCA | NM_173925.2 | 60 | 126 | 
| R: TCCTTGGGGTTTAGGCAGAC | 
| Primer Name | Primer Sequences (5′–3′) | 
|---|---|
| miR-155 | RT:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCCCT | 
| F:GCCGCTTAATGCTAATCGTG | |
| R:GTGCAGGGTCCGAGGT | |
| miR-92a | RT:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAGGC | 
| F:GCCGCTATTGCACTTGTCC | |
| R:GTGCAGGGTCCGAGGT | |
| miR-27a-3p | RT:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGGAAC | 
| F:GCCGCTTCACAGTGGCT | |
| R:GTGCAGGGTCCGAGGT | |
| miR-181a-R-1 | RT:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACTCAC | 
| F:GCCGCAACATTCAACGCTGT | |
| R:GTGCAGGGTCCGAGGT | |
| miR-let-7b | RT:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACCAC | 
| F:GCCGCTGAGGTAGTAGGTT | |
| R:GTGCAGGGTCCGAGGT | |
| miR-151-5p | RT:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACTAGA | 
| F:GCCGCTCGAGGAGCTCAC | |
| R:GTGCAGGGTCCGAGGT | |
| U6 | F:CTCGCTTCGGCAGCACA | 
| R:AACGCTTCACGAATTTGCGT | 
| Components | Volume | 
|---|---|
| Total RNA/miRNA | Up to 2 μg | 
| Seem-loop primer(2μM) | 1 μL | 
| 5*THERMO Reaction Mix | 4 μL | 
| gDNA remover | 1 μL | 
| RNase free H2O | To 20 μL | 
| Temperature (°C) | Time | Cycle | 
|---|---|---|
| 25 | 5 min | 1 | 
| 50 | 15 min | 1 | 
| 85 | 5 s | 1 | 
| miRNA | Gene ID | Symbol | Gene Annotation | 
|---|---|---|---|
| bta-miR-155 | 100313006 | USP43 | protein deubiquitination | 
| bta-miR-92a | 100313392 | FRYL | cell morphogenesis | 
| bta-miR-27a-3p | 790986 | PDP1 | cation binding | 
| bta-miR-181a_R-1 | 100313401 | AKAP7 | protein-containing complex | 
| bta-let-7b | 100170922 | PUDP | protein kinase activity | 
| bta-miR-151-5p | 790978 | TSHZ1 | regulation of gene expression | 
| miRNA ID | log2FoldChange | p-Value | Expression Level | 
|---|---|---|---|
| bta-miR-155 | 0.63 | 1.63 × 10−4 | Increased | 
| bta-miR-92a | 0.24 | 3.42 × 10−3 | Increased | 
| bta-miR-27a-3p | −0.31 | 3.79 × 10−3 | Decreased | 
| bta-miR-181a_R-1 | 0.17 | 4.73 × 10−3 | Increased | 
| bta-let-7b | 0.23 | 1.17 × 10−2 | Increased | 
| bta-miR-151-5p | 0.10 | 4.92 × 10−2 | Increased | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.; Zhang, Z.; Wang, X.; Lu, L.; Zhang, Z.; Zhang, G.; Min, J.; Shi, Q.; Lyu, S.; Chu, Q.; et al. In Vitro Analysis of LPS-Induced miRNA Differences in Bovine Endometrial Cells and Study of Related Pathways. Animals 2024, 14, 3367. https://doi.org/10.3390/ani14233367
Li X, Zhang Z, Wang X, Lu L, Zhang Z, Zhang G, Min J, Shi Q, Lyu S, Chu Q, et al. In Vitro Analysis of LPS-Induced miRNA Differences in Bovine Endometrial Cells and Study of Related Pathways. Animals. 2024; 14(23):3367. https://doi.org/10.3390/ani14233367
Chicago/Turabian StyleLi, Xinmiao, Zhihao Zhang, Xiangnan Wang, Ligang Lu, Zijing Zhang, Geyang Zhang, Jia Min, Qiaoting Shi, Shijie Lyu, Qiuxia Chu, and et al. 2024. "In Vitro Analysis of LPS-Induced miRNA Differences in Bovine Endometrial Cells and Study of Related Pathways" Animals 14, no. 23: 3367. https://doi.org/10.3390/ani14233367
APA StyleLi, X., Zhang, Z., Wang, X., Lu, L., Zhang, Z., Zhang, G., Min, J., Shi, Q., Lyu, S., Chu, Q., Qi, X., Li, H., Huang, Y., & Wang, E. (2024). In Vitro Analysis of LPS-Induced miRNA Differences in Bovine Endometrial Cells and Study of Related Pathways. Animals, 14(23), 3367. https://doi.org/10.3390/ani14233367
 
        

 
       