Next Article in Journal
Ultrasonography of Pregnancy in Murciano-Granadina Goat Breed: Fetal Growth Indices and Umbilical Artery Doppler Parameters
Next Article in Special Issue
In Situ Degradation Kinetics of 25 Feedstuffs and the Selection of Time Points in Mathematical Statistics
Previous Article in Journal
Examination of Shape Variation of the Skull in British Shorthair, Scottish Fold, and Van Cats
Previous Article in Special Issue
Supplementary Feeding of Grazing Inner Mongolian Cashmere Goats during Pregnancy—Based on “Nutrient Requirements of Cashmere Goats”
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Hair Follicle Development and Cashmere Traits in Albas Goat Kids

1
State Key Laboratory of Animal Nutrition, College of Animal Science and Technology, China Agricultural University, Beijing 100193, China
2
Department of Animal Nutrition and Feed Science, College of Animal Science and Technology, China Agricultural University, No. 2, Yuan Ming Yuan West Road, Beijing 100193, China
*
Author to whom correspondence should be addressed.
The authors contributed equally to this work.
Animals 2023, 13(4), 617; https://doi.org/10.3390/ani13040617
Submission received: 25 December 2022 / Revised: 31 January 2023 / Accepted: 7 February 2023 / Published: 9 February 2023

Simple Summary

The development of secondary hair follicles in goat kids determines cashmere quality in adults; however, this requires theoretical support. After a follow-up trial, we found that the development of secondary hair follicles in kids is complete at 5–6 months of age. FGF2, 21 and BMP7 may promote the growth of secondary hair follicles; and the optimal period for secondary hair follicle regulation is from birth to 5–6 months of age. In addition, hair follicle traits at 6 months of age can be used as an index for the breeding selection of cashmere goats.

Abstract

The objectives of this trial were to study the growth and development of hair follicles and cashmere traits in cashmere goats and to provide a theoretical basis for the regulation of secondary hair follicle development and the scientific breeding selection of cashmere goats. Twelve single-fetal female kids were selected as research objects. A long-term tracking plan was created to regularly determine their growth performance, cashmere performance, and hair follicle traits. The results showed no significant difference in live weight after the first and second combing. The cashmere yield and unit yield of the first combing were significantly higher than those of the second combing (p < 0.05). Sections of hair follicles showed that the primary hair follicles are almost fully developed by 1 month, and the secondary hair follicles are fully developed by 5–6 months after birth. The primary hair follicle density (PFD) and secondary hair follicle density (SFD) were highest at birth and decreased within 1 month; and SFD was stable at 5–6 months of age. The change of MSFD took a maximum time of 2 to 3 months. The S:P increase reached its peak at 6 months. BMP4 expression increased with time. FGF2, FGF21 and BMP7 were higher at 3 months old than at the other two-time points. In conclusion, this study determined the total development time of primary and secondary hair follicles from morphology and speculated that FGF2, FGF21, and BMP7 may play a regulatory role in developing secondary hair follicles. Therefore, the period from birth to 6 months of age was the best time to regulate secondary hair follicle development in cashmere goats kids. The traits of the hair follicle and cashmere at 6 months of age could be breeding selection indicators for cashmere goats.

1. Introduction

China is the world’s largest producer, processor, and marketer of cashmere; with total cashmere production accounting for over 70% of the world’s total production. China also has excellent cashmere goat varieties, of which the Inner Mongolia Albas cashmere goat is renowned for its high cashmere yield and good quality [1,2]. The quality of cashmere is determined by its yield, fineness, and length [3]. The diameter of Inner Mongolia Albas cashmere is mainly between 14 and 16 μm, and the super fine variety diameter was 14.5 μm or less. Cashmere quality is affected by genetic, environmental, and feeding management factors. Some studies show that cashmere yield is correlated with live weight, length, and fineness [4,5]; moreover, cashmere yield can be increased under supplementary feeding [6,7].
The hair follicle is a skin-derived organ and is divided into primary and secondary follicles, with the primary hair follicle growing coarse hair and the secondary hair follicle growing cashmere [8,9]. The growth of cashmere is cyclical, emerging from the body in August each year and shedding naturally in April of the following year. Cashmere growth and shedding are determined by the cycle of the secondary hair follicles, which consists of the anagen, catagen, and telogen phases [10,11]. The growth of secondary hair follicles is a complex process regulated by a variety of signaling pathways, of which the FGF and the BMP signaling pathways are well studied [12]. The fibroblast growth factor (FGF) family is expressed in human skin. FGF1, 2, 5, 7, 10, 13, and 22 are known to be expressed in dermal and hair follicular cells and regulate hair growth and skin regeneration [13]. FGF2 can promote the proliferation of the central neuron cells of mesenchymal cells and bone marrow mesenchymal stem cells [14]. FGF21 is involved in hair follicle development and promotes secondary follicle development in the retrograde period [15]. Bone morphogenetic proteins (BMPs) belong to the transforming growth factor-β (TGF-β) superfamily, and BMPs are involved in a wide range of biological processes, such as cell proliferation, differentiation, bone formation, tumors, and hair follicle growth [16]. It is generally believed that BMPs have inhibitory and antagonistic effects on hair follicle growth, and BMP2, BMP4, BMP6, and BMP7 have been identified as candidate genes for hair follicle development [17,18,19]. Zhang et al. proposed a model to explain a mechanism controlling expression of the BMP4 gene in different tissue types, as well as different development stages as related to hair development [20]. BMP7 is highly expressed in the growth phase of hair follicles and is low or undetected in the degenerate or resting phase [21]. Lv et al. noted that BMP7 may promote the proliferation of hair follicle cells in the hair follicle growth phase [22]. Noramly et al. found that BMP7 was associated with the size and spatial distribution of the feather germs, implying a potential role in hair follicle growth and development [23]. Furthermore, previous RNA-seq data from our study of adult goats and kids found that FGF2/21 and BMP4/7 were highly expressed (Table 1). Therefore, we speculated that FGF2/21 and BMP4/7 played an important role in the skin hair follicles of goats.
In addition, the breeding selection of cashmere goats includes two stages: (1) the choice of goat kids based on their weight and (2) the choice of adult goats based on their weight and cashmere traits. Nonetheless, in neither case are secondary hair follicle traits considered. Moreover, we speculate that young age is the critical period for regulating the development of secondary hair follicles, as it determines the “Lifetime cashmere quality”. Therefore, this study observed the morphogenesis of hair follicles in goat kids and regularly determined the secondary hair follicle traits and expression of crucial genes in order to provide a theoretical basis for regulating the development of secondary hair follicles, and to create a reference for scientific breeding selection of Inner Mongolia cashmere goats.

2. Materials and Methods

2.1. Animals and Sampling

This study was conducted on a commercial farm (YiWei white cashmere goat farm) located in the Inner Mongolia Autonomous Region, China, 39°06′ N, 107°59′ E. Twelve female, singleton, Inner Mongolian Albas cashmere goat kids, which were healthy newborns with a mean live weight (3.00 ± 0.56), were selected as the experimental subjects. Long-term follow-up studies were conducted (at ages 1 day to 6 months, 12 months, and 24 months, respectively) with regular weight, skin, and cashmere samples. Four skin samples were collected regularly at the posterior edge of the left scapula and the upper 1/3 of the line between the middorsal line and the midabdominal line for the skin test. Histological sections were stained with Sacpic method and then they were accurately analyzed under a photomicroscope (Leica ICC 50 W, Leica, Wetzlar, Germany) to determine the traits of the hair follicles [24,25]. The hair follicle index included the primary hair follicle density (PFD), secondary hair follicle density (SFD), mature secondary hair follicle density (MSFD), S:P, and the ratio of MSF. The total cashmere weight of each dam was recorded after combing, and cashmere samples within an area of 10 × 10 cm were shorn from the left midside of each dam close to the skin for the measurement of fiber staple length and diameter. The procedures for determining hair follicle indexes and cashmere traits refer to Yang and Duan [26,27].

2.2. RT-qPCR

FGF2, FGF21, BMP4, and BMP7 mRNA expression levels in the skin were measured using Q-PCR. The total RNA from the skin tissue was extracted using TRIzol (Takara, Dalian, China). All primer sequences were determined using established GenBank sequences, which are listed in Table 2. RNA was reverse transcribed to cDNA using a cDNA Synthesis Kit (Servicebio, Beijing, China). Real-time qPCR was performed on an ABI7500 system (Applied Biosystem, CA, USA) using a qPCR Detection kit (SYBR Green) (Servicebio, Beijing, China). Data were processed using ABI7500 Software v. 2.0.6 (Applied Biosystem, CA, USA). The RT-PCR analysis was performed using the 2−ΔΔCT method.

2.3. Immunofluorescence

Skin specimens were fixed in 4% paraformaldehyde and were then dehydrated and embedded in paraffin. Paraffin sections were successfully dewaxed in different gradients of the dewaxing solution, absolute ethanol, and distilled water. The dewaxed sections were placed in EDTA antigen repair buffer (pH 8.0) for antigen repair and blocked with a 10% donkey serum block. Primary antibodies were then added: anti-rabbit-FGF-21 (1:200) and BMP7 antibody (1:200), and incubated overnight at 4°C. On the next day, the slides were washed three times with PBS (pH 7.4) in a rocker device, the objective tissue was covered with a secondary antibody (responding appropriately to the primary antibody in the species), and was incubated at room temperature for 50 min in dark conditions. Finally, DAPI dye solution was added and incubated for 10 min. The images were observed and collected under a fluorescence microscope (GE Bioscience, Newark, NJ, USA).

2.4. Statistical Analyses

We used Excel to collect and organize the data, and the SPSS28 (IBM, New York, NY, USA) general linear model was used to compare the hair follicle indicators and cashmere performance in each stage. The results were expressed as mean ± standard error. A difference was considered significant at p < 0.05.

3. Results

3.1. The Live Weight of Cashmere Goat at Different Phases

We tracked the weight of cashmere goats within two years of age (Table 3). The weight of goat kids increased steadily from birth to 6 months, reaching nearly 18 kg, and remained at approximately 28 kg at the first and second combings (p < 0.05). The same weight provides a good analysis environment for us in the statistics of cashmere and hair follicle traits.

3.2. Cashmere Performance at Different Phases

We measured the cashmere characteristics after weaning at 3 months of age (Table 4). The diameter at 6 months (12.80 μm, p < 0.05) was significantly lower than that at other time points. The diameter was approximately 13.50 μm and the length was approximately 9.10 cm at the first and second combing. The yield and the yield per unit live weight of the first combing (869.48 g, 30.58 g/kg, p < 0.05) were significantly higher than those from the second combing.

3.3. The Development of Hair Follicles at Different Phases

Figure 1 shows the cross and longitudinal sections of hair follicles from the 1st day to the 180th day. As seen in the cross-section, most primary hair follicles completed development on the 1st day, whereas some had not yet. However, the secondary hair follicles were immature and in small number. The hair follicle morphology shows purple cell clusters in the differentiation stage. At 1 month old, primary hair follicles were thoroughly developed and the number of mature secondary hair follicles increased rapidly; and the distance between hair follicles was relatively loose. At 5–6 months of age, the morphology and the number of secondary hair follicles tended to be stable. Longitudinal and cross-sections showed similar results. Nonetheless, an interesting observation was that secondary hair follicles grew to run downward from the skin surface over time and were closest to the primary hair follicle in the same follicle group at 5–6 months.

3.4. Hair Follicle Traits at Different Phases

Table 5 shows the long-term record of hair follicle traits. PFD decreased gradually from day 1 to 6 months (9.97–3.86 n/mm²) and stabilized at between 5 and 6 months and 1.5 years old (the middle period of the second anagen). Furthermore, there was no difference between 4 months and 5 months, 6 months, and 1.5 years old (p > 0.05). The changing trend of SFD was similar to that of the primary hair follicles (60.75–46.83 n/mm²). The SFD at 6 months to 1.5 years was similar (p > 0.05). MSFD increased rapidly from 1 month of age, gradually approaching the number of total secondary hair follicles; and the change in MSFD occurred at a maximum of 2 months to 3 months of age, suggesting that the growth of secondary hair follicles is very active at this time. The ratio of MSFD was approximately 0.5–0.7 prior to 2 months of age and gradually levelled off with increasing age, approaching 1.0. S:P increased at the age of 1 month (6.10–12.64) and at 6 months; and the maximum value was not significantly different from that at the 4th and 5th months, and 1.5 years old (p > 0.05).

3.5. The mRNA and Protein Expression of BMP and FGF

The expression of FGF and BMP genes on the 1st, 90th, and 180th day-olds was tested (Figure 2). We found the expression of FGF2, 21, and BMP7 genes on the 90th day was higher than that at the other two time points. The level of BMP4 expression increased over time. Moreover, the protein of FGF21 and BMP7 was determined (Figure 3). FGF21 protein was expressed mainly in the dermal papilla, inner root sheath, outer root sheath, and epidermis. BMP7 was mainly expressed in the interstitial tissue between hair follicles, almost not at all in the hair follicle area; and the expression level of BMP7 in the epidermis was lower than that of FGF21.

4. Discussion

In this study, the growth of hair follicles and cashmere on Inner Mongolia Albas cashmere goats from birth to 2 years of age was tracked. We found that the primary and secondary hair follicles were developed entirely by 1 month and 5–6 months of age, respectively. The cashmere and unit yields of the first combing were higher than those of the second combing. The expression levels of the FGF2, 21, and BMP7 genes-essential genes for hair follicle development-were higher at 3 months of age.
Inner Mongolia Albas goat coat is composed of wool and cashmere, corresponding to the primary and secondary hair follicles, respectively. The growth of cashmere in adult cashmere goats follows an annual cycle. In general, cashmere growth begins in the summer, stops in the winter, and is shed naturally in the spring; with no cashmere growing on the body surface between spring and summer. Cashmere quality is affected by genetic, breeding management and environmental factors [28,29,30,31]. With increase in age, the fleece or cashmere yield of sheep and goats showed a trend of increase and then decrease [32,33]. The cashmere diameter of Inner Mongolia and Liaoning cashmere goats tended to become thicker with age [34]. Our previous research found that cashmere production reaches a maximum at 2–5 years old and cashmere length reaches a maximum at 2–3 years old. Cashmere diameter tends to increase and then decrease, and single kids have a higher production performance than double kids. This study showed almost no change in the cashmere length and diameter of the first and second combing. Cashmere yield and unit yield decreased significantly, which was nearly consistent with the previous results.
Primary and secondary hair follicles form the hair follicle groups. These are separated by dense connective tissue surrounding the septum, each consisting of several primary follicles and a number of secondary follicles located on its side. Inner Mongolia Albas cashmere goats have mainly three-hair groups, with fewer two-hair and four-hair groups; that is, where the hair follicle group is composed of three primary hair follicles and secondary hair follicles. The development of hair follicles is a complex process that begins in the embryonic stage, and primary hair follicles occur earlier than secondary hair follicles [35]. Secondary hair follicles are derived from the epidermis surrounding the primary hair follicle-not directly from the primary hair follicle-and developed secondary hair follicles enter periodic growth and apoptosis. Fozi et al. found that the number of primary hair follicles in Raieni cashmere goats did not change after birth, and the number of secondary hair follicles stopped increasing at 3 months of age [36]. Most of the primary hair follicles of cashmere goats are completed before birth; while the number of secondary hair follicles is completed by 3–6 months after birth [37]. Moreover, Yang’s study suggests that the number of secondary hair follicles fixed during young age determines the number of secondary hair follicles in adulthood [38]. The time of primary hair follicle development in this study was later than in other studies, possibly due to the rearing environment. Secondary hair follicle results were nearly consistent with those of previous studies. In our test of skin hair follicles, the hair bulb part of the primary hair follicle was large and located in the deep layer of the skin. The diameter of the hair follicle was thick, and the hair shaft medullary. The hair bulb of the secondary hair follicle was small and located in the superficial layer of the skin. The diameter of the hair follicle was small, and the hair shaft had no medulla. Although primary and secondary hair follicles have different characteristics, they have the same basic structure. Experiments have shown that hair follicles develop from hair follicle stem cells stored in the bulge near the skin’s surface [39,40]. We found that secondary hair follicles descend to the root of primary hair follicles with increasing age, indicating that the occurrence and development of secondary hair follicles in Albas cashmere goats are similar to that of other mammals.
In fur-bearing animals, their fur is of great economic value. Cashmere production is the main economic trait of cashmere goats. The development of secondary hair follicles directly affects the yield and quality of cashmere. The greater the SFD, the more fibers and the greater the yield of cashmere. Additionally, the S:P ratio was not affected by skin shrinkage during skin tests and was generally used as an index to measure the number of secondary hair follicles in cashmere goat skin. This study showed that the PFD and SFD gradually decreased and became stable after birth, and that the S:P reached its maximum between 3 to 5 months after birth [41]. In our study, secondary hair follicles’ characteristics were unchanged at 5–6 months of age and close to the middle anagen period of the following year (1.5 years old), indicating that secondary hair follicle traits at this time are almost the same in adulthood. Therefore, hair follicle traits at the age of 6 months can be an essential indicator for breed selection.
The hair follicle is the basis for the formation and development of animal hair; and it is an organ that grows periodically. The growth cycle is regulated by a variety of signaling pathways, and FGFs play essential role in hair follicle morphogenesis [42,43]. Fon, T. K. et al. reported that FGF2 and FGF21 are expressed periodically during hair follicle growth in postnatal mice [44]. FGF21 is mainly expressed in the inner and outer root sheaths of hair follicles, and its expression is correlated with the number of hair follicles [45,46]. FGF2 can promote the mitosis of dermal fibroblasts and maintain stem cells’ proliferation and differentiation ability [47]. This study found that the expression of FGF2 and FGF21 genes and proteins in goat kids was the highest at 3 months of age, and that the hair follicle growth rate was fastest at this time. We speculate that FGF2 and FGF21 may promote the development of secondary hair follicle at an early age. BMP determines bone formation at different stages of growth and development in animals and is one of the signaling molecules involved in hair follicle development [48,49]. As critical gene regulators, BMPs control the differentiation of the postnatal hair follicle and show different expression levels at various stages of hair follicle development [50]. BMP4 is expressed and plays a negative regulatory role in the development of hair follicles and feathers and is an essential factor in the maintenance of hair follicle telogen [51,52]. BMP7 is expressed in the whole hair follicle cycle, with the highest expression in the growth phase, and the expression of BMP7 stops in the stationary phase [53]. The results of this study of BMP4 and BMP7 are nearly consistent. In conclusion, the FGF and BMP genes may play an essential role in developing secondary hair follicles in goat kids.

5. Conclusions

We demonstrated for the first time the timing of the complete development of primary and secondary hair follicles in goat kids by serial histomorphological observations. The cashmere yield and unit yield of the first combing were significantly higher than those of the second combing. FGF2, 21 and BMP7 may promote the growth of secondary hair follicles. In addition, the period prior to six months of age is the window for the regulation of the development of secondary hair follicles and cashmere. The traits of the secondary hair follicle and cashmere at the age of 6 months can therefore be a basis for predicting cashmere quality in adulthood.

Author Contributions

X.D.: investigation, data curation, software, writing—original draft; L.Y. (Lingyun Yao): investigation, data curation, software; X.W.: collected the samples; S.L.: formal analysis; J.Q.: investigation; L.Y. (Lu Yang): software; L.H.: methodology, formal analysis; W.Z.: conceptualization, methodology, supervision, writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by grants from the China Agriculture Research System (CARS-39).

Institutional Review Board Statement

The study design was reviewed and approved by the Animal Care and Use Committee of the China Agricultural University (Beijing, China). (Approval No.: AW12212202-1-1).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data used to support the findings of this study have not been made available as we will be conducting further research.

Acknowledgments

We are grateful to the YiWei White Cashmere Goat Farm.

Conflicts of Interest

There are no conflicts of interest for this manuscript.

References

  1. Dai, B.; Hao, F.; Xu, T.; Zhu, B.; Ren, L.-Q.; Han, X.-Y.; Liu, D.-J. Thymosin β4 Identified by Transcriptomic Analysis from HF Anagen to Telogen Promotes Proliferation of SHF-DPCs in Albas Cashmere Goat. Int. J. Mol. Sci. 2020, 21, 2268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Gong, G.; Fan, Y.; Li, W.; Yan, X.; Yan, X.; Zhang, L.; Wang, N.; Chen, O.; Zhang, Y.; Wang, R.; et al. Identification of the key genes associated with different hair types in the Inner Mongolia cashmere goat. Animals 2022, 12, 1456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Hu, X.; Hao, F.; Li, X.; Xun, Z.; Gao, Y.; Ren, B.; Cang, M.; Liang, H.; Liu, D. Generation of VEGF knock-in cashmere goat via the CRISPR/Cas9 system. Int. J. Biol. Sci. 2021, 17, 1026–1040. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Bai, J.Y.; Jia, X.P.; Wang, Y.Q.; Pang, Y.Z. Path analysis of the main economic characters of the inner Mongolia white cashmere goats. J. Exp. Biol. Agric. Sci. 2015, 3, 269–274. [Google Scholar] [CrossRef] [Scilit]
  5. Wudubala, B.L.; Cun, F.Z.; Yu, R.L.; Yun, M.H.; Yun, D.Z. Correlation and regression analysis of body size, cashmere traits and economic traits in erlangshan cashmere goat. China Anim. Husb. Vet. Med. 2015, 42, 1245–1252. [Google Scholar]
  6. Xue, B.; Zhang, X.H.; Sun, Y.B. The effect of different nutrition level on cashmere goat cashmere production performance. Mod. J. Anim. Husb. Vet. Med. 2016, 2, 26–30. [Google Scholar]
  7. Zhou, B.F.; Xue, K.B.; Zhang, J.J.; He, M.C.; He, T.; Li, J.L.; Ma, F.M.; Zhao, X.M.; Liu, Q.; Xie, W.Z.; et al. The effect of supplementary feeding differ level of sulphur on cashmere yield of Long-dong cashmere goat. J. Anim. Sci. Vet. Med. 2013, 32, 29–30. [Google Scholar]
  8. Wei, G.; Zhang, W.D.; Zhang, Y.L.; Zheng, Y.J.; Li, F.; Wang, S.H.; Liu, J.W.; Tan, S.J.; Yan, Z.H.; Wang, L.; et al. A Single-cell transcriptome atlas of cashmere goat hair follicle morphogenesis. Genom. Proteom. Bioinf. 2021, 19, 437–451. [Google Scholar] [CrossRef] [Scilit]
  9. Jiao, Q.; Yin, R.H.; Zhao, S.J.; Wang, Z.Y.; Zhu, Y.B.; Wang, W.; Zheng, Y.Y.; Yin, X.B.; Guo, D.; Wang, S.Q. Identification and molecular analysis of a lncRNA-HOTAIR transcript from secondary hair follicle of cashmere goat reveal integrated regulatory network with the expression regulated potentially by its promoter methylation. Gene 2019, 688, 182–192. [Google Scholar] [CrossRef] [Scilit]
  10. Su, R.; Fan, Y.; Qiao, X.; Li, X.K.; Zhang, L.; Li, C.; Li, J.Q. Transcriptomic analysis reveals critical genes for the hair follicle of Inner Mongolia cashmere goat from catagen to telogen. PLoS ONE 2018, 13, e204404. [Google Scholar] [CrossRef] [Scilit]
  11. Pazzaglia, I.; Mercati, F.; Antonini, M.; Capomaccio, S.; Cappelli, K.; Dall’Aglio, C.; La Terza, A.; Mozzicafreddo, M.; Nocelli, C.; Pallotti, S.; et al. PDGFA in cashmere goat: A Motivation for the hair follicle stem cells to activate. Animals 2019, 9, 38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Kawano, M.; Komi-Kuramochi, A.; Asada, M. Comprehensive analysis of FGF and FGFR expression in skin: FGF18 is highly expressed in hair follicles and capable of inducing anagen from telogen stage hair follicles. J. Investig. Dermatol. 2005, 124, 877–885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Coffin, J.D.; Florkiewicz, R.Z.; Neumann, J. Abnormal bone growth and selective translational regulation in basic fibroblast growth factor (FGF-2) transgenic mice. Mol. Biol. Cell 1995, 6, 1861–1873. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Dong, Y.; Xie, M.; Jiang, Y.; Xiao, N.Q.; Du, X.Y.; Zhang, W.G.; Gwenola, T.K.; Wang, J.H.; Yang, S.; Liang, J. Sequencing and automated whole-genome optical mapping of the genome of a domestic goat (Capra hircus). Nat. Biotechnol. 2013, 31, 135–141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Botchkarev, V.A.; Sharov, A.A. BMP signaling in the control of skin development and hair follicle growth. Differentiation 2004, 72, 512–526. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Botchkarev, V.A. Bone morphogenetic proteins and their antagonists in skin and hair follicle biology. J. Invest. Dermatol. 2003, 120, 36–47. [Google Scholar] [CrossRef] [Scilit]
  17. Cai, B.; Zheng, Y.; Yan, J.; Wang, J.; Liu, X.; Yin, G. BMP2-mediated PTEN enhancement promotes differentiation of hair follicle stem cells by inducing autophagy. Exp. Cell Res. 2019, 385, 111647. [Google Scholar] [CrossRef] [Scilit]
  18. Esibizione, D.; Cui, C.Y.; Schlessinger, D. Candidate EDA targets revealed by expression profiling of primary keratinocytes from Tabby mutant mice. Gene 2008, 427, 42–46. [Google Scholar] [CrossRef] [Scilit]
  19. Wu, P.; Zhang, Y.; Xing, Y.; Xu, W.; Guo, H.; Deng, F.; Ma, X.; Li, Y. The balance of Bmp6 and Wnt10b regulates the telogen-anagen transition of hair follicles. Cell Commun. Signal. 2019, 17, 16. [Google Scholar] [CrossRef] [Scilit]
  20. Zhang, J.H.; Tan, X.Y.; Christopher, H.C.; Lu, Y.B.; Guo, D.Y.; Stephen, E.H.; Feng, J.Q. Dissection of promoter control modules that direct Bmp4 expression in the epithelium-derived components of hair follicles. Biochem. Biophys. Res. Commun. 2002, 293, 1412–1419. [Google Scholar] [CrossRef] [Scilit]
  21. Song, L.L.; Cui, Y.; Yu, S.J.; Liu, P.G.; Zhang, Q. Expression characteristics of bmp2, bmpr-ia and noggin in different stages of hair follicle in yak skin. Gen. Comp. Endocrinol. 2017, 260, 18–24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Lv, X.; Sun, W.; Zou, S.; Chen, L.; Mwacharo, J.M.; Wang, J. Characteristics of the BMP7 promoter in Hu sheep. Animals 2019, 9, 874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Noramly, S.; Morgan, B.A. BMPs mediate lateral inhibition at successive stages in feather tract development. Development 1998, 125, 3775–3787. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Harshuk-Shabso, S.; Dressler, H.; Niehrs, C.; Aamar, E. FGF and Wnt signaling interaction in the mesenchymal niche regulates the murine hair cycle clock. Nat. Commun. 2020, 11, 5114. [Google Scholar] [CrossRef] [Scilit]
  25. Nixon, A.J. A method for determining the activity state of hair follicles. Biotech. Histochem. 1993, 68, 316–325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Zhang, H.H.; Nan, W.X.; Wang, S.Y.; Song, X.C.; Si, H.Z.; Li, T.; Li, G.Y. Epigallocatechin-3-Gallate promotes the growth of mink hair follicles through sonic hedgehog and protein kinase B signaling pathways. Front. Pharmacol. 2018, 9, 674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Duan, C.H.; Xu, J.H.; Sun, C.; Jia, Z.H.; Zhang, W. Effects of melatonin implantation on cashmere yield, fibre characteristics, duration of cashmere growth as well as growth and reproductive performance of Inner Mongolian cashmere goats. J. Anim. Sci. Biotechnol. 2015, 6, 22. [Google Scholar] [CrossRef] [Scilit]
  28. Yang, C.H.; Duan, C.H.; Wu, Z.Y.; Li, Y.; Luan, Y.Y.; Fu, X.J.; Zhang, W. Effects of melatonin administration to cashmere goats on cashmere production and hair follicle characteristics in two consecutive cashmere growth cycles. Domest. Anim. Endocrinol. 2021, 74, 106534. [Google Scholar] [CrossRef] [Scilit]
  29. Dong, K.H.; Wen, S.H.; Zhang, K.L.; He, F.L. Analysis for the variations of undercoat weight & cashmere quality on different generation of gross bred goats. J. Shanxi Agric. Univ. 1992, 12, 43–45. [Google Scholar]
  30. Lou, Y.J. Effect of grazing and barn feeding on the productivity of Liaoning cashmere goat. Pratacultural Sci. 2008, 25, 100–102. [Google Scholar]
  31. McGregor, B.A. Influence of nutrition, fibre diameter and fibre length on the fibre curvature of cashmere. Aust. J. Exp. Agric. 2003, 43, 1199. [Google Scholar] [CrossRef] [Scilit]
  32. Ma, S. Study on growth development and cashmere wool quality change of Tibetan- sheep under grazing conditions. Chin. Qinghai J. Anim. Vet. Sci. 2016, 46, 10–12. [Google Scholar]
  33. Man, B.; Li, J.; Jiang, H. Variation of cashmere traits in Liaoning cashmere goats. China Herbiv. Sci. 2015, 35, 15–18. [Google Scholar]
  34. Liu, H.Y.; Zhang, W.; Yue, C. Effect of different years on body weight and cashmere production performance of Inner Mongolia white cashmere goats. Grass-Feed. Livest. 2007, 1, 48–50. [Google Scholar]
  35. Yanjun, Z.; Jun, Y.; Jinquan, L. Study on hair follicle structure and morphogenesis of the Inner Mongolian Arbas cashmere goat. Scentia Agric. Sin. 2007, 40, 1017–1023. [Google Scholar]
  36. Fozi, M.A. Post-Natal skin follicle development in the Raieni cashmere goat. Sheep Goat Res. J. 2012, 27, 32–36. [Google Scholar]
  37. Henderson, M.; Sabine, J.R. Secondary follicle development in Australian cashmere goats. Small Rumin Res 1991, 4, 349–363. [Google Scholar] [CrossRef] [Scilit]
  38. Yang, C.H.; Xu, J.H.; Ren, Q.C.; Duan, T.; Mo, F.; Zhang, W. Melatonin promotes secondary hair follicle development of early postnatal cashmere goat and improves cashmere quantity and quality by enhancing antioxidant capacity and suppressing apoptosis. J. Pineal Res. 2019, 67, e12569. [Google Scholar] [CrossRef] [Scilit]
  39. Zhang, Y.L.; Wang, X.; Khatib, H.; Ge, W.; Wang, S.H.; Sun, B.; Shen, W. Melatonin promotes cashmere goat (Capra hircus) secondary hair follicle growth: A view from integrated analysis of long non-coding and coding RNAs . Cell Cycle 2018, 17, 1255–1267. [Google Scholar] [CrossRef] [Scilit]
  40. Lavker, R.M.; Miller, S.; Wilson, C.; Cotsarelis, G.; Wei, Z.G.; Yang, J.S.; Sun, T.T. Hair follicle stem cells: Their location, role in hair cycle, and involvement in skin tumor formation. J. Investig. Derm. 1993, 1, 16–26. [Google Scholar] [CrossRef] [Scilit]
  41. Diener, E.; Ealey, E.H.; Legge, J.S. Phylogenetic studies on the immune response. 3. Autoradiographic studies on the lymphoid system of the Australian echidna Tachyglossus aculeatus. Immunology 1967, 13, 339–347. [Google Scholar] [PubMed]
  42. Rabata, A.; Fedr, R.; Soucek, K.; Hampl, A.; Koledova, Z. 3D Cell culture models demonstrate a role for FGF and WNT signaling in regulation of lung epithelial cell fate and morphogenesis. Front. Cell Dev. Biol. 2020, 8, 574. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Weber, E.L.; Lai, Y.C.; Lei, M.; Jiang, T.X.; Chuong, C.M. Human fetal scalp dermal papilla enriched genes and the role of R-Spondin-1 in the restoration of hair neogenesis in adult mouse cells. Cell Dev. Biol. 2020, 8, 583434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Fon Tacer, K.; Bookout, A.L.; Ding, X.; Kurosu, H.; John, G.B.; Wang, L.; Goetz, R.; Mohammadi, M.; Kuro-o, M.; Mangelsdorf, D.J.; et al. Research resource: Comprehensive expression atlas of the fibroblast growth factor system in adult mouse. Mol. Endocrinol. 2010, 24, 2050–2064. [Google Scholar] [CrossRef] [Scilit]
  45. Chapnik, N.; Genzer, Y.; Froy, O. Relationship between FGF21 and UCP1 levels under time-restricted feeding and high-fat diet. J. Nutr. Biochem. 2017, 40, 116–121. [Google Scholar] [CrossRef] [Scilit]
  46. Liu, X.; Zhang, P.; Zhang, X.; Li, X.; Bai, Y.; Ao, Y.; Hexig, B.; Guo, X.; Liu, D. FGF21 knockout mice generated using CRISPR/Cas9 reveal genetic alterations that may affect hair growth. Gene 2020, 733, 144242. [Google Scholar] [CrossRef] [Scilit]
  47. Kiso, M.; Hamazaki, T.S.; Itoh, M.; Kikuch, S.; Nakagawa, H.; Okochi, H. Synergistic effect of PDGF and FGF2 for cell proliferation and hair inductive activity in murine vibrissal dermal papilla in vitro. J. Derm. Sci. 2015, 79, 110–118. [Google Scholar] [CrossRef] [Scilit]
  48. Genander, M.; Cook, P.J.; Ramskold, D.; Keyes, B.E.; Mertz, A.F.; Sandberg, R.; Fuchs, E. BMP signaling and its pSMAD1/5 target genes differentially regulate hair follicle stem cell lineages. Cell Stem Cell 2014, 15, 619–633. [Google Scholar] [CrossRef] [Scilit]
  49. Oshimori, N.; Fuchs, E. Paracrine TGF-beta signaling counterbalances BMP-mediated repression in hair follicle stem cell activation. Cell Stem Cell 2012, 10, 63–75. [Google Scholar] [CrossRef] [Scilit]
  50. Ahn, K.; Kairo, A.; Chu, E.Y.; Wine-Lee, L.; Reddy, S.T.; Croft, N.J.; Cebra-Thomas, J.A.; Metzger, D.; Chambon, P.; Lyons, K. Epithelial BMPr1a regulates differentiation and proliferation in postnatal hair follicles and is essential for tooth development. Development 2004, 131, 2257–2268. [Google Scholar] [CrossRef] [Scilit]
  51. Yoon, J.H.; Kim, H.J.; Kim, T.H.; Kim, K.H. Corrigendum: BMP4-induced differentiation of human hair follicle neural crest stem cells into precursor melanocytes from hair follicle bulge. Ann Derm. 2020, 32, 539. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Wang, X.J.; He, J.N.; Cheng, M.; Liu, K.D.; Liu, N. Association analysis between BMP4 gene expression in the shoulder skin of fine wool sheep and the hair follicle density. Heilongjiang Anim. Sci. Vet. Med. 2016, 10, 95–98. [Google Scholar]
  53. Sun, W.; Ni, R.; Yin, J.F.; Musa, H.H.; Ding, T.; Chen, L. Genome array of hair follicle genes in lamb skin with different patterns. PLoS ONE 2013, 8, e68840. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Morphological changes of hair follicles at different time points, (A) cross section, 40× (B) longitudinal section, 40×.
Figure 1. Morphological changes of hair follicles at different time points, (A) cross section, 40× (B) longitudinal section, 40×.
Animals 13 00617 g001
Figure 2. (AD) represent the expression of BMP4, BMP7, FGF2, and FGF21 at different time points (n = 5); Data are presented as least squares means ± SEM; ** signifies a highly significant difference at p ≤ 0.01.
Figure 2. (AD) represent the expression of BMP4, BMP7, FGF2, and FGF21 at different time points (n = 5); Data are presented as least squares means ± SEM; ** signifies a highly significant difference at p ≤ 0.01.
Animals 13 00617 g002
Figure 3. Immunofluorescence for FGF21 and BMP7 in skin and hair follicle sections. Fluorescence signal DAPI (blue), FGF21 (red), BMP7 (green), Scale bar = 100 μm.
Figure 3. Immunofluorescence for FGF21 and BMP7 in skin and hair follicle sections. Fluorescence signal DAPI (blue), FGF21 (red), BMP7 (green), Scale bar = 100 μm.
Animals 13 00617 g003
Table 1. The expression of RNA in skin samples of different ages.
Table 1. The expression of RNA in skin samples of different ages.
AgeFGF2FGF21BMP4BMP7
90 days32.93 ± 7.1123.48 ± 2.6721.31 ± 3.9416.19 ± 2.18
1 years old1.50 ± 0.253.51 ± 0.236.16 ± 1.055.72 ± 3.07
6 years old1.69 ± 0.365.06 ± 2.215.21 ± 0.846.06 ± 2.68
The expression quantity is the pair value base 10.
Table 2. Primers used for expression analysis in the study.
Table 2. Primers used for expression analysis in the study.
TargetPrimers Sequences (5′-3′)Product Size (bp)
FGF2F: GCAAACCGTTACCTTGCTATGA
R: TACTGCCCAGTTCGTTTCAGTG
164
FGF21F: GTTCAAGCACTTGGGACTGTGG
R: CTGGGCATCATCCGTGTAGAG
145
BMP4F: GGATTACATGCGGGATCTTTAC
R: GAGTTTTCGCTGGTCCCTGG
171
BMP7F: GACTTCAGCCTGGACAACGA
R: TCGGTGAGGAAGTGGCTATCTT
299
GAPDHF: ATGTTTGTGATGGGCGTGAA
R: GGCGTGGACAGTGGTCATAAGT
153
GAPDH is used as control; F = forward; R = reverse.
Table 3. Live weight at different time points.
Table 3. Live weight at different time points.
AgeLive Weight
1 day3.0 a
15 days5.03 b
1 month7.97 c
2 months10.09 d
3 months11.77 d
4 months13.17 e
5 months16.12 f
6 months18.52 f
First yearling combing28.61 g
Second yearling combing28.41 g
First yearling combing occurs at 12 months of age, and second yearling combing at 24 months of age. a-g Different superscript letters in the same variable indicate statistical differences (p < 0.05).
Table 4. Cashmere performance at different time points.
Table 4. Cashmere performance at different time points.
Item3 Months6 MonthsFirst Yearling CombingSecond Yearling Combing
Diameter/μm13.40 a,b12.80 a13.65 b13.39 a,b
Length/cm2.20 a4.57 b9.09 c9.11 c
Yield/g--869.48 b695.73 a
Production
unit weight g/kg
--30.58 b24.54 a
a–c Different superscript letters in the same variable indicate statistical differences (p < 0.05).
Table 5. The hair follicle trial at different time points.
Table 5. The hair follicle trial at different time points.
AgePFD
(n/mm²)
SFD
(n/mm²)
MSFD
(n/mm²)
Ratio of MSFS:P
Day 19.97 e60.75 e30.33 e0.500 a6.10 a
Day 159.37 e57.81 d,e31.01 e0.534 a6.10 a
Month 18.52 d57.56 d,e35.71 e,d0.619 b6.87 b
Month 26.80 c55.80 d39.06 d0.700 c8.23 c
Month 35.57 c54.52 c,d44.86 c0.823 d9.80 d
Month 44.52 b53.78 c49.03 b0.911 e11.95 e
Month 54.41 b51.57 b50.41 b0.971 f11.74 e
Month 63.86 a48.68 a48.68 a1.000 f12.64 e
1.5 years4.01 a46.83 a46.83 a1.000 f11.82 e
PFD = primary hair follicle density; SFD = secondary hair follicle density; MSFD = mature secondary hair follicle density; Ratio of MSF = the ratio of the number of mature secondary follicles to the total number of secondary follicles; S:P = primary hair follicle/secondary hair follicle. a–f Different superscript letters in the same variable indicate statistical differences (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Diao, X.; Yao, L.; Wang, X.; Li, S.; Qin, J.; Yang, L.; He, L.; Zhang, W. Hair Follicle Development and Cashmere Traits in Albas Goat Kids. Animals 2023, 13, 617. https://doi.org/10.3390/ani13040617

AMA Style

Diao X, Yao L, Wang X, Li S, Qin J, Yang L, He L, Zhang W. Hair Follicle Development and Cashmere Traits in Albas Goat Kids. Animals. 2023; 13(4):617. https://doi.org/10.3390/ani13040617

Chicago/Turabian Style

Diao, Xiaogao, Lingyun Yao, Xinhui Wang, Sen Li, Jiaxin Qin, Lu Yang, Liwen He, and Wei Zhang. 2023. "Hair Follicle Development and Cashmere Traits in Albas Goat Kids" Animals 13, no. 4: 617. https://doi.org/10.3390/ani13040617

APA Style

Diao, X., Yao, L., Wang, X., Li, S., Qin, J., Yang, L., He, L., & Zhang, W. (2023). Hair Follicle Development and Cashmere Traits in Albas Goat Kids. Animals, 13(4), 617. https://doi.org/10.3390/ani13040617

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop