Prevalence and Molecular Characterization of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi in Cattle in Heilongjiang Province, Northeast China
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Areas and Sample Collection
2.2. Genomic DNA Extraction and PCR Amplifications
2.3. Sequencing and Phylogenetic Analysis
2.4. Statistical Analysis
3. Results
3.1. Prevalence of Cryptosporidium spp., G. duodenalis, and E. bieneusi in Cattle in Heilongjiang Province
3.2. Molecular Characterization and Phylogenetic Analysis of Three Protozoan Pathogens in Cattle in Heilongjiang Province
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jiang, Y.; Liu, L.; Yuan, Z.; Liu, A.; Cao, J.; Shen, Y. Molecular identification and genetic characteristics of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi in human immunodeficiency virus/acquired immunodeficiency syndrome patients in Shanghai, China. Parasites Vectors 2023, 16, 53. [Google Scholar] [CrossRef] [PubMed]
- Certad, G.; Gantois, N.; Merlin, S.; Martel, S.; Even, G.; Viscogliosi, E.; Audebert, C.; Chabé, M. Frequency and Molecular Identification of Cryptosporidium in Adult Prim’Holstein Dairy Cattle Farms in the North of France. Microorganisms. 2024, 12, 335. [Google Scholar] [CrossRef] [PubMed]
- Lux, L.; Ulrich, R.G.; Santos-Silva, S.; Queirós, J.; Imholt, C.; Klotz, C.; Paupério, J.; Pita, R.; Vale-Gonçalves, H.; Alves, P.C.; et al. Detection and Molecular Characterization of Giardia and Cryptosporidium spp. Circulating in Wild Small Mammals from Portugal. Animals 2023, 13, 515. [Google Scholar] [CrossRef] [PubMed]
- Fan, Y.; Wang, X.; Yang, R.; Zhao, W.; Li, N.; Guo, Y.; Xiao, L.; Feng, Y. Molecular characterization of the waterborne pathogens Cryptosporidium spp., Giardia duodenalis, Enterocytozoon bieneusi, Cyclospora cayetanensis and Eimeria spp. in wastewater and sewage in Guangzhou, China. Parasites Vectors 2021, 14, 66. [Google Scholar] [CrossRef] [PubMed]
- Ryan, U.M.; Feng, Y.; Fayer, R.; Xiao, L. Taxonomy and molecular epidemiology of Cryptosporidium and Giardia—A 50 year perspective (1971–2021). Int. J. Parasitol. 2021, 51, 1099–1119. [Google Scholar] [CrossRef] [PubMed]
- Gong, C.; Cao, X.F.; Deng, L.; Li, W.; Huang, X.M.; Lan, J.C.; Xiao, Q.C.; Zhong, Z.J.; Feng, F.; Zhang, Y.; et al. Epidemiology of Cryptosporidium infection in cattle in China: A review. Parasite 2017, 24, 1. [Google Scholar] [CrossRef]
- Liang, Y.; Liu, Y.Y.; Mei, J.J.; Zheng, W.B.; Liu, Q.; Gao, W.W.; Zhu, X.Q.; Xie, S.C. Molecular Identification and Genotyping of Cryptosporidium spp. and Blastocystis sp. in Cattle in Representative Areas of Shanxi Province, North China. Animals 2023, 13, 2929. [Google Scholar] [CrossRef] [PubMed]
- Ryan, U.; Zahedi, A.; Feng, Y.; Xiao, L. An Update on Zoonotic Cryptosporidium Species and Genotypes in Humans. Animals 2021, 11, 3307. [Google Scholar] [CrossRef] [PubMed]
- Adam, R.D. Giardia duodenalis: Biology and Pathogenesis. Clin. Microbiol. Rev. 2021, 34, e0002419. [Google Scholar] [CrossRef]
- Heyworth, M.F. Giardia duodenalis genetic assemblages and hosts. Parasite 2016, 23, 13. [Google Scholar] [CrossRef]
- Kuthyar, S.; Kowalewski, M.M.; Seabolt, M.; Roellig, D.M.; Gillespie, T.R. Molecular characterization of Giardia duodenalis and evidence for cross-species transmission in Northern Argentina. Transbound. Emerg. Dis. 2022, 69, 2209–2218. [Google Scholar] [CrossRef]
- Liang, X.X.; Zou, Y.; Li, T.S.; Chen, H.; Wang, S.S.; Cao, F.Q.; Yang, J.F.; Sun, X.L.; Zhu, X.Q.; Zou, F.C. First report of the prevalence and genetic characterization of Giardia duodenalis and Cryptosporidium spp. in Yunling cattle in Yunnan Province, southwestern China. Microb. Pathog. 2021, 158, 105025. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Feng, Y.; Santin, M. Host Specificity of Enterocytozoon bieneusi and Public Health Implications. Trends Parasitol. 2019, 35, 436–451. [Google Scholar] [CrossRef]
- Zhang, Y.; Koehler, A.V.; Wang, T.; Haydon, S.R.; Gasser, R.B. Enterocytozoon bieneusi Genotypes in Cattle on Farms Located within a Water Catchment Area. J. Eukaryot. Microbiol. 2019, 66, 553–559. [Google Scholar] [CrossRef]
- Li, W.; Xiao, L. Ecological and public health significance of Enterocytozoon bieneusi. One Health 2020, 12, 100209. [Google Scholar] [CrossRef]
- Elmahallawy, E.K.; Köster, P.C.; Dashti, A.; Alghamdi, S.Q.; Saleh, A.; Gareh, A.; Alrashdi, B.M.; Hernández-Castro, C.; Bailo, B.; Lokman, M.S.; et al. Molecular detection and characterization of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi infections in dromedary camels (Camelus dromedaries) in Egypt. Front. Vet. Sci. 2023, 10, 1139388. [Google Scholar] [CrossRef]
- An, D.; Jiang, T.; Zhang, C.; Ma, L.; Jia, T.; Pei, Y.; Zhu, Z.; Liu, Q.; Liu, J. Epidemiology and Molecular Characterization of Zoonotic Gastrointestinal Protozoal Infection in Zoo Animals in China. Animals 2024, 14, 853. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Wang, J.; Huang, S.; Song, J.; Fan, Y.; Zhao, G. Molecular Characterization of Cryptosporidium spp., Giardia duodenalis, Enterocytozoon bieneusi and Escherichia coli in Dairy Goat Kids with Diarrhea in Partial Regions of Shaanxi Province, China. Animals 2023, 13, 2922. [Google Scholar] [CrossRef] [PubMed]
- Liu, A.; Wang, R.; Li, Y.; Zhang, L.; Shu, J.; Zhang, W.; Feng, Y.; Xiao, L.; Ling, H. Prevalence and distribution of Cryptosporidium spp. in dairy cattle in Heilongjiang Province, China. Parasitol. Res. 2009, 105, 797–802. [Google Scholar] [CrossRef]
- Zhang, W.; Wang, R.; Yang, F.; Zhang, L.; Cao, J.; Zhang, X.; Ling, H.; Liu, A.; Shen, Y. Distribution and genetic characterizations of Cryptosporidium spp. in pre-weaned dairy calves in Northeastern China’s Heilongjiang Province. PLoS ONE 2013, 8, e54857. [Google Scholar] [CrossRef]
- Zhao, W.; Wang, R.; Zhang, W.; Liu, A.; Cao, J.; Shen, Y.; Yang, F.; Zhang, L. MLST subtypes and population genetic structure of Cryptosporidium andersoni from dairy cattle and beef cattle in northeastern China’s Heilongjiang Province. PLoS ONE 2014, 9, e102006. [Google Scholar] [CrossRef] [PubMed]
- Zhao, W.; Zhang, W.; Yang, F.; Zhang, L.; Wang, R.; Cao, J.; Shen, Y.; Liu, A. Enterocytozoon bieneusi in Dairy Cattle in the Northeast of China: Genetic Diversity of ITS Gene and Evaluation of Zoonotic Transmission Potential. J. Eukaryot. Microbiol. 2015, 62, 553–560. [Google Scholar] [CrossRef] [PubMed]
- Liu, A.; Zhang, X.; Zhang, L.; Wang, R.; Li, X.; Shu, J.; Zhang, X.; Shen, Y.; Zhang, W.; Ling, H. Occurrence of bovine giardiasis and endemic genetic characterization of Giardia duodenalis isolates in Heilongjiang Province, in the Northeast of China. Parasitol. Res. 2012, 111, 655–661. [Google Scholar] [CrossRef] [PubMed]
- Xiao, L.; Escalante, L.; Yang, C.; Sulaiman, I.; Escalante, A.A.; Montali, R.J.; Fayer, R.; Lal, A.A. Phylogenetic analysis of Cryptosporidium parasites based on the small-subunit rRNA gene locus. Appl. Environ. Microbiol. 1999, 65, 1578–1583. [Google Scholar] [CrossRef] [PubMed]
- Lalle, M.; Pozio, E.; Capelli, G.; Bruschi, F.; Crotti, D.; Cacciò, S.M. Genetic heterogeneity at the beta-giardin locus among human and animal isolates of Giardia duodenalis and identification of potentially zoonotic subgenotypes. Int. J. Parasitol. 2005, 35, 207–213. [Google Scholar] [CrossRef] [PubMed]
- Sulaiman, I.M.; Fayer, R.; Lal, A.A.; Trout, J.M.; Schaefer, F.W.; Xiao, L. Molecular characterization of microsporidia indicates that wild mammals Harbor host-adapted Enterocytozoon spp. as well as human-pathogenic Enterocytozoon bieneusi. Appl. Environ. Microbiol. 2003, 69, 4495–4501. [Google Scholar] [CrossRef] [PubMed]
- Burland, T.G. DNASTAR’s Lasergene sequence analysis software. Methods Mol. Biol. 2000, 132, 71–91. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Ghebremichael, S.T.; Meng, X.; Yang, Y.; Andegiorgish, A.K.; Wu, Z.; Chen, J.; Wei, J.; Li, T.; Bao, J.; Zhou, Z.; et al. First identification and coinfection detection of Enterocytozoon bieneusi, Encephalitozoon spp., Cryptosporidium spp. and Giardia duodenalis in diarrheic pigs in Southwest China. BMC Microbiol. 2023, 23, 334. [Google Scholar] [CrossRef]
- Gu, Y.; Wang, X.; Zhou, C.; Li, P.; Xu, Q.; Zhao, C.; Xu, W. Investigation on Cryptosporium infectons in wild animals in a zoo in Anhui Province. J. Zoo. Wildl. Med. 2016, 47, 846–854. [Google Scholar] [CrossRef]
- Huang, J.; Yue, D.; Qi, M.; Wang, R.; Zhao, J.; Li, J.; Shi, K.; Wang, M.; Zhang, L. Prevalence and molecular characterization of Cryptosporidium spp. and Giardia duodenalis in dairy cattle in Ningxia, northwestern China. BMC Vet. Res. 2014, 10, 292. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Tang, L.; Li, W.; Li, C.; Gu, Y. Prevalence and molecular characterization of Cryptosporidium spp. and Enterocytozoon bieneusi from large-scale cattle farms in Anhui Province, China. J. Vet. Med. Sci. 2022, 84, 40–47. [Google Scholar] [CrossRef] [PubMed]
- Qi, M.; Wang, R.; Jing, B.; Jian, F.; Ning, C.; Zhang, L. Prevalence and multilocus genotyping of Cryptosporidium andersoni in dairy cattle and He cattle in Xinjiang, China. Infect. Genet. Evol. 2016, 44, 313–317. [Google Scholar] [CrossRef] [PubMed]
- Liang, N.; Wu, Y.; Sun, M.; Chang, Y.; Lin, X.; Yu, L.; Hu, S.; Zhang, X.; Zheng, S.; Cui, Z.; et al. Molecular epidemiology of Cryptosporidium spp. in dairy cattle in Guangdong Province, South China. Parasitology 2019, 146, 28–32. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.X.; Tan, Q.D.; Zhou, D.H.; Ni, X.T.; Liu, G.X.; Yang, Y.C.; Zhu, X.Q. Prevalence and molecular characterization of Cryptosporidium spp. in dairy cattle, northwest China. Parasitol. Res. 2015, 114, 2781–2787. [Google Scholar] [CrossRef] [PubMed]
- Zhong, Z.; Dan, J.; Yan, G.; Tu, R.; Tian, Y.; Cao, S.; Shen, L.; Deng, J.; Yu, S.; Geng, Y.; et al. Occurrence and genotyping of Giardia duodenalis and Cryptosporidium in pre-weaned dairy calves in central Sichuan province, China. Parasite 2018, 25, 45. [Google Scholar] [CrossRef] [PubMed]
- Meng, Y.W.; Shu, F.F.; Pu, L.H.; Zou, Y.; Yang, J.F.; Zou, F.C.; Zhu, X.Q.; Li, Z.; He, J.J. Occurrence and Molecular Characterization of Cryptosporidium spp. in Dairy Cattle and Dairy Buffalo in Yunnan Province, Southwest China. Animals 2022, 12, 1031. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Zou, Y.; Wang, P.; Qu, M.R.; Zheng, W.B.; Wang, P.; Chen, X.Q.; Zhu, X.Q. Prevalence and multilocus genotyping of Cryptosporidium spp. in cattle in Jiangxi Province, southeastern China. Parasitol. Res. 2021, 120, 1281–1289. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.H.; Lee, J.Y.; Liu, S.S.; Chen, C.C.; Hsu, H.Y. Cryptosporidium parvum infection and management-based risk factors of dairy calves in Taiwan. J. Vet. Med. Sci. 2021, 83, 1838–1844. [Google Scholar] [CrossRef]
- Zhao, L.; Chai, H.L.; Wang, M.Y.; Zhang, Z.S.; Han, W.X.; Yang, B.; Wang, Y.; Zhang, S.; Zhao, W.H.; Ma, Y.M.; et al. Prevalence and molecular characterization of Cryptosporidium spp. in dairy cattle in Central Inner Mongolia, Northern China. BMC Vet. Res. 2023, 19, 134. [Google Scholar] [CrossRef]
- Wu, Y.; Chen, Y.; Chang, Y.; Zhang, X.; Li, D.; Wang, L.; Zheng, S.; Wang, R.; Zhang, S.; Li, J.; et al. Genotyping and identification of Cryptosporidium spp., Giardia duodenalis and Enterocytozoon bieneusi from free-range Tibetan yellow cattle and cattle-yak in Tibet, China. Acta Trop. 2020, 212, 105671. [Google Scholar] [CrossRef] [PubMed]
- Díaz, P.; Navarro, E.; Remesar, S.; García-Dios, D.; Martínez-Calabuig, N.; Prieto, A.; López-Lorenzo, G.; López, C.M.; Panadero, R.; Fernández, G.; et al. The Age-Related Cryptosporidium Species Distribution in Asymptomatic Cattle from North-Western SPAIN. Animals 2021, 11, 256. [Google Scholar] [CrossRef] [PubMed]
- Feltus, D.C.; Giddings, C.W.; Khaitsa, M.L.; McEvoy, J.M. High prevalence of Cryptosporidium bovis and the deer-like genotype in calves compared to mature cows in beef cow-calf operations. Vet. Parasitol. 2008, 151, 191–195. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, S.T.; Fukuda, Y.; Tada, C.; Sato, R.; Duong, B.; Nguyen, D.T.; Nakai, Y. Molecular characterization of Cryptosporidium in native beef calves in central Vietnam. Parasitol. Res. 2012, 111, 1817–1820. [Google Scholar] [CrossRef] [PubMed]
- Ryan, U.; Zahedi, A.; Paparini, A. Cryptosporidium in humans and animals-a one health approach to prophylaxis. Parasite Immunol. 2016, 38, 535–547. [Google Scholar] [CrossRef] [PubMed]
- Xiao, L.; Fayer, R. Molecular characterization of species and genotypes of Cryptosporidium and Giardia and assessment of zoonotic transmission. Int. J. Parasitol. 2008, 38, 1239–1255. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Ma, G.; Zhao, J.; Lu, Q.; Wang, H.; Zhang, L.; Jian, F.; Ning, C.; Xiao, L. Cryptosporidium andersoni is the predominant species in post-weaned and adult dairy cattle in China. Parasitol. Int. 2011, 60, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Kváč, M.; Vlnatá, G.; Ježková, J.; Horčičková, M.; Konečný, R.; Hlásková, L.; McEvoy, J.; Sak, B. Cryptosporidium occultus sp. n. (Apicomplexa: Cryptosporidiidae) in rats. Eur. J. Protistol. 2018, 63, 96–104. [Google Scholar] [CrossRef] [PubMed]
- Matas-Méndez, P.; Ávalos, G.; Caballero-Gómez, J.; Dashti, A.; Castro-Scholten, S.; Jiménez-Martín, D.; González-Barrio, D.; Muñoz-de-Mier, G.J.; Bailo, B.; Cano-Terriza, D.; et al. Detection and Molecular Diversity of Cryptosporidium spp. and Giardia duodenalis in the Endangered Iberian Lynx (Lynx pardinus), Spain. Animals 2024, 14, 340. [Google Scholar] [CrossRef]
- Cui, Z.; Wang, L.; Cao, L.; Sun, M.; Liang, N.; Wang, H.; Chang, Y.; Lin, X.; Yu, L.; Wang, R.; et al. Genetic characteristics and geographic segregation of Giardia duodenalis in dairy cattle from Guangdong Province, southern China. Infect. Genet. Evol. 2018, 66, 95–100. [Google Scholar] [CrossRef]
- Wang, Y.; Cao, J.; Chang, Y.; Yu, F.; Zhang, S.; Wang, R.; Zhang, L. Prevalence and molecular characterization of Cryptosporidium spp. and Giardia duodenalis in dairy cattle in Gansu, northwest China. Parasite 2020, 27, 62. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Zhao, G.; Chen, G.; Jian, F.; Zhang, S.; Feng, C.; Wang, R.; Zhu, J.; Dong, H.; Hua, J.; et al. Multilocus genotyping of Giardia duodenalis in dairy cattle in Henan, China. PLoS ONE 2014, 9, e100453. [Google Scholar] [CrossRef] [PubMed]
- Jian, Y.; Zhang, X.; Li, X.; Karanis, G.; Ma, L.; Karanis, P. Prevalence and molecular characterization of Giardia duodenalis in cattle and sheep from the Qinghai-Tibetan Plateau Area (QTPA), northwestern China. Vet. Parasitol. 2018, 250, 40–44. [Google Scholar] [CrossRef] [PubMed]
- Qi, M.; Wang, H.; Jing, B.; Wang, R.; Jian, F.; Ning, C.; Zhang, L. Prevalence and multilocus genotyping of Giardia duodenalis in dairy calves in Xinjiang, Northwestern China. Parasites Vectors 2016, 9, 546. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Li, N.; Jiang, W.; Guo, Y.; Wang, X.; Jin, Y.; Feng, Y.; Xiao, L. Infection patterns, clinical significance, and genetic characteristics of Enterocytozoon bieneusi and Giardia duodenalis in dairy cattle in Jiangsu, China. Parasitol. Res. 2019, 118, 3053–3060. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.T.; Wang, R.J.; Ren, G.J.; Yu, Z.Q.; Zhang, L.X.; Zhang, S.Y.; Lu, H.; Peng, X.Q.; Zhao, G.H. Multilocus genotyping of Giardia duodenalis and Enterocytozoon bieneusi in dairy and native beef (Qinchuan) calves in Shanxi province, northwestern China. Parasitol. Res. 2016, 115, 1355–1361. [Google Scholar] [CrossRef] [PubMed]
- Fan, Y.; Wang, T.; Koehler, A.V.; Hu, M.; Gasser, R.B. Molecular investigation of Cryptosporidium and Giardia in pre- and post-weaned calves in Hubei Province, China. Parasites Vectors 2017, 10, 519. [Google Scholar] [CrossRef] [PubMed]
- Heng, Z.J.; Yang, J.F.; Xie, X.Y.; Xu, C.R.; Chen, J.R.; Ma, J.; He, J.J.; Mao, H.M. Prevalence and multilocus genotyping of Giardia duodenalis in Holstein cattle in Yunnan, China. Front. Vet. Sci. 2022, 9, 949462. [Google Scholar] [CrossRef]
- Dan, J.; Zhang, X.; Ren, Z.; Wang, L.; Cao, S.; Shen, L.; Deng, J.; Zuo, Z.; Yu, S.; Wang, Y.; et al. Occurrence and multilocus genotyping of Giardia duodenalis from post-weaned dairy calves in Sichuan province, China. PLoS ONE 2019, 14, e0224627. [Google Scholar] [CrossRef]
- Fu, Y.; Dong, H.; Bian, X.; Qin, Z.; Han, H.; Lang, J.; Zhang, J.; Zhao, G.; Li, J.; Zhang, L. Molecular characterizations of Giardia duodenalis based on multilocus genotyping in sheep, goats, and beef cattle in Southwest Inner Mongolia, China. Parasite 2022, 29, 33. [Google Scholar] [CrossRef]
- Santín, M.; Trout, J.M.; Fayer, R. A longitudinal study of Giardia duodenalis genotypes in dairy cows from birth to 2 years of age. Vet. Parasitol. 2009, 162, 40–45. [Google Scholar] [CrossRef] [PubMed]
- Geurden, T.; Geldhof, P.; Levecke, B.; Martens, C.; Berkvens, D.; Casaert, S.; Vercruysse, J.; Claerebout, E. Mixed Giardia duodenalis assemblage A and E infections in calves. Int. J. Parasitol. 2008, 38, 259–264. [Google Scholar] [CrossRef] [PubMed]
- Bartley, P.M.; Roehe, B.K.; Thomson, S.; Shaw, H.J.; Peto, F.; Innes, E.A.; Katzer, F. Detection of potentially human infectious assemblages of Giardia duodenalis in fecal samples from beef and dairy cattle in Scotland. Parasitology 2019, 146, 1123–1130. [Google Scholar] [CrossRef] [PubMed]
- Chourabi, M.; Boughattas, S.; Abdallah, A.M.; Ismail, A.; Behnke, J.M.; Al-Mekhlafi, H.M.; Abu-Madi, M. Genetic Diversity and Prevalence of Giardia duodenalis in Qatar. Front. Cell. Infect. Microbiol. 2021, 11, 652946. [Google Scholar] [CrossRef] [PubMed]
- Meng, X.Z.; Kang, C.; Wei, J.; Ma, H.; Liu, G.; Zhao, J.P.; Zhang, H.S.; Yang, X.B.; Wang, X.Y.; Yang, L.H.; et al. Meta-Analysis of the Prevalence of Giardia duodenalis in Cattle in China. Foodborne Pathog. Dis. 2023, 20, 17–31. [Google Scholar] [CrossRef]
- Fantinatti, M.; Bello, A.R.; Fernandes, O.; Da-Cruz, A.M. Identification of Giardia lamblia assemblage E in humans points to a new anthropozoonotic cycle. J. Infect. Dis. 2016, 214, 1256–1259. [Google Scholar] [CrossRef] [PubMed]
- Zahedi, A.; Field, D.; Ryan, U. Molecular typing of Giardia duodenalis in humans in Queensland—First report of Assemblage E. Parasitology 2017, 144, 1154–1161. [Google Scholar] [CrossRef] [PubMed]
- Song, H.Y.; Wang, K.S.; Yang, J.F.; Mao, H.M.; Pu, L.H.; Zou, Y.; Ma, J.; Zhu, X.Q.; Zou, F.C.; He, J.J. Prevalence and Novel Genotypes Identification of Enterocytozoon bieneusi in Dairy Cattle in Yunnan Province, China. Animals 2021, 11, 3014. [Google Scholar] [CrossRef] [PubMed]
- Feng, Y.; Gong, X.; Zhu, K.; Li, N.; Yu, Z.; Guo, Y.; Weng, Y.; Kváč, M.; Feng, Y.; Xiao, L. Prevalence and genotypic identification of Cryptosporidium spp., Giardia duodenalis and Enterocytozoon bieneusi in pre-weaned dairy calves in Guangdong, China. Parasites Vectors 2019, 12, 41. [Google Scholar] [CrossRef]
- Qi, M.; Jing, B.; Jian, F.; Wang, R.; Zhang, S.; Wang, H.; Ning, C.; Zhang, L. Dominance of Enterocytozoon bieneusi genotype J in dairy calves in Xinjiang, Northwest China. Parasitol. Int. 2017, 66, 960–963. [Google Scholar] [CrossRef]
- Li, S.; Wang, P.; Zhu, X.Q.; Zou, Y.; Chen, X.Q. Prevalence and genotypes/subtypes of Enterocytozoon bieneusi and Blastocystis sp. in different breeds of cattle in Jiangxi Province, southeastern China. Infect. Genet. Evol. 2022, 98, 105216. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.Y.; Qin, R.L.; Mei, J.J.; Zou, Y.; Zhang, Z.H.; Zheng, W.B.; Liu, Q.; Zhu, X.Q.; Gao, W.W.; Xie, S.C. Molecular Detection and Genotyping of Enterocytozoon bieneusi in Beef Cattle in Shanxi Province, North China. Animals 2022, 12, 2961. [Google Scholar] [CrossRef] [PubMed]
- Hwang, S.; Shin, S.U.; Kim, S.; Ryu, J.H.; Choi, K.S. Zoonotic potential of Enterocytozoon bieneusi in pre-weaned Korean native calves. Parasites Vectors 2020, 3, 300. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.; Gong, B.; Liu, X.; Wu, Y.; Yang, F.; Xu, J.; Zhang, X.; Cao, J.; Liu, A. First identification and genotyping of Enterocytozoon bieneusi in humans in Myanmar. BMC Microbiol. 2020, 20, 10. [Google Scholar] [CrossRef]
- Imre, K.; Morar, A.; Ilie, M.S.; Plutzer, J.; Imre, M.; Emil, T.; Herbei, M.V.; Dărăbuș, G. Survey of the Occurrence and Human Infective Potential of Giardia duodenalis and Cryptosporidium spp. in Wastewater and Different Surface Water Sources of Western Romania. Vector Borne Zoonotic Dis. 2017, 17, 685–691. [Google Scholar] [CrossRef]
Species | Loci | Primer ID | Primer Sequences (5′-3′) | Fragment Length (bp) | Temperature Annealing (°C) | Reference |
---|---|---|---|---|---|---|
Cryptosporidium spp. | SSU rRNA gene | CS-F1 | TTCTAGAGCTAATACATGCG | 830 | 55 | [24] |
CS-R1 | CCCATTTCCTTCGAAACAGGA | |||||
CS-F2 | GGAAGGGTTGTATTTATTAGATAAAG | |||||
CS-R2 | CTCATAAGG TGCTGAAGGAGTA | |||||
Giardia duodenalis | bg gene | GD-F1 | GAGGCCGCCCTGGATCTTCGAGACGAC | 511 | 60 | [25] |
GD-R1 | GAACGAACGAGATCGAGGTCCG | |||||
GD-F2 | CTCGACGAGCTTCGTGTT | |||||
GD-R2 | TTCCGTRTYCAGTACAACTC | |||||
Enterocytozoon bieneusi | ITS gene | EB-F1 | GGTCATAGGGATGAAGAG | 392 | 57 | [26] |
EB-R1 | TTCGAGTTCTTTCGCGCTC | |||||
EB-F2 | GCTCTGAATATCTATGGCT | |||||
EB-R2 | ATCGCCGACGGATCCAAGTG |
Factor | Categories | No. Examined | No. of Positive | Prevalence% (95% CI) | OR (95% CI) | p-Value | Species (No.) |
---|---|---|---|---|---|---|---|
Region | Daqing | 201 | 24 | 11.9% (7.5–16.4) | 15.8 (2.1–118.2) | <0.001 | C. andersoni (1), C. bovis (14), C. parvum (1), C. ryanae (8) |
Daxinganling | 60 | 3 | 5.0 (0.0–10.50) | 6.15 (0.6–60.5) | C. andersoni (3) | ||
Harbin | 134 | 13 | 9.7 (4.7–14.7) | 12.6 (1.6–97.6) | C. andersoni (12), C. ryanae (1) | ||
Hegang | 79 | 6 | 7.6 (1.8–13.4) | 9.0 (1.1–73.0) | C. andersoni (6) | ||
Heihe | 118 | 1 | 0.9 (0.0–2.5) | 1 | C. bovis (1) | ||
Jixi | 64 | 3 | 4.7 (0.0–9.9) | 5.8 (0.6–56.5) | C. andersoni (3) | ||
Jiamusi | 35 | 0 | — | — | — | ||
Mudanjiang | 141 | 11 | 7.8 (3.4–12.2) | 9.9 (1.3–77.9) | C. andersoni (11) | ||
Qitaihe | 65 | 1 | 1.5 (0.0–4.5) | 1.8 (0.1–29.7) | C. occultus (1) | ||
Qiqihar | 49 | 0 | — | — | — | ||
Shuangyashan | 75 | 0 | — | — | — | ||
Suihua | 74 | 0 | — | — | — | ||
Yichun | 60 | 2 | 3.3 (0.0–7.9) | 4.0 (0.4–45.4) | C. andersoni (2) | ||
Type | Dairy cattle | 585 | 35 | 6.0 (4.1–7.9) | 1.2 (0.7–2.0) | 0.506 | C. andersoni (14), C. bovis (14), C. parvum (1), C. ryanae (6) |
Beef cattle | 570 | 29 | 5.1 (3.3–6.9) | 1 | C. andersoni (24), C. bovis (1), C. occultus (1), C. ryanae (3) | ||
Gender | Female | 722 | 33 | 4.6 (3.0–6.1) | 1 | 0.063 | C. andersoni (21), C. bovis (8), C. occultus (1), C. parvum (1), C. ryanae (2) |
Male | 433 | 31 | 7.2 (4.7–9.6) | 1.6 (1.0–2.7) | C. andersoni (17), C. bovis (7), C. ryanae (7) | ||
Age | <12 Months | 273 | 35 | 12.8 (8.9–16.8) | 5.0 (2.6–9.8) | <0.001 | C. andersoni (14), C. bovis (14), C. ryanae (7) |
12–18 Months | 421 | 12 | 2.9 (1.3–4.4) | 1 | C. andersoni (9), C. bovis (1), C. ryanae (2) | ||
>18 Months | 461 | 17 | 3.7 (2.0–5.4) | 1.3 (0.6–2.8) | C. andersoni (15), C. occultus (1), C. parvum (1) | ||
Total | 1155 | 64 | 5.5 (4.2–6.9) |
Factor | Categories | No. Examined | No. of Positive | Prevalence% (95% CI) | OR (95% CI) | p-Value | Assemblages (No.) |
---|---|---|---|---|---|---|---|
Region | Daqing | 201 | 6 | 3.0 (0.6–5.3) | 2.4 (0.3–20.3) | 0.003 | E (6) |
Daxinganling | 60 | 2 | 3.3 (0.0–7.9) | 2.7 (0.2–30.4) | E (2) | ||
Harbin | 134 | 8 | 6.0 (2.0–10.0) | 5.0 (0.6–40.4) | E (8) | ||
Hegang | 79 | 1 | 1.3 (0.0–3.7) | 1 | E (1) | ||
Heihe | 118 | 3 | 2.5 (0.0–5.4) | 2.0 (0.2–19.9) | E (3) | ||
Jixi | 64 | 0 | — | — | — | ||
Jiamusi | 35 | 0 | — | — | — | ||
Mudanjiang | 141 | 4 | 2.8 (0.1–5.6) | 2.3 (0.3–20.7) | E (4) | ||
Qitaihe | 65 | 7 | 10.8 (3.2–18.3) | 9.4 (1.1–78.6) | E (7) | ||
Qiqihar | 49 | 1 | 2.0 (0.0–6.0) | 1.6 (0.1–26.6) | A (1) | ||
Shuangyashan | 75 | 4 | 5.3 (0.2–10.4) | 4.4 (0.5–40.2) | E (4) | ||
Suihua | 74 | 8 | 10.8 (3.7–17.9) | 9.5 (1.2–77.6) | E (8) | ||
Yichun | 60 | 0 | — | — | — | ||
Type | Dairy cattle | 585 | 14 | 2.4 (1.2–3.6) | 1 | 0.011 | E (13), A (1) |
Beef cattle | 570 | 30 | 5.3 (3.4–7.1) | 2.3 (1.2–4.3) | E (30) | ||
Gender | Female | 722 | 25 | 3.5 (2.1–4.8) | 1 | 0.426 | E (24), A (1) |
Male | 433 | 19 | 4.4 (2.5–6.3) | 1.3 (0.7–2.4) | E (19) | ||
Age | <12 Months | 273 | 14 | 5.1 (2.5–7.7) | 1.6 (0.8–3.4) | 0.416 | E (14) |
12–18 Months | 421 | 15 | 3.6 (1.8–5.3) | 1.1 (0.5–2.3) | E (15) | ||
>18 Months | 461 | 15 | 3.3 (1.6–4.9) | 1 | E (14), A (1) | ||
Total | 1155 | 44 | 3.8 (2.7–4.9) |
Factor | Categories | No. Examined | No. of Positive | Prevalence% (95% CI) | OR (95% CI) | p-Value | Genotypes (No.) |
---|---|---|---|---|---|---|---|
Region | Daqing | 201 | 24 | 11.9 (7.5–16.4) | 9.4 (2.2–40.6) | <0.001 | BEB4 (7), BEB6 (1), CHS8 (1), COS-I (3), I (1), J (11) |
Daxinganling | 60 | 0 | — | — | — | ||
Harbin | 134 | 3 | 2.2 (0.0–4.7) | 1.6 (0.3–9.7) | I (1), J (2) | ||
Hegang | 79 | 4 | 5.1 (0.2–9.9) | 3.7 (0.7–20.7) | I (3), J (1) | ||
Heihe | 118 | 6 | 5.1 (1.1–9.0) | 3.7 (0.7–18.8) | BEB6 (2), CHS8 (1),COS-I (3) | ||
Jixi | 64 | 6 | 9.4 (2.2–16.5) | 7.2 (1.4–36.7) | I (2), J (4) | ||
Jiamusi | 35 | 0 | — | — | — | ||
Mudanjiang | 141 | 2 | 1.4 (0.0–3.4) | 1 | CHS7 (2) | ||
Qitaihe | 65 | 11 | 16.9 (7.8–26.0) | 14.2 (3.0–66.0) | BEB6 (1), BEB4 (1), BEB8 (1), J (8) | ||
Qiqihar | 49 | 0 | — | — | — | ||
Shuangyashan | 75 | 7 | 9.3 (2.7–15.9) | 7.2 (1.4–35.4) | J (4), I (2), BEB4 (1) | ||
Suihua | 74 | 3 | 4.1 (0.0–8.5) | 2.9 (0.5–18.0) | COS-I (2), BEB6 (1) | ||
Yichun | 60 | 9 | 15.0 (6.0–24.0) | 8.2 (1.7–39.0) | BEB4 (4), J (3), I (2) | ||
Type | Dairy cattle | 585 | 32 | 5.5 (3.6–7.3) | 1 | 0.153 | BEB4 (5), BEB6 (3), J (14), CHS7 (1), CHS8 (2), COS-I (6), I (1) |
Beef cattle | 570 | 43 | 7.5 (5.4–9.7) | 1.4 (0.9–2.3) | BEB4 (8), BEB6 (2), BEB8 (1), J (19), CHS7 (1), COS-I (2), I (10) | ||
Gender | Female | 722 | 44 | 6.1 (4.3–7.8) | 1 | 0.477 | BEB4 (7), BEB6 (3), BEB8 (1), J (15), CHS7 (1), CHS8 (2), COS-I (5), I (10) |
Male | 433 | 31 | 7.2 (4.7–9.6) | 1.2 (0.7–1.9) | BEB4 (6), BEB6 (2), J (18), CHS7 (1), COS-I (3), I (1) | ||
Age | <12 Months | 273 | 26 | 9.5 (6.0–13.0) | 2.2 (1.2–4.1) | 0.033 | BEB4 (6), BEB6 (1), J (13), COS-I (3), I (3) |
12–18 Months | 421 | 19 | 4.5 (2.5–6.5) | 1 | BEB4 (3), BEB6 (2), J (9), CHS7 (2), COS-I (1), I (2) | ||
>18 Months | 461 | 30 | 6.5 (4.3–8.8) | 1.5 (0.8–2.7) | BEB4 (4), BEB6 (2), BEB8 (1), J (11), CHS8 (2), COS-I (4), I (6) | ||
Total | 1155 | 75 | 6.5 (5.1–7.9) |
Region | Type | Gender | Age | ||||
---|---|---|---|---|---|---|---|
Dairy Cattle | Beef Cattle | Female | Male | <12 Months | 12–18 Months | >18 Months | |
Daqing | C. ryanae + E (2), C. bovis + J (2), C. ryanae + BEB4 (1) | C. ryanae + BEB4 (2) | C. ryanae + E (1), C. bovis + J (1) | C. ryanae + E (1), C. ryanae + BEB4 (3), C. bovis + J (1) | C. ryanae + E (2), C. ryanae + BEB4 (3), C. bovis + J (2) | — | — |
Harbin | — | C. andersoni + E (2), C. andersoni + J (1), C. andersoni + I (1) | C. andersoni + E (2), C. andersoni + J (1), C. andersoni + I (1) | — | C. andersoni + E (1), C. andersoni + I (1) | — | C. andersoni + E (1), C. andersoni + J (1) |
Qitaihe | — | C. occultus + BEB4 (1), E + J (1) | C. occultus + BEB4 (1) | E + J (1) | — | E + J (1) | C. occultus + BEB4 (1) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gao, J.-F.; Zhou, L.; Zhang, A.-H.; Hou, M.-R.; Liu, X.-W.; Zhang, X.-H.; Wang, J.-W.; Wang, X.; Bai, X.; Jiao, C.-L.; et al. Prevalence and Molecular Characterization of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi in Cattle in Heilongjiang Province, Northeast China. Animals 2024, 14, 1635. https://doi.org/10.3390/ani14111635
Gao J-F, Zhou L, Zhang A-H, Hou M-R, Liu X-W, Zhang X-H, Wang J-W, Wang X, Bai X, Jiao C-L, et al. Prevalence and Molecular Characterization of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi in Cattle in Heilongjiang Province, Northeast China. Animals. 2024; 14(11):1635. https://doi.org/10.3390/ani14111635
Chicago/Turabian StyleGao, Jun-Feng, Lu Zhou, Ai-Hui Zhang, Mei-Ru Hou, Xue-Wei Liu, Xin-Hui Zhang, Jia-Wen Wang, Xue Wang, Xue Bai, Chen-Long Jiao, and et al. 2024. "Prevalence and Molecular Characterization of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi in Cattle in Heilongjiang Province, Northeast China" Animals 14, no. 11: 1635. https://doi.org/10.3390/ani14111635
APA StyleGao, J.-F., Zhou, L., Zhang, A.-H., Hou, M.-R., Liu, X.-W., Zhang, X.-H., Wang, J.-W., Wang, X., Bai, X., Jiao, C.-L., Yang, Y., Lan, Z., Qiu, H.-Y., & Wang, C.-R. (2024). Prevalence and Molecular Characterization of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi in Cattle in Heilongjiang Province, Northeast China. Animals, 14(11), 1635. https://doi.org/10.3390/ani14111635