Next Article in Journal
A Pretty Kettle of Fish: A Review on the Current Challenges in Mediterranean Teleost Reproduction
Next Article in Special Issue
The Role of Hunters in Wildlife Health Research and Monitoring: Their Contribution as Citizen Scientists in Italy
Previous Article in Journal
A Meta-Analysis of the Effects of Dietary Yeast Mannan-Rich Fraction on Broiler Performance and the Implication for Greenhouse Gas Emissions from Chicken Production
Previous Article in Special Issue
Genetic Diversity of Avian Influenza Viruses Detected in Waterbirds in Northeast Italy Using Two Different Sampling Strategies
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Exposure of Urban European Hedgehogs (Erinaceus europaeus) to Toxoplasma gondii in Highly Populated Areas of Northeast Spain

by
Alejandra Escudero
1,
Maria Puig Ribas
2,
Elena Obón
3,
Sonia Almería
4,
Xavier Fernández Aguilar
2,5,
Hojjat Gholipour
2,6,
Oscar Cabezón
2,5,* and
Rafael Molina-López
3
1
Anatomía Patológica, Departamento de Producción y Sanidad Animal, Facultad de Veterinaria, Universidad Cardenal Herrera-CEU, 46115 Alfara del Patriarca, Valencian Community, Spain
2
Wildlife Conservation Medicine Research Group (WildCoM), Departament de Medicina i Cirurgia Animals, Universitat Autònoma de Barcelona, 08193 Bellaterra, Catalonia, Spain
3
Centre de Fauna Salvatge de Torreferrussa, Forestal Catalana, S.A., Generalitat de Catalunya, 08130 Santa Perpètua de la Mogoda, Catalonia, Spain
4
Center for Food Safety and Nutrition (CFSAN), Department of Health and Human Services, Food and Drug Administration, Office of Applied Research and Safety Assessment (OARSA), Division of Virulence Assessment, Laurel, MD 20708, USA
5
Unitat Mixta d’Investigació IRTA-UAB, Centre de Recerca en Sanitat Animal (CReSA), Campus de la Universitat Autònoma de Barcelona (UAB), 08193 Bellaterra, Catalonia, Spain
6
Department of Clinical Sciences, Faculty of Veterinary Medicine, Shahid Bahonar University of Kerman, Kerman 76179-14111, Iran
*
Author to whom correspondence should be addressed.
Animals 2024, 14(11), 1596; https://doi.org/10.3390/ani14111596
Submission received: 10 April 2024 / Revised: 12 May 2024 / Accepted: 21 May 2024 / Published: 28 May 2024
(This article belongs to the Special Issue Interdisciplinary Perspectives on Wildlife Disease Ecology)

Abstract

:

Simple Summary

Toxoplasma gondii is a generalist zoonotic parasite that involves warm-blooded animals as intermediate hosts and felines as definitive hosts. Recent studies have shown significant positive associations between human population density and T. gondii seroprevalence in wildlife. However, there is a lack of data regarding the exposure of T. gondii in urban wildlife. The present study aimed to analyse the T. gondii exposure of urban hedgehogs from the Metropolitan Area of Barcelona, NE Spain. Our results reported a high seroprevalence of urban hedgehogs to the parasite, reinforcing the association between human population density and environmental T. gondii oocysts. Urban hedgehogs could be good candidates for sentinels of the presence of T. gondii oocysts in anthropised areas. In addition, the role of vertical transmission of T. gondii in hedgehogs, as well as the impact of T. gondii on the health of urban wildlife species, needs further research.

Abstract

Toxoplasma gondii is a generalist zoonotic parasite that involves a wide range of warm-blooded animals as intermediate hosts and felines as definitive hosts. Recent studies have proved significant positive associations between human population density and T. gondii seroprevalence in wildlife. However, there is limited data regarding T. gondii wildlife in urban areas, where the highest human density occurs. The present study aimed to analyse the T. gondii exposure in urban hedgehogs from the Metropolitan Area of Barcelona, NE Spain. One hundred eighteen hedgehogs were analysed for the presence of antibodies (modified agglutination test; n = 55) and parasite DNA (qPCR; heart = 34; brain = 60). Antibodies were detected in 69.09% of hedgehogs. T. gondii DNA was not detected in any of the analysed samples. The present study reports a high T. gondii seroprevalence in urban hedgehogs in areas surrounding Barcelona, the most densely human-populated area of NE Spain, reinforcing the association between human population density and environmental T. gondii oocysts. The lack of detection by molecular techniques warrants more studies. In the last few decades, the distribution and abundance of European hedgehogs have declined, including their urban populations. Further research is needed to investigate the impact of T. gondii on hedgehog populations.

1. Introduction

Toxoplasma gondii is a generalist zoonotic parasite with a complex life cycle that involves warm-blooded animals as intermediate hosts. Domestic and wild felid species play a critical role in the ecology and epidemiology of T. gondii because they are the definitive hosts, excreting oocysts in their faeces. Toxoplasmosis has been reported worldwide, causing mild disease in humans, domestic animals, and wildlife; however, it can be fatal in young, immunocompromised, pregnant, or congenitally infected individuals [1]. The epidemiology of T. gondii is influenced by several factors such as parasite genotype, wild/domestic feline population characteristics, hosts’ interactions, environment, or anthropogenic factors including land use, environmental degradation, and climate change [1].
The transmission of zoonotic infectious agents is widely related to the interactions between wild and domestic animals and humans. In this sense, urban areas are potential high-risk spots for pathogen transmission [2,3,4,5]. In urban areas, feral cat populations reach high densities, increasing the probability of T. gondii transmission between hosts [5]. From this perspective, recent studies have shown significant positive associations between human population density and T. gondii oocysts shedding in domestic and wild felids [5] and seroprevalence in wild mammals [4,6,7]. Therefore, urbanisation may create ideal environmental conditions for the ecology of this parasite [5,8,9].
Although T. gondii has been extensively described in wild fauna from Spain [10,11,12,13,14,15] and also in the definitive host in urban areas of Barcelona [16], little data have been reported from urban wildlife. Hence, the analysis of the exposure of urban wildlife to T. gondii is important to increase the knowledge of its epidemiology in anthropised areas. The European hedgehog (Erinaceus europaeus) is an omnivorous nocturnal animal distributed throughout the Mediterranean basin, including urban areas [17]. They typically live in anthropogenic areas and are susceptible to infection by T. gondii [18]. Due to its adaptability to anthropised habitats, this species could be considered a suitable sentinel for the environmental presence of zoonoses in urban areas. The aim of the present study was to analyse the prevalence of T. gondii infection in free-ranging European hedgehogs from urban ecosystems in the most densely human-populated area of NE Spain.

2. Materials and Methods

2.1. Animals and Samples

One hundred eighteen diseased European hedgehogs euthanised for welfare reasons at the Wildlife Rehabilitation Centre (WRC) of Torreferrussa in Barcelona (Forestal Catalana, Catalonia Government, license number B2300083), Catalonia (NE Spain) were analysed. The animals studied were collected within the Metropolitan Area of Barcelona (MAB), the most densely human-populated area of NE Spain [19] (Figure 1). Animals were classified as sub-adults (<1 year old) and adults (life expectancy is 3 years (0–10 years) [17]). The sex of the animals was recorded. Sera, heart, and brain were analysed, taking advantage of the biological samples archive of the WRC of Torreferrussa: 55 animals (sera), 29 animals (brain); 31 animals (brain + heart), 3 animals (heart).

2.2. Laboratorial Analyses

Sera were examined by the modified agglutination test (MAT) to detect antibodies against T. gondii as previously described [20]. Each serum sample was tested at dilutions of 1:25, 1:50, and 1:500. Previously, IgM antibodies from sera were neutralised using 2-mercaptoethanol. Titres of 1:25 or higher were considered positive. DNA was extracted from the brain (0.2 g) and heart (0.2 g) tissues using the commercial kit NucleoSpin Tissue (Macherey-Nagel, Düren, Germany) according to the manufacturer’s procedure. Extracted DNA was amplified using a real-time PCR (rtPCR) with Toxo-SE (5′ AGGCGAGGGTGAGGATGA 3′) and Toxo-AS (5′ TCGTCTCGTCTGGATCGCAT 3′) primers, and the probe (5′ 6FAM-CGACGAGAGTCGGAGAGGGAGAAGATGT-BHQ1 3′), using a commercial kit (TaqMan PCR Master Mix; Applied Biosystems, Carlsbad, CA, USA) [21]. Primers Toxo-SE and Toxo-SA target the 529 bp repeat region (REP529, GenBank accession no. AF146527) of T. gondii. The qPCR method used can detect T. gondii DNA extracted from a single cyst DNA [21,22]. DNA was extracted from T. gondii oocysts (purchased at Grupo SALUVET, Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad Complutense de Madrid, Spain) and used as DNA positive control. Each qPCR run included a negative control, containing 500 µL of PBS. The cycling protocol was as follows: 50 °C for 2 min (activation of the uracil-N-glycosylase) and denaturation at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 61 °C for 1 min.

2.3. Statistical Analyses

Differences in T. gondii seroprevalence between age groups (subadults and adults) and sex (males and females) were assessed using Pearson’s chi-squared test, with statistical significance determined at p < 0.05. Seroprevalence was estimated using the 95% Wilson confidence interval. All statistical analysis were performed using the R 3.1.2 GUI 1.65 Statistical Program and the “epiR” package to calculate prevalence estimates.

3. Results

Antibodies against T. gondii were detected in 38 out of 55 (69.09%; 95%CI: 56.0–79.7) hedgehogs. Toxoplasma gondii DNA was not detected in any of the 34 hearts (0.0%; 95%CI: 0.0–10.1) and 60 brains (0.0%; 95%CI: 0.0–6.0) analysed. No statistically significant differences were found in T. gondii seroprevalence between age groups (sub-adults, 64.52%; adults, 75%) (X2 = 0.69, p = 0.40) or sex (females, 74.95%; males, 64.28%) (X2 = 0.62, p = 0.43).

4. Discussion

Landscape anthropization creates the perfect environmental conditions for some domestic animals, favouring the overabundance of some of these species, including domestic cats, the definitive host of T. gondii, and their related pathogens [23], with adverse effects on wild species, including urban wildlife. Understanding the dynamics of T. gondii in urban areas requires the knowledge of many factors (i.e., local climate, land use, habitat composition, domestic/wild felines’ abundance, intermediate hosts community composition) that may influence its circulation at a local scale. The present study provides information on T. gondii seroprevalence of urban hedgehogs from the most densely human-populated area of NE Spain, the Metropolitan Area of Barcelona.
Mammals from a high trophic level, omnivorous or carnivorous species, can be good sentinels for the detection of pathogens in certain ecosystems [15,24]. Omnivorous and carnivorous animals have been increasingly drawn to urban or suburban areas due to easy access to food or shelter [25]. Previous studies have used such high trophic level species, such as American minks as sentinels or indicators for the circulation of T. gondii in semiaquatic freshwater ecosystems [15,26], sea otters in marine environments [27] and hedgehogs as sentinels in urban areas [18]. Our results agree with the previous report on hedgehogs in urban areas in the Czech Republic [18] and suggest that hedgehogs can be used as an indicator for the presence of T. gondii circulating in areas located near human settlements.
A high seroprevalence of antibodies against T. gondii was observed in the studied urban hedgehogs in the MAB. Previous serological studies in hedgehogs showed lower seroprevalence in Austria (25% of 64 hedgehogs by complement fixation test (CFT)) [28] and in central Italy (19% of 100 hedgehogs by Dye test) [29]. In 40 hedgehogs tested serologically in Teramo Province, Italy, no positivity was found [30]. The high prevalence of antibodies against T. gondii assessed in the studied urban hedgehogs is similar to the high antibody prevalences found in feral cats (51.9%) [16] and pregnant women (28.6%) [31] in the same MAB. Similarly, significantly higher seroprevalence levels have been reported in wildlife from the same region, in Catalonia, NE Spain, compared to other areas of Spain in several species, including wild rabbits (53.8%) [32], red deer (42.2%) [16], wild birds (27.2%) [11], or even in legally trapped and released common ravens in Catalonia, which showed one of the highest seroprevalences in wild birds worldwide (80.5%) [14]. MAT has been widely used and accepted in epidemiological studies of different wildlife species. Although the specificity and sensitivity of MAT have not been evaluated for the diagnosis of toxoplasmosis in the European hedgehog, it is the most sensitive and specific test for the diagnosis of toxoplasmosis in warm-blooded species.
However, several studies have reported differences in T. gondii infection in small mammals from different highly anthropised areas in Europe [7,18,33,34,35,36,37,38,39,40,41] (Table 1), suggesting different rates of exposure to the parasite associated with specific factors from the studied areas (i.e., environmental conditions, host communities, host susceptibility, T. gondii lineages).
Importantly, when T. gondii was studied in the invasive American mink in Catalonia, a high seroprevalence (82.6%; n = 46) was observed [15]. In that study, T. gondii was found in American mink brain tissues (9.2%; n = 120) using the same molecular detection method as in the present study, while no T. gondii DNA was detected in the analysed hedgehogs. In the Czech Republic, the parasite was detected in 19.2% of 26 European hedgehogs analysed by PCR in brain tissue [18]. A possible explanation for the lack of T. gondii DNA detected in the brain and hearts of the hedgehogs analysed in the present study is that the analysis of DNA in tissues has usually lower sensitivity than serology due to the random distribution of tissue cysts, the limited volume of sample analysed (1 g of the sample from the whole organ), and the usual low parasite burden observed in the tissues of chronically infected animals [42]. This makes PCR impractical for prevalence studies of T. gondii in chronically infected animals.
The high prevalence of T. gondii infection in urban hedgehogs from the MAB can be explained by its habitat overlapping with feral cats. Although several studies have reported that domestic cats show lower prevalences of oocyst shedding than wild felines [8,43], the large populations of cats represent a significant source of T. gondii oocysts. There are no current estimates of cat densities in the MAB. However, a positive association between human population density and T. gondii oocysts shedding prevalence of free-ranging domestic cats has been reported worldwide [5]. The high prevalence of infection found in urban hedgehogs from the MAB reinforces this association and suggests a high load of T. gondii oocysts in the environment, representing a health risk for the human and wildlife populations in urban areas, in accordance with previous studies [44,45]. The evidence of accumulating T. gondii oocysts in urban areas posing a significant public health hazard has been described worldwide [46].
Many previous studies have shown a relationship of higher seroprevalence by increased age in wildlife species as an indication of continuous contact with the parasite [15,18]. Due to the lifelong persistence of T. gondii IgG antibodies in healthy individuals, seroprevalence by MAT reflects lifelong exposure to the parasite. Increased contact by age indicates horizontal transmission as the main route of T. gondii infection. However, in the present study, there were no significant differences by age groups (sub-adults, 64.52%; adults, 75%) and these results could imply vertical transmission as an important route of T. gondii transmission in hedgehogs in the area, as proved in some small mammals [47]. However, further studies are needed to verify this hypothesis.
In Europe, the expansion of urbanised areas into natural habitats and the increase in urban wildlife in green zones and parks in populated areas favour some wildlife species [48,49]. One of these species is the European hedgehog [50,51,52,53]. However, in the last few decades, the distribution and abundance of European hedgehogs have declined in different European countries, including urban populations [49,54,55,56,57,58,59,60]. Although several causes have been proposed for their decline in urban areas, including parasitic diseases (e.g., Crenosoma striatum, Capillaria spp., gastropod-transmitted lungworms) [49], further research is necessary to investigate the impact of T. gondii on the hedgehogs’ population health.

5. Conclusions

The high T. gondii seroprevalence observed in hedgehogs in the MAB indicates that urban hedgehogs are good candidates to be sentinels of the presence of T. gondii oocysts in anthropised areas. The fact that there were no significant differences in seroprevalence related to age could be an indication of vertical transmission of T. gondii in this species, but further research is needed. In addition, further research is also needed about the potential impact of T. gondii on the health of urban wildlife species, such as hedgehogs.

Author Contributions

Conceptualisation, R.M.-L., O.C., H.G., X.F.A. and A.E.; methodology, O.C., M.P.R., A.E., E.O., H.G. and X.F.A.; formal analysis, A.E., H.G., X.F.A. and R.M.-L.; investigation, A.E., M.P.R., R.M.-L., H.G., X.F.A. and O.C.; resources, O.C. and R.M.-L.; data curation, H.G., X.F.A., O.C. and R.M.-L.; writing—original draft preparation, H.G., A.E. and R.M.-L.; writing—review and editing, H.G., X.F.A., O.C. and S.A.; visualisation, H.G., X.F.A., O.C. and R.M.-L.; supervision, O.C.; project administration, R.M.-L. All authors have read and agreed to the published version of the manuscript.

Funding

M. P. Ribas was funded through the 2021 FI Scholarship, Departament de Recerca i Universitats, Generalitat de Catalunya, Spain (FI_B 00171).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author/s.

Acknowledgments

This study was part of an agreement with the Departament d’Acció Climàtica, Alimentació i Agenda Rural (Generalitat de Catalunya). We thank all the staff of the Torreferrussa Wildlife Rehabilitation Center for their devoted care of the patients. We thank to Lola Pailler for her help in the analysis of the results.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Dubey, J.P. Toxoplasmosis of Animals and Humans, 3rd ed.; CRC Press: Boca Ratón, FL, USA, 2021. [Google Scholar]
  2. Rubel, D.; Wisnivesky, C. Magnitude and distribution of canine fecal contamination and helminth eggs in two areas of different urban structure, Greater Buenos Aires, Argentina. Vet. Parasitol. 2005, 133, 339–347. [Google Scholar] [CrossRef]
  3. Lewis, J.S.; Logan, K.A.; Alldredge, M.W.; Carver, S.; Bevins, S.N.; Lappin, M.; Van de Woude, S.; Crooks, K.R. The effects of demographic, social, and environmental characteristics on pathogen prevalence in wild felids across a gradient of urbanization. PLoS ONE 2017, 12, e0187035. [Google Scholar] [CrossRef]
  4. Barros, M.; Cabezón, O.; Dubey, J.P.; Almería, S.; Ribas, M.P.; Escobar, L.E.; Ramos, B.; Medina-Vogel, G. Toxoplasma gondii infection in wild mustelids and cats across an urban-rural gradient. PLoS ONE 2018, 13, e0199085. [Google Scholar] [CrossRef] [PubMed]
  5. Zhu, S.; VanWormer, E.; Shapiro, K. More people, more cats, more parasites: Human Population Density and Temperature Variation Predict Prevalence of Toxoplasma gondii Oocyst Shedding in Free-ranging Domestic and Wild Felids. PLoS ONE 2023, 18, e0286808. [Google Scholar] [CrossRef]
  6. Wilson, A.G.; Wilson, S.; Alavi, N.; Lapen, D.R. Human density is associated with the increased prevalence of a generalist zoonotic parasite in mammalian wildlife. Proc. R. Soc. B Biol. Sci. 2021, 288, 20211724. [Google Scholar] [CrossRef] [PubMed]
  7. Scherrer, P.; Ryser-Degiorgis, M.P.; Frey, C.F.; Basso, W. Toxoplasma gondii Infection in the Eurasian Beaver (Castor fiber) in Switzerland: Seroprevalence, Genetic Characterization, and Clinicopathologic Relevance. J. Wildl. Dis. 2024, 60, 126–138. [Google Scholar] [CrossRef] [PubMed]
  8. Zhu, S.; Shapiro, K.; VanWormer, E. Dynamics and epidemiology of Toxoplasma gondii oocyst shedding in domestic and wild felids. Transbound. Emerg. Dis. 2022, 69, 2412–2423. [Google Scholar] [CrossRef]
  9. Vanwormer, E.; Conrad, P.A.; Miller, M.A.; Melli, A.C.; Carpenter, T.E.; Mazet, J.A. Toxoplasma gondii, source to sea: Higher contribution of domestic felids to terrestrial parasite loading despite lower infection prevalence. Ecohealth 2013, 10, 277–289. [Google Scholar] [CrossRef] [PubMed]
  10. Almería, S.; Cabezón, O.; Paniagua, J.; Cano-Terriza, D.; Jiménez-Ruiz, S.; Arenas-Montes, A.; Dubey, J.P.; García-Bocanegra, I. Toxoplasma Gondii in Sympatric Domestic and Wild Ungulates in the Mediterranean Ecosystem. Parasitol. Res. 2018, 117, 665–671. [Google Scholar] [CrossRef]
  11. Cabezón, O.; García-Bocanegra, I.; Molina-López, R.; Marco, I.; Blanco, J.M.; Höfle, U.; Margalida, A.; Bach-Raich, E.; Darwich, L.; Echeverría, I.; et al. Seropositivity and Risk Factors Associated with Toxoplasma Gondii Infection in Wild Birds from Spain. PLoS ONE 2011, 6, e29549. [Google Scholar] [CrossRef]
  12. Cabezón, O.; Cerdà-Cuéllar, M.; Morera, V.; García-Bocanegra, I.; González-Solís, J.; Napp, S.; Ribas, M.P.; Blanch-Lázaro, B.; Fernández-Aguilar, X.; Antilles, N.; et al. Toxoplasma gondii Infection in Seagull Chicks Is Related to the Consumption of Freshwater Food Resources. PLoS ONE 2016, 11, e0150249. [Google Scholar] [CrossRef] [PubMed]
  13. Fernández-Aguilar, X.; Alzaga, V.; Villanúa, D.; Cabezón, O.; García-Bocanegra, I.; Dubey, J.P.; Almería, S. Epidemiology and prevalence of Toxoplasma gondii infection in the Iberian hare (Lepus granatensis). Vet. Parasitol. 2013, 196, 194–198. [Google Scholar] [CrossRef]
  14. Molina-López, R.; Cabezón, O.; Pabón, M.; Darwich, L.; Obón, E.; Lopez-Gatius, F.; Dubey, J.P.; Almería, S. High seroprevalence of Toxoplasma gondii and Neospora caninum in the Common raven (Corvus corax) in the Northeast of Spain. Res. Vet. Sci. 2012, 93, 300–302. [Google Scholar] [CrossRef] [PubMed]
  15. Ribas, M.P.; Almería, S.; Fernández-Aguilar, X.; de Pedro, G.; Lizarraga, P.; Alarcia-Alejos, O.; Molina-López, R.; Obón, E.; Gholipour, H.; Temiño, C.; et al. Tracking Toxoplasma Gondii in Freshwater Ecosystems: Inter-action with the Invasive American Mink (Neovison vison) in Spain. Parasitol. Res. 2018, 117, 2275–2281. [Google Scholar] [CrossRef] [PubMed]
  16. Gauss, C.B.; Almería, S.; Ortuño, A.; Garcia, F.; Dubey, J.P. Seroprevalence of Toxoplasma gondii Antibodies in Domestic Cats from Barcelona, Spain. J. Parasitol. 2003, 89, 1067–1068. [Google Scholar] [CrossRef]
  17. The IUCN Red List of Threatened Species. International Union for the Conservation of Nature (IUCN). Available online: https://www.iucnredlist.org/ (accessed on 19 March 2024).
  18. Hofmannová, L.; Juránková, J. Survey of Toxoplasma gondii and Trichinella spp. in Hedgehogs Living in Proximity to Urban Areas in the Czech Republic. Parasitol. Res. 2019, 118, 711–714. [Google Scholar] [CrossRef] [PubMed]
  19. National Air and Space Administration (NASA) Socioeconomic Data and Applications Center (SEDAC): Gridded Population of the World. Available online: https://sedac.ciesin.columbia.edu/data/collection/gpw-v4 (accessed on 15 January 2024).
  20. Dubey, J.P.; Desmonts, G. Serological responses of equids fed Toxoplasma gondii oocysts. Equine Vet. J. 1987, 19, 337–339. [Google Scholar] [CrossRef] [PubMed]
  21. Ajzenberg, D.; Lamaury, I.; Demar, M.; Vautrin, C.; Cabié, A.; Simon, S.; Nicolas, M.; Desbois-Nogard, N.; Boukhari, R.; Riahi, H.; et al. Performance Testing of PCR Assay in Blood Samples for the Diagnosis of Toxoplasmic Encephalitis in AIDS Patients from the French Departments of America and Genetic Diversity of Toxoplasma Gondii: A Prospective and Multicentric Study. PLoS Negl. Trop. Dis. 2016, 10, e0004790. [Google Scholar] [CrossRef] [PubMed]
  22. Galal, L.; Schares, G.; Stragier, C.; Vignoles, P.; Brouat, C.; Cuny, T.; Dubois, C.; Rohart, T.; Glodas, C.; Dardé, M.L.; et al. Diversity of Toxoplasma gondii Strains Shaped by Commensal Communities of Small Mammals. Int. J. Parasitol. 2019, 49, 267–275. [Google Scholar] [CrossRef]
  23. Medina, F.M.; Bonnaud, E.; Vidal, E.; Tershy, B.R.; Zavaleta, E.S.; Josh Donlan, C.; Keith, B.S.; Le Corre, M.; Horwath, S.V.; Nogales, M. A global review of the impacts of invasive cats on island endangered vertebrates. Glob. Chang. Biol. 2011, 17, 3503–3510. [Google Scholar] [CrossRef]
  24. Bossart, G.D. Marine mammals as sentinel species for oceans and human health. Vet. Pathol. 2011, 48, 676–690. [Google Scholar] [CrossRef] [PubMed]
  25. Kornacka-Stackonis, A. Toxoplasma gondii infection in wild omnivorous and carnivorous animals in Central Europe—A brief overview. Vet. Parasitol. 2022, 304, 109701. [Google Scholar] [CrossRef] [PubMed]
  26. Heddergott, M.; Pikalo, J.; Müller, F.; Osten-Sacken, N.; Steinbach, P. Prevalence of Toxoplasma gondii in Wild American Mink (Neogale vison): The First Serological Study in Germany and Poland. Pathogens 2024, 13, 153. [Google Scholar] [CrossRef] [PubMed]
  27. Conrad, P.A.; Miller, M.A.; Kreuder, C.; James, E.R.; Mazet, J.; Dabritz, H.; Jessup, D.A.; Gulland, F.; Grigg, M.E. Transmission of Toxoplasma: Clues from the study of sea otters as sentinels of Toxoplasma gondii flow into the marine environment. Int. J. Parasitol. 2005, 35, 1155–1168. [Google Scholar] [CrossRef] [PubMed]
  28. Sixl, W.; Köck, M.; Withalm, H.; Stünzner, D. Serological investigation of the hedgehog (Erinaceus europaeus) in Styria. Geog. Med. Suppl. 1989, 2, 105–108. [Google Scholar]
  29. Orlandella, V. Study on experimental toxoplasmosis in hedgehogs (Erinaceus europaeus). Acta Med. Vet. 1966, 12, 95–99. [Google Scholar]
  30. Berengo, A.; De Lalla, F.; Pampiglione, S.; Prosperi, S.; Sciarra, D. Toxoplasmosis in Teramo Province, Italy. Parassitologia 1972, 14, 53–63. [Google Scholar]
  31. Muñoz-Batet, C.; Guardià-Llobet, C.; Juncosa-Morros, T.; Viñas-Domenech, L.; Sierra-Soler, M.; Sanfeliu-Sala, I.; Bosch-Mestres, J.; Dopico-Ponte, E.; Lite-Lite, J.; Matas-Andreu, L.; et al. Toxoplasmosis and pregnancy. Multicenter study of 16,362 pregnant women in Barcelona. Med. Clin. (Barc) 2004, 123, 12–16. (In Spanish) [Google Scholar] [PubMed]
  32. Almería, S.; Calvete, C.; Pagés, A.; Gauss, C.; Dubey, J.P. Factors affecting the seroprevalence of Toxoplasma gondii infection in wild rabbits (Oryctolagus cuniculus) from Spain. Vet. Parasitol. 2004, 123, 265–270. [Google Scholar] [CrossRef]
  33. Hughes, J.M.; Williams, R.H.; Morley, E.K.; Cook, D.A.; Terry, R.S.; Murphy, R.G.; Smith, J.E.; Hide, G. The prevalence of Neospora caninum and co-infection with Toxoplasma gondii by PCR analysis in naturally occurring mammal populations. Parasitol. 2006, 132, 29–36. [Google Scholar] [CrossRef]
  34. Krücken, J.; Blümke, J.; Maaz, D.; Demeler, J.; Ramünke, S.; Antolová, D.; Schaper, R.; von Samson-Himmelstjerna, G. Small rodents as paratenic or intermediate hosts of carnivore parasites in Berlin, Germany. PLoS ONE 2017, 12, e0172829. [Google Scholar] [CrossRef] [PubMed]
  35. Ivovic, V.; Potusek, S.; Buzan, E. Prevalence and Genotype Identification of Toxoplasma gondii in Suburban Rodents Collected at Waste Disposal Sites. Parasite 2019, 26, 27. [Google Scholar] [CrossRef] [PubMed]
  36. Maas, M.; Glorie, J.; Dam-Deisz, C.; de Vries, A.; Franssen, F.F.J.; Jaarsma, R.I.; Hengeveld, P.D.; Dierikx, C.M.; van der Giessen, J.W.B.; Opsteegh, M. Zoonotic Pathogens in Eurasian Beavers (Castor fiber) in the Netherlands. J. Wildl. Dis. 2022, 58, 404–408. [Google Scholar] [CrossRef]
  37. Kalmár, Z.; Sándor, A.D.; Balea, A.; Borşan, S.D.; Matei, I.A.; Ionică, A.M.; Gherman, C.M.; Mihalca, A.D.; Cozma-Petruț, A.; Mircean, V.; et al. Toxoplasma gondii in small mammals in Romania: The influence of host, season and sampling location. BMC Vet. Res. 2023, 19, 177. [Google Scholar] [CrossRef] [PubMed]
  38. Psaroulaki, A.; Antoniou, M.; Toumazos, P.; Mazeris, A.; Ioannou, I.; Chochlakis, D.; Christophi, N.; Loukaides, P.; Patsias, A.; Moschandrea, I.; et al. Rats as indicators of the presence and dispersal of six zoonotic microbial agents in Cyprus, an island ecosystem: A seroepidemiological study. Trans. R. Soc. Trop. Med. Hyg. 2010, 104, 733–739. [Google Scholar] [CrossRef] [PubMed]
  39. Ayral, F.; Artois, J.; Zilber, A.-L.; Widén, F.; Pounder, K.C.; Aubert, D.; Bicout, D.J.; Artois, M. The relationship between socioeconomic indices and potentially zoonotic pathogens carried by wild Norway rats: A survey in Rhône, France (2010–2012). Epidemiol. Infect. 2015, 143, 586–599. [Google Scholar] [CrossRef]
  40. Vujanić, M.; Ivović, V.; Kataranovski, M.; Nikolić, A.; Bobić, B.; Klun, I.; Villena, I.; Kataranovski, D.; Djurković-Djaković, O. Toxoplasmosis in naturally infected rodents in Belgrade, Serbia. Vector Borne Zoonotic Dis. 2011, 11, 1209–1211. [Google Scholar] [CrossRef] [PubMed]
  41. Reperant, L.A.; Hegglin, D.; Tanner, I.; Fischer, C.; Deplazes, P. Rodents as shared indicators for zoonotic parasites of carnivores in urban environments. Parasitology 2009, 136, 329–337. [Google Scholar] [CrossRef]
  42. Hill, D.E.; Chirukandoth, S.; Dubey, J.P.; Lunney, J.K.; Gamble, H.R. Comparison of detection methods for Toxoplasma gondii in naturally and experimentally infected swine. Vet. Parasitol. 2006, 141, 9–17. [Google Scholar] [CrossRef]
  43. Hatam-Nahavandi, K.; Calero-Bernal, R.; Rahimi, M.T.; Pagheh, A.S.; Zarean, M.; Dezhkam, A.; Ahmadpour, E. Toxoplasma gondii infection in domestic and wild felids as public health concerns: A systematic review and meta-analysis. Sci. Rep. 2021, 11, 9509. [Google Scholar] [CrossRef]
  44. Carver, S.; Bevins, S.N.; Lappin, M.R.; Boydston, E.E.; Lyren, L.M.; Alldredge, M.; Logan, K.A.; Sweanor, L.L.; Riley, S.P.; Serieys, L.E.; et al. Pathogen exposure varies widely among sympatric populations of wild and domestic felids across the United States. Ecol. Appl. 2016, 26, 367–381. [Google Scholar] [CrossRef] [PubMed]
  45. Hillman, A.E.; Lymbery, A.J.; Elliot, A.D.; Andrew Thompson, R.C. Urban environments alter parasite fauna, weight and reproductive activity in the quenda (Isoodon obesulus). Sci. Total Environ. 2017, 607–608, 1466–1478. [Google Scholar] [CrossRef] [PubMed]
  46. Torrey, E.F.; Yolken, R.H. Toxoplasma oocysts as a public health problem. Trends Parasitol. 2013, 29, 380–384. [Google Scholar] [CrossRef] [PubMed]
  47. Owen, M.R.; Trees, A.J. Vertical transmission of Toxoplasma gondii from chronically infected house (Mus. musculus) and field (Apodemus sylvaticus) mice determined by polymerase chain reaction. Parasitology 1998, 116, 299–304. [Google Scholar] [CrossRef] [PubMed]
  48. Castillo-Contreras, R.; Carvalho, J.; Serrano, E.; Mentaberre, G.; Fernández-Aguilar, X.; Colom, A.; González-Crespo, C.; Lavín, S.; López-Olvera, J.R. Urban wild boars prefer fragmented areas with food resources near natural corridors. Sci. Total Environ. 2018, 615, 282–288. [Google Scholar] [CrossRef] [PubMed]
  49. Taucher, A.L.; Gloor, S.; Dietrich, A.; Geiger, M.; Hegglin, D.; Bontadina, F. Decline in Distribution and Abundance: Urban Hedgehogs under Pressure. Animals 2020, 10, 1606. [Google Scholar] [CrossRef] [PubMed]
  50. Hubert, P.; Julliard, R.; Biagianti, S.; Poulle, M.L. Ecological factors driving the higher hedgehog (Erinaceus europeaus) density in an urban area compared to the adjacent rural area. Landsc. Urban Plan. 2011, 103, 34–43. [Google Scholar] [CrossRef]
  51. Pettett, C.E.; Moorhouse, T.P.; Johnson, P.J.; Macdonald, D.W. Factors affecting hedgehog (Erinaceus europaeus) attraction to rural villages in arable landscapes. Eur. J. Wildl. Res. 2017, 63, 1–12. [Google Scholar] [CrossRef]
  52. Van de Poel, J.L.; Dekker, J.; van Langevelde, F. Dutch hedgehogs Erinaceus europaeus are nowadays mainly found in urban areas, possibly due to the negative effects of badgers Meles meles. Wildl. Biol. 2015, 21, 51–55. [Google Scholar] [CrossRef]
  53. Rasmussen, S.L.; Berg, T.B.; Dabelsteen, T.; Jones, O.R. The ecology of suburban juvenile European hedgehogs (Erinaceus europaeus) in Denmark. Ecol. Evol. 2019, 9, 13174–13187. [Google Scholar] [CrossRef]
  54. Huijser, M.P.; Bergers, P.J.M. The effect of roads and traffic on hedgehog (Erinaceus europaeus) populations. Biol. Conserv. 2000, 95, 6–9. [Google Scholar] [CrossRef]
  55. Hof, A.R.; Bright, P.W. Quantifying the long-term decline of the West European hedgehog in England by subsampling citizen-science datasets. Eur. J. Wildl. Res. 2016, 62, 407–413. [Google Scholar] [CrossRef]
  56. Krange, M. Change in the Occurrence of the West European Hedgehog (Erinaceus europaeus) in Western Sweden during 1950–2010; Karlstad University: Karlstad, Sweden, 2015. [Google Scholar]
  57. Harris, S.; Morris, P.; Wray, S.; Yalden, D. A Review of British Mammals: Population Estimates and Conservation Status of British Mammals other than Cetaceans; Joint Nature Conservation Committee: Peterborough, UK, 1995; p. 216. [Google Scholar]
  58. Battersby, J. UK Mammals: Species Status and Population Trends; JNCC: Peterborough, UK, 2005. [Google Scholar]
  59. Wembridge, D. The State of Britain’s Hedgehogs. 2011. Available online: https://ptes.org/wp-content/uploads/2015/11/SOBH2011.pdf (accessed on 5 February 2024).
  60. Roos, S.; Johnston, A.; Noble, D. UK Hedgehog Datasets and Their Potential for Long-Term Monitoring. British Trust for Ornithology Research Report 598. 2012. Available online: https://www.bto.org/our-science/projects/gbw/publications/papers/monitoring/btorr598 (accessed on 12 January 2024).
Figure 1. The hedgehogs analysed in this study were found in the Metropolitan Area of Barcelona, the largest human population of NE Spain (A). A gradient of the human population is depicted in the panel.
Figure 1. The hedgehogs analysed in this study were found in the Metropolitan Area of Barcelona, the largest human population of NE Spain (A). A gradient of the human population is depicted in the panel.
Animals 14 01596 g001
Table 1. Prevalence of Toxoplasma gondii infection in small mammals from highly anthropised areas from Europe.
Table 1. Prevalence of Toxoplasma gondii infection in small mammals from highly anthropised areas from Europe.
Species% T. gondiiTechniqueTissueCountryReference
Mus musculus53%PCRbrainUK[33]
Rattus norvegicus42.2%
Rodents4.66%PCRbrainBerlin (Germany)[34]
Apodemus flavicollis2.22%
Apodemus agrarius5.13%
Myodes glareolus0%
Apodemus sylvaticus8%
Microtus arvalis27.3%
Microtus agrestis50%
Rodents2.94%PCRbrainIstria (Croatia/Slovenia)[35]
Apodemus agrarius1.2%PCRheartRomania[37]
Apodemus flavicollis8.5%
Apodemus sylvaticus9.1%
Micromys minutus11.1%
Microtus arvalis4.3%
Microtus subterraneus4.4%
Mus musculus5.7%
Myodes glareolus35.5%
Sorex araneus21.7%
Sorex minutus23.1%
Spermophilus citellus33.3%
T. europaea, R. norvegicus, O. zibethicus, N. anomalus, M. spicilegus, C. suaveolens, C. leucodon, A. amphibious, A. uralensis0%
Erinaceus europaeus19.2%PCRbrainCzech Republic[18]
Erinaceus roumanicus16.6%
Rattus rattus26.9%IFATserumCyprus[38]
Rattus norvegicus28.3%
Rattus norvegicus7.7%MATserumRhône (France)[39]
Rattus norvegicus27.5%MATserumSerbia[40]
Erinaceus europaeus19%Dye testserumCentral Italy[29]
Erinaceus europaeus0%Dye testserumTeramo province, Italy[30]
Erinaceus europaeus25%CFTserumAustria[28]
Castor fiber54.6%ELISAserumSwitzerland[7]
Apodemus flavicollis2.5%ELISAserumGeneva (Switzerland)[41]
Microtus arvalis3.1%
Arvicola terrestris5%
MAT: modified agglutination test, CFT: complement fixation test, IFAT: indirect immunofluorescent antibody assay (IFAT).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Escudero, A.; Ribas, M.P.; Obón, E.; Almería, S.; Aguilar, X.F.; Gholipour, H.; Cabezón, O.; Molina-López, R. Exposure of Urban European Hedgehogs (Erinaceus europaeus) to Toxoplasma gondii in Highly Populated Areas of Northeast Spain. Animals 2024, 14, 1596. https://doi.org/10.3390/ani14111596

AMA Style

Escudero A, Ribas MP, Obón E, Almería S, Aguilar XF, Gholipour H, Cabezón O, Molina-López R. Exposure of Urban European Hedgehogs (Erinaceus europaeus) to Toxoplasma gondii in Highly Populated Areas of Northeast Spain. Animals. 2024; 14(11):1596. https://doi.org/10.3390/ani14111596

Chicago/Turabian Style

Escudero, Alejandra, Maria Puig Ribas, Elena Obón, Sonia Almería, Xavier Fernández Aguilar, Hojjat Gholipour, Oscar Cabezón, and Rafael Molina-López. 2024. "Exposure of Urban European Hedgehogs (Erinaceus europaeus) to Toxoplasma gondii in Highly Populated Areas of Northeast Spain" Animals 14, no. 11: 1596. https://doi.org/10.3390/ani14111596

APA Style

Escudero, A., Ribas, M. P., Obón, E., Almería, S., Aguilar, X. F., Gholipour, H., Cabezón, O., & Molina-López, R. (2024). Exposure of Urban European Hedgehogs (Erinaceus europaeus) to Toxoplasma gondii in Highly Populated Areas of Northeast Spain. Animals, 14(11), 1596. https://doi.org/10.3390/ani14111596

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop