Identification and Analysis of Genes Related to Testicular Size in 14-Day-Old Piglets
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Test Animal Selection and Sample Collection
2.2. Materials and Methods
2.2.1. Histological Testing
2.2.2. RNA-Seq
2.2.3. Differential Expression Analysis and Differential Expression Genes (DEGs) Enrichment Analysis
2.2.4. Real-Time qRT-PCR Validation
2.3. Data Processing and Analysis
3. Results
3.1. Histological Observation
3.2. Quality Control Data Statistics and Sequence Alignment
3.3. DEGs Screening
3.4. GO Function Enrichment Analysis of DEGs
3.5. KEGG Function Enrichment Analysis Results of DEGs
3.6. Real-Time qRT-PCR Verification Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sun, W.; Luo, J.; Li, F.; Li, W.; Yue, X. Progress of Screening Genes and Regulating Network Related to Testis Development in Mammals Based on Transcriptomics. Chin. J. Anim. Vet. Sci. 2018, 49, 1810–1817. [Google Scholar]
- Aguirre, V.; Orihuela, A.; Vázquez, R. Effect of semen collection frequency on seasonal variation in sexual behaviour, testosterone, testicular size and semen characteristics of tropical hair rams (Ovis aries). Trop. Anim. Health Prod. 2007, 39, 271–277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, B.; Yan, Z.; Wang, P.; Yang, Q.; Huang, X.; Shi, H.; Tang, Y.; Ji, Y.; Zhang, J.; Gun, S. Identification and Characterization of lncRNA and mRNA in Testes of Landrace and Hezuo Boars. Animals 2021, 11, 2263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, X.; Niu, X.; Huang, S.; Li, S.; Ran, X.; Wang, J.; Dai, X. The piRNAs are present in the developing testes of Chinese indigenous Xiang pigs. Theriogenology 2022, 189, 92–106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, W.; Zhao, F.; Chen, M.; Li, Y.; Lan, X.; Yang, R.; Pan, C. Identification and characterization of male reproduction-related genes in pig (Sus scrofa) using transcriptome analysis. BMC Genom. 2020, 21, 381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, D.; Pertea, G.; Trapnell, C.; Pimentel, H.; Kelley, R.; Salzberg, S.L. TopHat2:accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013, 14, 36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, L.; Feng, Z.; Wang, X.; Wang, X.; Zhang, X. DEGseq: An R package for identifying differentially expressed genes from RNA-seq data. Bioinformatics 2010, 26, 136–138. [Google Scholar] [CrossRef] [Scilit]
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef] [Scilit]
- Klopfenstein, D.V.; Zhang, L.; Pedersen, B.S.; Ramírez, F.; Vesztrocy, A.W.; Naldi, A.; Mungall, C.J.; Yunes, J.M.; Botvinnik, O.; Weigel, M.; et al. GOATOOLS: A Python library for Gene Ontology analyses. Sci. Rep. 2018, 8, 10872. [Google Scholar] [CrossRef] [Scilit]
- Ding, J.; Tang, D.; Zhang, Y.; Gao, X.; Du, C.; Shen, W.; Jin, S.; Zhu, J. Transcriptomes of Testes at Different Developmental Stages in the Opsariichthys bidens Predict Key Genes for Testis Development and Spermatogenesis. Mar. Biotechnol. 2022, 25, 123–139. [Google Scholar] [CrossRef] [Scilit]
- Chen, M.; Wang, J.; Liu, N.; Cui, W.; Dong, W.; Xing, B.; Pan, C. Pig SOX9:Expression profiles of Sertoli cell (SCs) and a functional 18 bp indel affecting testis weight. Theriogenology 2019, 138, 94–101. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Cui, Y.; Zhang, X.; Wang, Y.; Gao, J.; Yu, T.; Lv, X.; Pan, C. Pig StAR: mRNA expression and alternative splicing in testis and Leydig cells, and association analyses with testicular morphology traits. Theriogenology 2018, 118, 46–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaczmarek, K.; Niedzialkowska, E.; Studencka, M.; Schulz, Y.; Grzmil, P. Ccdc33,a predominantly testis-expressed gene, encodes a putative peroxisomal protein. Cytogenet. Genome Res. 2009, 126, 243–252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, P.H.; Hu, W.; Zhang, X.B.; Wang, W.; Zhang, L.J. Protective Effect of Adrenomedullin on Rat Leydig Cells from Lipopolysaccharide-Induced Inflammation and Apoptosis via the PI3K/Akt Signaling Pathway ADM on Rat Leydig Cells from Inflammation and Apoptosis. Mediators Inflamm. 2016, 2016, 7201549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, Y.; Yang, W.; Luo, H.; Wang, X.; Chen, Z.; Zhang, J.; Wang, Y.; Li, X. Thyroid hormone inhibits the proliferation of piglet Sertoli cell via PI3K signaling pathway. Theriogenology 2015, 83, 86–94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Itman, C.; Wong, C.; Whiley, P.A.; Fernando, D.; Loveland, K.L. TGFβ superfamily signaling regulators are differentially expressed in the developing and adult mouse testis. Spermatogenesis 2011, 1, 63–72. [Google Scholar] [CrossRef] [Scilit]
- Golestaneh, N.; Beauchamp, E.; Fallen, S.; Kokkinaki, M.; Üren, A.; Dym, M. Wnt signaling promotes proliferation and stemness regulation of spermatogonial stem/progenitor cells. Reproduction 2009, 138, 151–162. [Google Scholar] [CrossRef] [Scilit]
- Sharpe, R.; McKinnell, C.; Kivlin, C.; Fisher, J. Proliferation and functional maturation of Sertoli cells, and their relevance to disorders of testis function in adulthood. Reproduction 2003, 125, 769–784. [Google Scholar] [CrossRef]
- Wong, E.W.; Lee, W.M.; Cheng, C.Y. Secreted Frizzled-related protein 1 (sFRP1) regulates spermatid adhesion in the testis via dephosphorylation of focal adhesion kinase and the nectin-3 adhesion protein complex. FASEB J. 2013, 27, 464–477. [Google Scholar] [CrossRef] [Scilit]
- Kahn, M. Can we safely target the WNT pathway? Nat. Rev. Drug Discov. 2014, 13, 513–532. [Google Scholar] [CrossRef] [Scilit]
- Surana, R.; Sikka, S.; Cai, W.; Shin, E.M.; Warrier, S.R.; Tan, H.J.G.; Arfuso, F.; Fox, S.A.; Dharmarajan, A.M.; Kumar, A.P. Secreted frizzled related proteins: Implications in cancers. Biochim. Biophys. Acta 2014, 1845, 53–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fabijanovic, D.; Zunic, I.; Martic, T.N.; Skenderi, F.; Serman, L.; Vranic, S. The expression of SFRP1,SFRP3,DVL1,and DVL2 proteins in testicular germ cell tumors. Apmis 2016, 124, 942–949. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, S.Y.; Jameson, J.L. Minireview: Transcriptional regulation of gonadal development and differentiation. Endocrinology 2005, 146, 1035–1042. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, S.; Shin, T. Immunohistochemical study of osteopontin in boar testis. J. Vet. Sci. 2007, 8, 107–110. [Google Scholar] [CrossRef] [Scilit]
- Johnson, G.A.; Burghardt, R.C.; Bazer, F.W. Osteopontin: A leading candidate adhesion molecule for implantation in pigs and sheep. J. Anim. Sci. Biotechnol. 2014, 5, 56. [Google Scholar] [CrossRef] [Scilit]
- Stenhouse, C.; Cortes-Araya, Y.; Donadeu, F.X.; Ashworth, C.J. Associations between testicular development and fetal size in the pig. J. Anim. Sci. Biotechnol. 2022, 13, 24. [Google Scholar] [CrossRef] [Scilit]
- Kuiri-Hänninen, T.; Sankilampi, U.; Dunkel, L. Activation of the hypothalamic-pituitary-gonadal axis in infancy: Minipuberty. Horm. Res. Paediatr. 2014, 82, 73–80. [Google Scholar] [CrossRef] [Scilit]
- Young, J.; Xu, C.; Papadakis, G.E.; Acierno, J.S.; Maione, L.; Hietamäki, J.; Raivio, T.; Pitteloud, N. Clinical Management of Congenital Hypogonadotropic Hypogonadism. Endocr. Rev. 2019, 40, 669–710. [Google Scholar] [CrossRef] [Scilit]
- Lund, C.; Yellapragada, V.; Vuoristo, S.; Balboa, D.; Trova, S.; Allet, C.; Eskici, N.; Pulli, K.; Giacobini, P.; Tuuri, T.; et al. Characterization of the human GnRH neuron developmental transcriptome using a GNRH1-TdTomato reporter line in human pluripotent stem cells. Dis. Models Mech. 2020, 13, dmm040105. [Google Scholar] [CrossRef] [Scilit]
- Liu, T.; Laidlaw, T.M.; Feng, C.; Xing, W.; Shen, S.; Milne, G.L.; Boyce, J.A. Prostaglandin E2 deficiency uncovers a dominant role for thromboxane A2 in house dust mite-induced allergic pulmonary inflammation. Proc. Natl. Acad. Sci. USA 2012, 109, 12692–12697. [Google Scholar] [CrossRef] [Scilit]
- Sasaki, Y.; Kamei, D.; Ishikawa, Y.; Ishii, T.; Uematsu, S.; Akira, S.; Murakami, M.; Hara, S. Microsomal prostaglandin E synthase-1 is involved in multiple steps of colon carcinogenesis. Oncogene 2012, 31, 2943–2952. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Piotrowska-Tomala, K.; Siemieniuch, M.; Szóstek, A.; Korzekwa, A.; Woclawek-Potocka, I.; Galváo, A.; Okuda, K.; Skarzynski, D. Lipopolysaccharides, cytokines, and nitric oxide affect secretion of prostaglandins and leukotrienes by bovine mammary gland epithelial cells. Domest. Anim. Endocrinol. 2012, 43, 278–288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaewmala, K.; Uddin, M.J.; Cinar, M.U.; Große-Brinkhaus, C.; Jonas, E.; Tesfaye, D.; Phatsara, C.; Tholen, E.; Looft, C.; Schellander, K. Investigation into association and expression of PLCz and COX-2 as candidate genes for boar sperm quality and fertility. Reprod. Domest. Anim. 2012, 47, 213–223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marques, D.B.; Bastiaansen, J.W.; Broekhuijse, M.L.; Lopes, M.S.; Knol, E.F.; Harlizius, B.; Guimarães, S.E.; Silva, F.F.; Lopes, P.S. Weighted single-step GWAS and gene network analysis reveal new candidate genes for semen traits in pigs. Genet. Sel. Evol. 2018, 50, 40. [Google Scholar] [CrossRef] [Scilit]







| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| PTGES | AGTGAGGCTTCGGAAGAAGG | TCATTCCGATGGGCCCTAAG |
| SFRP1 | GTGTCCTCCATGTGACAACG | CGATCTTCTTGTCGCCGTTT |
| SPP1 | GCCACATTGCTAAAGCCTGA | TGGCAGGGTCTCTTGTTTGA |
| PLA2G4E | AATGTGATGCCAACGTCCTG | AGTTGTGGAACTGGGACACA |
| KCNJ5 | TACCTGAGCGACCTCTTCAC | CCCGGATGTAAGCAATGAGC |
| PTGS2 | TGATGGCCACGAGTACAACT | CTGGTCGATTGAGGCCTTTG |
| HCN1 | CGAGAAGGAGCTGTGGGTAA | TCAGCAGGCAAATCTCTCCA |
| β-actin | CCCTGGAGAAGAGCTACGAG | TAGAGGTCCTTGCGGATGTC |
| Sample | Total Reads | Total Mapped | Multiple Mapped | Uniquely Mapped |
|---|---|---|---|---|
| LT12 | 57,632,434 | 55,340,855 (96.02%) | 1,873,579 (3.25%) | 53,467,276 (92.77%) |
| LT14 | 62,742,476 | 60,345,536 (96.18%) | 2,104,208 (3.35%) | 58,241,328 (92.83%) |
| LT15 | 62,787,562 | 60,345,322 (96.11%) | 1,982,702 (3.16%) | 58,362,620 (92.95%) |
| ST4 | 61,715,704 | 59,368,830 (96.2%) | 2,043,653 (3.31%) | 57,325,177 (92.89%) |
| ST22 | 58,535,570 | 56,198,163 (96.01%) | 1,814,622 (3.1%) | 54,383,541 (92.91%) |
| ST37 | 57,182,910 | 55,152,747 (96.45%) | 1,869,568 (3.27%) | 53,283,179 (93.18%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, Y.; Zhang, L.; Wang, L.; Zhang, J.; Shen, W.; Ma, Y.; Ding, C.; Wu, G. Identification and Analysis of Genes Related to Testicular Size in 14-Day-Old Piglets. Animals 2024, 14, 172. https://doi.org/10.3390/ani14010172
Zhao Y, Zhang L, Wang L, Zhang J, Shen W, Ma Y, Ding C, Wu G. Identification and Analysis of Genes Related to Testicular Size in 14-Day-Old Piglets. Animals. 2024; 14(1):172. https://doi.org/10.3390/ani14010172
Chicago/Turabian StyleZhao, Yunjiao, Liangzhi Zhang, Lei Wang, Jianbo Zhang, Wenjuan Shen, Yuhong Ma, Chengxiang Ding, and Guofang Wu. 2024. "Identification and Analysis of Genes Related to Testicular Size in 14-Day-Old Piglets" Animals 14, no. 1: 172. https://doi.org/10.3390/ani14010172
APA StyleZhao, Y., Zhang, L., Wang, L., Zhang, J., Shen, W., Ma, Y., Ding, C., & Wu, G. (2024). Identification and Analysis of Genes Related to Testicular Size in 14-Day-Old Piglets. Animals, 14(1), 172. https://doi.org/10.3390/ani14010172

