Assessing the Risk of Spreading Clostridioides difficile and Its Toxins Within the Dairy Farm
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. DNA Isolation
2.3. C. difficile Toxin Analysis
2.4. NGS Sequencing of a 16S RNA Gene Fragment
2.5. Statistical Data Processing
3. Results
3.1. Results of Assessing the Presence of Toxins Using PCR
3.2. Results of the Taxonomic Assessment of Microbial Communities
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Vedantam, G.; Clark, A.; Chu, M.; McQuade, R.; Mallozzi, M.; Viswanathan, V.K. Clostridium difficile infection: Toxins and non-toxin virulence factors, and their contributions to disease establishment and host response. Gut Microbes 2012, 3, 121–134. [Google Scholar] [CrossRef] [PubMed]
- Indra, A.; Lassnig, H.; Baliko, N.; Much, P.; Fiedler, A.; Huhulescu, S. Clostridium difficile: A new zoonotic agent? Wien. Klin. Wochenschr. 2009, 121, 91–95. [Google Scholar] [CrossRef] [PubMed]
- Noren, T.; Johansson, K.; Unemo, M. Clostridium difficile PCR-ribotype 046 is common among neonatal pigs and humans in Sweden. Clin. Microbiol. Infect. 2014, 20, O2–O6. [Google Scholar] [CrossRef] [PubMed]
- Galdys, A.L.; Curry, S.R.; Harrison, L.H. Asymptomatic Clostridium difficile colonization as a reservoir for Clostridium difficile infection. Expert Rev. Anti-Infect. Ther. 2014, 12, 967–980. [Google Scholar] [CrossRef]
- Rodriguez, C.; Hakimi, D.E.; Vanleyssem, R.; Taminiau, B.; Van Broeck, J.; Delmee, M.; Korsak, N.; Daube, G. Clostridium difficile in beef cattle farms, farmers and their environment: Assessing the spread of the bacterium. Vet. Microbiol. 2017, 210, 183–187. [Google Scholar] [CrossRef]
- Keel, K.; Brazier, J.S.; Post, K.W.; Weese, S.; Songer, J.G. Prevalence of PCR Ribotypes among Clostridium difficile Isolates from Pigs, Calves, and Other Species. J. Clin. Microbiol. 2007, 6, 1963–1964. [Google Scholar] [CrossRef]
- Rodriguez-Palacios, A.; Staempfli, H.R.; Duffield, T.; Weese, J.S. Clostridium difficile in Retail Ground Meat, Canada. Emerg. Infect. Dis. 2007, 3, 485–487. [Google Scholar] [CrossRef]
- Koene, M.; Mevius, D.; Wagenaar, J.; Harmanus, C.; Hensgens, M.; Meetsma, A.; Putirulan, F.; van Bergen, M.; Kuijper, E. Clostridium difficile in Dutch animals: Their presence, characteristics and similarities with human isolates. Clin. Microbiol. Infect. 2012, 18, 778–784. [Google Scholar] [CrossRef]
- Feltis, B.A.; Wiesner, S.M.; Kim, A.S.; Erlandsen, S.L.; Lyerly, D.L.; Wilkins, T.D.; Wells, C.L. Clostridium difficile toxins A and B can alter epithelial permeability and promote bacterial paracellular migration through HT-29 enterocytes. Shock 2000, 14, 629–634. [Google Scholar] [CrossRef]
- Riggs, M.M.; Sethi, A.K.; Zabarsky, T.F.; Eckstein, E.C.; Jump, R.L.P.; Donskey, C.J. Asymptomatic carriers are a potential source for transmission of epidemic and nonepidemic Clostridium difficile strains among long-term care facility residents. Clin. Infect. Dis. 2007, 45, 992–998. [Google Scholar] [CrossRef]
- Voth, D.; Ballard, J.D. Clostridium difficile Toxins: Mechanism of Action and Role in Disease. Clin. Microbiol. Rev. 2005, 2, 247–263. [Google Scholar] [CrossRef] [PubMed]
- Louie, T.J.; Miller, M.A.; Mullane, K.M.; Weiss, K.; Lentnek, A.; Golan, Y.; Gorbach, S.; Sears, P.; Shue, Y.-K. Fidaxomicin versus vancomycin for Clostridium difficile infection. N. Eng. J. Med. 2011, 364, 422–431. [Google Scholar] [CrossRef] [PubMed]
- Rupnik, M.; Janezic, S. An update on Clostridium difficile toxinotyping. J. Clin. Microbiol. 2016, 54, 13–18. [Google Scholar] [CrossRef] [PubMed]
- Gerding, D.N.; Johnson, S.; Rupnik, M.; Aktories, K. Clostridium difficile binary toxin CDT: Mechanism, epidemiology, and potential clinical importance. Gut Microbes 2014, 5, 15–27. [Google Scholar] [CrossRef] [PubMed]
- Hensgens, M.P.M.; Keessen, E.C.; Squire, M.M.; Riley, T.V.; Koene, M.G.J.; De Boer, E. Clostridium difficile infection in the community: A zoonotic disease? Clin. Microbiol. Infect. 2012, 18, 635–645. [Google Scholar] [CrossRef]
- Werner, A.; Mölling, P.; Fagerström, A.; Dyrkell, F.; Arnellos, D.; Johansson, K. Whole genome sequencing of Clostridioides difficile PCR ribotype 046 suggests transmission between pigs and humans. PLoS ONE 2020, 15, e0244227. [Google Scholar] [CrossRef]
- Knetsch, C.W.; Connor, T.R.; Mutreja, A.; van Dorp, S.M.; Sanders, I.M.; Browne, H.P. Whole genome sequencing reveals potential spread of Clostridium difficile between humans and farm animals in the Netherlands, 2002 to 2011. Eurosurveillance 2014, 19, 20954. [Google Scholar] [CrossRef]
- van Dorp, S.M.; Hensgens, M.P.M.; Dekkers, O.M.; Demeulemeester, A.; Buiting, A.; Bloembergen, P. Spatial clustering and livestock exposure as risk factor for community-acquired Clostridium difficile infection. Clin. Microbiol. Infect. 2019, 25, 607–612. [Google Scholar] [CrossRef]
- Bolton, D.; Marcos, P. The Environment, Farm Animals and Foods as Sources of Clostridioides difficile Infection in Humans. Foods 2023, 12, 1094. [Google Scholar] [CrossRef]
- Persson, S.; Jensen, J.N.; Olsen, K.E.P. Multiplex PCR Method for Detection of Clostridium difficile tcdA, tcdB, cdtA, and cdtB and Internal In-Frame Deletion of tcdC. J. Clin. Microbiol. 2011, 49, 4299–4300. [Google Scholar] [CrossRef]
- Heberle, H.; Meirelles, G.V.; da Silva, F.R.; Telles, G.P.; Minghim, R. InteractiVenn: A web-based tool for the analysis of sets through Venn diagrams. BMC Bioinform. 2015, 16, 169. [Google Scholar] [CrossRef] [PubMed]
- Guh, A.Y.; Mu, Y.; Winston, L.G.; Johnston, H.; Olson, D.; Farley, M.M.; Wilson, L.E.; Holzbauer, S.M.; Phipps, E.C.; Dumyati, G.K.; et al. Emerging Infections Program Clostridioides difficile Infection Working Group Trends in U.S. burden of Clostridioides difficile Infection and Outcomes. N. Engl. J. Med. 2020, 382, 1320–1330. [Google Scholar] [CrossRef] [PubMed]
- Lim, S.C.; Knight, D.R.; Riley, T.V. Clostridium difficile and one health. Clin. Microbiol. Infect. 2020, 26, 857–863. [Google Scholar] [CrossRef] [PubMed]
- Janvilisri, T.; Scaria, J.; Thompson, A.D.; Nicholson, A.; Limbago, B.M.; Arroyo, L.G.; Songer, J.G.; Gröhn, Y.T.; Chang, Y.F. Microarray identification of Clostridium difficile core components and divergent regions associated with host origin. J. Bacteriol. 2009, 191, 3881–3891. [Google Scholar] [CrossRef] [PubMed]
- Keessen, E.C.; Donswijk, C.J.; Hol, S.P.; Hermanus, C.; Kuijper, E.J.; Lipman, L.J. Aerial dissemination of Clostridium difficile on a pig farm and its environment. Environ. Res. 2011, 111, 1027–1032. [Google Scholar] [CrossRef]
- Janezic, S.; Zidaric, V.; Pardon, B. International Clostridium difficile animal strain collection and large diversity of animal associated strains. BMC Microbiol. 2014, 14, 173. [Google Scholar] [CrossRef]
- Varshney, J.B.; Very, K.J.; Williams, J.L.; Hegarty, J.P.; Stewart, D.B.; Lumadue, J.; Venkitanarayanan, K.; Jayarao, B.M. Characterization of Clostridium difficile isolates from human fecal samples and retail meat from Pennsylvania. Foodborne Pathog. Dis. 2014, 11, 822–829. [Google Scholar] [CrossRef]
- Hiergeist, A.; Ruelle, J.; Emler, S.; Gessner, A. Reliability of species detection in 16S microbiome analysis: Comparison of five widely used pipelines and recommendations for a more standardized approach. PLoS ONE 2023, 18, e0280870. [Google Scholar] [CrossRef]
- Bandelj, P.; Harmanus, C.; Blagus, R.; Cotman, M.; Kuijper, E.J.; Ocepek, M.; Vengust, M. Quantification of Clostridioides (Clostridium) difficile in feces of calves of different age and determination of predominant Clostridioides difficile ribotype 033 relatedness and transmission between family dairy farms using multilocus variable-number tandem-repeat analysis. BMC Vet. Res. 2018, 14, 298. [Google Scholar]
- Thitaram, S.N.; Frank, J.F.; Lyon, S.A.; Siragusa, G.R.; Bailey, J.S.; Lombard, J.E.; Haley, C.A.; Wagner, B.A.; Dargatz, D.A.; Fedorka-Cray, P.J. Clostridium difficile from healthy food animals: Optimized isolation and prevalence. J. Food Prot. 2011, 74, 130–133. [Google Scholar] [CrossRef]
- Rodriguez-Palacios, A.; Stämpfli, H.R.; Duffield, T.; Peregrine, A.S.; Trotz-Williams, L.A.; Arroyo, L.G.; Brazier, J.S.; Weese, J.S. Clostridium difficile PCR ribotypes in calves, Canada. Emerg. Infect. Dis. 2006, 12, 1730–1736. [Google Scholar] [CrossRef] [PubMed]
- Hegarty, R.S.; Goopy, J.P.; Herd, R.M.; McCorkell, B. Cattle selected for lower residual feed intake have reduced daily methane production. J. Anim. Sci. 2007, 85, 1479–1486. [Google Scholar] [PubMed]
- Patra, A.; Yu, Z. Effects of garlic oil, nitrate, saponin and their combinations supplemented to different substrates on in vitro fermentation, ruminal methanogenesis, and abundance and diversity of microbial populations. J. Appl. Microbiol. 2015, 119, 127–138. [Google Scholar] [PubMed]
- Lopes, J.C.; de Matos, L.F.; Harper, M.T.; Giallongo, F.; Oh, J.; Gruen, D.; Ono, S.; Kindermann, M.; Duval, S.; Hristov, A.N.; et al. Effect of 3-nitrooxypropanol on methane and hydrogen emissions, methane isotopic signature, and ruminal fermentation in dairy cows. J. Dairy Sci. 2016, 99, 5335–5344. [Google Scholar] [CrossRef] [PubMed]
- Johnson, K.A.; Johnson, D.E. Methane emissions from cattle. J. Anim. Sci. 1995, 73, 2483–2492. [Google Scholar]
- Smith, P.E.; Kelly, A.K.; Kenny, D.A.; Waters, S.M. Differences in the Composition of the Rumen Microbiota of Finishing Beef Cattle Divergently Ranked for Residual Methane Emissions. Front. Microbiol. 2022, 13, 855565. [Google Scholar]
- Lan, W.; Yang, C. Ruminal methane production: Associated microorganisms and the potential of applying hydrogen-utilizing bacteria for mitigation. Sci. Total Environ. 2019, 654, 1270–1283. [Google Scholar]
- Greening, C.; Geier, R.; Wang, C.; Woods, L.C.; Morales, S.E.; McDonald, M.J.; Rushton-Green, R.; Morgan, X.C.; Koike, S.; Leahy, S.C.; et al. Diverse hydrogen production and consumption pathways influence methane production in ruminants. ISME J. 2019, 13, 2617–2632. [Google Scholar]
- Vidor, C.; Awad, M.; Lyras, D. Antibiotic resistance, virulence factors and genetics of Clostridium sordellii. Res. Microbiol. 2015, 166, 368–374. [Google Scholar] [CrossRef]
- Orrell, K.E.; Melnyk, R.A. Large Clostridial toxins: Mechanisms and roles in disease. Microbiol. Mol. Biol. Rev. 2021, 85, e0006421. [Google Scholar]








| Cow | Name | Group | Calving Date |
|---|---|---|---|
| No. 10 | Soiuznitsa | Mastitis | 13 June 2022 |
| No. 64 | Laura | Mastitis | 27 July 2022 |
| No. 282 | Delfinka | Mastitis | 19 September 2022 |
| No. 314 | Ovatsiia | Metabolic disorders 1 (exhaustion, diarrhea) | 21 October 2022 |
| No. 238 | Tara | Metabolic disorders (emaciation) | 10 October 2022 |
| No. 1061 | Sultanka | Metabolic disorders (emaciation, joint damage) | 18 May 2022 |
| No. 324 | Alaska | Clinically healthy (control) | 15 January 2022 |
| No. 1106 | Obaiatelnaia | Normal (control) | 30 January 2022 |
| No. 117 | Lorena | Normal (control) | 2 February 2022 |
| Indicator | Unit | Silage No. 1 | Silage No. 2 |
|---|---|---|---|
| Feeding units | FU/kg | 0.25 | 0.21 |
| Lactic acid | % | 3.99 | 3.86 |
| Acetic acid | % | 0.58 | 0.57 |
| Butyric acid | % | 0.01 | 0.35 |
| Mass fraction of moisture | % | 63.2 ± 0.3 | 70.0 ± 0.5 |
| Mass fraction of dry matter | % | 36.8 ± 1.9 | 30 ± 1.8 |
| Mass fraction of crude protein | % | 3.06 ± 0.4 | 3.08 ± 0.4 |
| Mass fraction of crude fat | % | 0.99 ± 0.42 | 0.81 ± 0.1 |
| Mass fraction of crude ash | % | 2.2 ± 0.1 | 2.2 ± 0.1 |
| Mass fraction of crude fiber | % | 11.3 ± 1.5 | 8.8 ± 1.4 |
| Exchange energy | MJ/kg | 3.40 | 2.78 |
| Active acidity | pH units | 3.7 ± 0.1 | 3.7 ± 0.1 |
| Mass fraction of soluble carbohydrates | % | 1.1 ± 0.3 | 0.1 ± 0.01 |
| Primer | Sequences (5′–3′) | b.p. | Refference |
|---|---|---|---|
| tcdA | GCATGATAAGGCAACTTCAGTGGTA AGTTCCTCCTGCTCCATCAAATG | 629 | [20] |
| tcdB | CCAAARTGGAGTGTTACAAACAGGTG GCATTTCTCCATTCTCAGCAAAGTA | 410 | [20] |
| ctdB | TTGACCCAAAGTTGATGTCTGATTG CGGATCTCTTGCTTCAGTCTTTATAG | 262 | [20] |
| March | April | |||||
|---|---|---|---|---|---|---|
| cdtB | tcdA | tcdB | cdtB | tcdA | tcdB | |
| Mastitis | 1/3 * | 3/3 | 2/3 | 1/3 | 3/3 | 2/3 |
| Metabolic | 3/3 | 3/3 | 0/3 | 3/3 | 3/3 | 0/3 |
| Healthy | 1/3 | 0/3 | 0/3 | 1/3 | 0/3 | 0/3 |
| Silage | 1/1 | 1/1 | 0/1 | 0/1 | 0/1 | 0/1 |
| Manger | 1/1 | 1/1 | 0/1 | 0/1 | 0/1 | 0/1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Filippova, V.A.; Ilina, L.A.; Yildirim, E.A.; Ponomareva, E.S.; Kluchnikova, I.A.; Dubrovin, A.V.; Kalitkina, K.A.; Zaikin, V.A.; Laptev, G.Y. Assessing the Risk of Spreading Clostridioides difficile and Its Toxins Within the Dairy Farm. Animals 2024, 14, 3148. https://doi.org/10.3390/ani14213148
Filippova VA, Ilina LA, Yildirim EA, Ponomareva ES, Kluchnikova IA, Dubrovin AV, Kalitkina KA, Zaikin VA, Laptev GY. Assessing the Risk of Spreading Clostridioides difficile and Its Toxins Within the Dairy Farm. Animals. 2024; 14(21):3148. https://doi.org/10.3390/ani14213148
Chicago/Turabian StyleFilippova, Valentina A., Larisa A. Ilina, Elena A. Yildirim, Ekaterina S. Ponomareva, Irina A. Kluchnikova, Andrey V. Dubrovin, Ksenia A. Kalitkina, Vasiliy A. Zaikin, and Georgy Y. Laptev. 2024. "Assessing the Risk of Spreading Clostridioides difficile and Its Toxins Within the Dairy Farm" Animals 14, no. 21: 3148. https://doi.org/10.3390/ani14213148
APA StyleFilippova, V. A., Ilina, L. A., Yildirim, E. A., Ponomareva, E. S., Kluchnikova, I. A., Dubrovin, A. V., Kalitkina, K. A., Zaikin, V. A., & Laptev, G. Y. (2024). Assessing the Risk of Spreading Clostridioides difficile and Its Toxins Within the Dairy Farm. Animals, 14(21), 3148. https://doi.org/10.3390/ani14213148

