Hair Follicle Development and Cashmere Traits in Albas Goat Kids
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Sampling
2.2. RT-qPCR
2.3. Immunofluorescence
2.4. Statistical Analyses
3. Results
3.1. The Live Weight of Cashmere Goat at Different Phases
3.2. Cashmere Performance at Different Phases
3.3. The Development of Hair Follicles at Different Phases
3.4. Hair Follicle Traits at Different Phases
3.5. The mRNA and Protein Expression of BMP and FGF
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dai, B.; Hao, F.; Xu, T.; Zhu, B.; Ren, L.-Q.; Han, X.-Y.; Liu, D.-J. Thymosin β4 Identified by Transcriptomic Analysis from HF Anagen to Telogen Promotes Proliferation of SHF-DPCs in Albas Cashmere Goat. Int. J. Mol. Sci. 2020, 21, 2268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gong, G.; Fan, Y.; Li, W.; Yan, X.; Yan, X.; Zhang, L.; Wang, N.; Chen, O.; Zhang, Y.; Wang, R.; et al. Identification of the key genes associated with different hair types in the Inner Mongolia cashmere goat. Animals 2022, 12, 1456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, X.; Hao, F.; Li, X.; Xun, Z.; Gao, Y.; Ren, B.; Cang, M.; Liang, H.; Liu, D. Generation of VEGF knock-in cashmere goat via the CRISPR/Cas9 system. Int. J. Biol. Sci. 2021, 17, 1026–1040. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bai, J.Y.; Jia, X.P.; Wang, Y.Q.; Pang, Y.Z. Path analysis of the main economic characters of the inner Mongolia white cashmere goats. J. Exp. Biol. Agric. Sci. 2015, 3, 269–274. [Google Scholar] [CrossRef] [Scilit]
- Wudubala, B.L.; Cun, F.Z.; Yu, R.L.; Yun, M.H.; Yun, D.Z. Correlation and regression analysis of body size, cashmere traits and economic traits in erlangshan cashmere goat. China Anim. Husb. Vet. Med. 2015, 42, 1245–1252. [Google Scholar]
- Xue, B.; Zhang, X.H.; Sun, Y.B. The effect of different nutrition level on cashmere goat cashmere production performance. Mod. J. Anim. Husb. Vet. Med. 2016, 2, 26–30. [Google Scholar]
- Zhou, B.F.; Xue, K.B.; Zhang, J.J.; He, M.C.; He, T.; Li, J.L.; Ma, F.M.; Zhao, X.M.; Liu, Q.; Xie, W.Z.; et al. The effect of supplementary feeding differ level of sulphur on cashmere yield of Long-dong cashmere goat. J. Anim. Sci. Vet. Med. 2013, 32, 29–30. [Google Scholar]
- Wei, G.; Zhang, W.D.; Zhang, Y.L.; Zheng, Y.J.; Li, F.; Wang, S.H.; Liu, J.W.; Tan, S.J.; Yan, Z.H.; Wang, L.; et al. A Single-cell transcriptome atlas of cashmere goat hair follicle morphogenesis. Genom. Proteom. Bioinf. 2021, 19, 437–451. [Google Scholar] [CrossRef] [Scilit]
- Jiao, Q.; Yin, R.H.; Zhao, S.J.; Wang, Z.Y.; Zhu, Y.B.; Wang, W.; Zheng, Y.Y.; Yin, X.B.; Guo, D.; Wang, S.Q. Identification and molecular analysis of a lncRNA-HOTAIR transcript from secondary hair follicle of cashmere goat reveal integrated regulatory network with the expression regulated potentially by its promoter methylation. Gene 2019, 688, 182–192. [Google Scholar] [CrossRef] [Scilit]
- Su, R.; Fan, Y.; Qiao, X.; Li, X.K.; Zhang, L.; Li, C.; Li, J.Q. Transcriptomic analysis reveals critical genes for the hair follicle of Inner Mongolia cashmere goat from catagen to telogen. PLoS ONE 2018, 13, e204404. [Google Scholar] [CrossRef] [Scilit]
- Pazzaglia, I.; Mercati, F.; Antonini, M.; Capomaccio, S.; Cappelli, K.; Dall’Aglio, C.; La Terza, A.; Mozzicafreddo, M.; Nocelli, C.; Pallotti, S.; et al. PDGFA in cashmere goat: A Motivation for the hair follicle stem cells to activate. Animals 2019, 9, 38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawano, M.; Komi-Kuramochi, A.; Asada, M. Comprehensive analysis of FGF and FGFR expression in skin: FGF18 is highly expressed in hair follicles and capable of inducing anagen from telogen stage hair follicles. J. Investig. Dermatol. 2005, 124, 877–885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coffin, J.D.; Florkiewicz, R.Z.; Neumann, J. Abnormal bone growth and selective translational regulation in basic fibroblast growth factor (FGF-2) transgenic mice. Mol. Biol. Cell 1995, 6, 1861–1873. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, Y.; Xie, M.; Jiang, Y.; Xiao, N.Q.; Du, X.Y.; Zhang, W.G.; Gwenola, T.K.; Wang, J.H.; Yang, S.; Liang, J. Sequencing and automated whole-genome optical mapping of the genome of a domestic goat (Capra hircus). Nat. Biotechnol. 2013, 31, 135–141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Botchkarev, V.A.; Sharov, A.A. BMP signaling in the control of skin development and hair follicle growth. Differentiation 2004, 72, 512–526. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Botchkarev, V.A. Bone morphogenetic proteins and their antagonists in skin and hair follicle biology. J. Invest. Dermatol. 2003, 120, 36–47. [Google Scholar] [CrossRef] [Scilit]
- Cai, B.; Zheng, Y.; Yan, J.; Wang, J.; Liu, X.; Yin, G. BMP2-mediated PTEN enhancement promotes differentiation of hair follicle stem cells by inducing autophagy. Exp. Cell Res. 2019, 385, 111647. [Google Scholar] [CrossRef] [Scilit]
- Esibizione, D.; Cui, C.Y.; Schlessinger, D. Candidate EDA targets revealed by expression profiling of primary keratinocytes from Tabby mutant mice. Gene 2008, 427, 42–46. [Google Scholar] [CrossRef] [Scilit]
- Wu, P.; Zhang, Y.; Xing, Y.; Xu, W.; Guo, H.; Deng, F.; Ma, X.; Li, Y. The balance of Bmp6 and Wnt10b regulates the telogen-anagen transition of hair follicles. Cell Commun. Signal. 2019, 17, 16. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.H.; Tan, X.Y.; Christopher, H.C.; Lu, Y.B.; Guo, D.Y.; Stephen, E.H.; Feng, J.Q. Dissection of promoter control modules that direct Bmp4 expression in the epithelium-derived components of hair follicles. Biochem. Biophys. Res. Commun. 2002, 293, 1412–1419. [Google Scholar] [CrossRef] [Scilit]
- Song, L.L.; Cui, Y.; Yu, S.J.; Liu, P.G.; Zhang, Q. Expression characteristics of bmp2, bmpr-ia and noggin in different stages of hair follicle in yak skin. Gen. Comp. Endocrinol. 2017, 260, 18–24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lv, X.; Sun, W.; Zou, S.; Chen, L.; Mwacharo, J.M.; Wang, J. Characteristics of the BMP7 promoter in Hu sheep. Animals 2019, 9, 874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Noramly, S.; Morgan, B.A. BMPs mediate lateral inhibition at successive stages in feather tract development. Development 1998, 125, 3775–3787. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harshuk-Shabso, S.; Dressler, H.; Niehrs, C.; Aamar, E. FGF and Wnt signaling interaction in the mesenchymal niche regulates the murine hair cycle clock. Nat. Commun. 2020, 11, 5114. [Google Scholar] [CrossRef] [Scilit]
- Nixon, A.J. A method for determining the activity state of hair follicles. Biotech. Histochem. 1993, 68, 316–325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.H.; Nan, W.X.; Wang, S.Y.; Song, X.C.; Si, H.Z.; Li, T.; Li, G.Y. Epigallocatechin-3-Gallate promotes the growth of mink hair follicles through sonic hedgehog and protein kinase B signaling pathways. Front. Pharmacol. 2018, 9, 674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duan, C.H.; Xu, J.H.; Sun, C.; Jia, Z.H.; Zhang, W. Effects of melatonin implantation on cashmere yield, fibre characteristics, duration of cashmere growth as well as growth and reproductive performance of Inner Mongolian cashmere goats. J. Anim. Sci. Biotechnol. 2015, 6, 22. [Google Scholar] [CrossRef] [Scilit]
- Yang, C.H.; Duan, C.H.; Wu, Z.Y.; Li, Y.; Luan, Y.Y.; Fu, X.J.; Zhang, W. Effects of melatonin administration to cashmere goats on cashmere production and hair follicle characteristics in two consecutive cashmere growth cycles. Domest. Anim. Endocrinol. 2021, 74, 106534. [Google Scholar] [CrossRef] [Scilit]
- Dong, K.H.; Wen, S.H.; Zhang, K.L.; He, F.L. Analysis for the variations of undercoat weight & cashmere quality on different generation of gross bred goats. J. Shanxi Agric. Univ. 1992, 12, 43–45. [Google Scholar]
- Lou, Y.J. Effect of grazing and barn feeding on the productivity of Liaoning cashmere goat. Pratacultural Sci. 2008, 25, 100–102. [Google Scholar]
- McGregor, B.A. Influence of nutrition, fibre diameter and fibre length on the fibre curvature of cashmere. Aust. J. Exp. Agric. 2003, 43, 1199. [Google Scholar] [CrossRef] [Scilit]
- Ma, S. Study on growth development and cashmere wool quality change of Tibetan- sheep under grazing conditions. Chin. Qinghai J. Anim. Vet. Sci. 2016, 46, 10–12. [Google Scholar]
- Man, B.; Li, J.; Jiang, H. Variation of cashmere traits in Liaoning cashmere goats. China Herbiv. Sci. 2015, 35, 15–18. [Google Scholar]
- Liu, H.Y.; Zhang, W.; Yue, C. Effect of different years on body weight and cashmere production performance of Inner Mongolia white cashmere goats. Grass-Feed. Livest. 2007, 1, 48–50. [Google Scholar]
- Yanjun, Z.; Jun, Y.; Jinquan, L. Study on hair follicle structure and morphogenesis of the Inner Mongolian Arbas cashmere goat. Scentia Agric. Sin. 2007, 40, 1017–1023. [Google Scholar]
- Fozi, M.A. Post-Natal skin follicle development in the Raieni cashmere goat. Sheep Goat Res. J. 2012, 27, 32–36. [Google Scholar]
- Henderson, M.; Sabine, J.R. Secondary follicle development in Australian cashmere goats. Small Rumin Res 1991, 4, 349–363. [Google Scholar] [CrossRef] [Scilit]
- Yang, C.H.; Xu, J.H.; Ren, Q.C.; Duan, T.; Mo, F.; Zhang, W. Melatonin promotes secondary hair follicle development of early postnatal cashmere goat and improves cashmere quantity and quality by enhancing antioxidant capacity and suppressing apoptosis. J. Pineal Res. 2019, 67, e12569. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.L.; Wang, X.; Khatib, H.; Ge, W.; Wang, S.H.; Sun, B.; Shen, W. Melatonin promotes cashmere goat (Capra hircus) secondary hair follicle growth: A view from integrated analysis of long non-coding and coding RNAs . Cell Cycle 2018, 17, 1255–1267. [Google Scholar] [CrossRef] [Scilit]
- Lavker, R.M.; Miller, S.; Wilson, C.; Cotsarelis, G.; Wei, Z.G.; Yang, J.S.; Sun, T.T. Hair follicle stem cells: Their location, role in hair cycle, and involvement in skin tumor formation. J. Investig. Derm. 1993, 1, 16–26. [Google Scholar] [CrossRef] [Scilit]
- Diener, E.; Ealey, E.H.; Legge, J.S. Phylogenetic studies on the immune response. 3. Autoradiographic studies on the lymphoid system of the Australian echidna Tachyglossus aculeatus. Immunology 1967, 13, 339–347. [Google Scholar] [PubMed]
- Rabata, A.; Fedr, R.; Soucek, K.; Hampl, A.; Koledova, Z. 3D Cell culture models demonstrate a role for FGF and WNT signaling in regulation of lung epithelial cell fate and morphogenesis. Front. Cell Dev. Biol. 2020, 8, 574. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weber, E.L.; Lai, Y.C.; Lei, M.; Jiang, T.X.; Chuong, C.M. Human fetal scalp dermal papilla enriched genes and the role of R-Spondin-1 in the restoration of hair neogenesis in adult mouse cells. Cell Dev. Biol. 2020, 8, 583434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fon Tacer, K.; Bookout, A.L.; Ding, X.; Kurosu, H.; John, G.B.; Wang, L.; Goetz, R.; Mohammadi, M.; Kuro-o, M.; Mangelsdorf, D.J.; et al. Research resource: Comprehensive expression atlas of the fibroblast growth factor system in adult mouse. Mol. Endocrinol. 2010, 24, 2050–2064. [Google Scholar] [CrossRef] [Scilit]
- Chapnik, N.; Genzer, Y.; Froy, O. Relationship between FGF21 and UCP1 levels under time-restricted feeding and high-fat diet. J. Nutr. Biochem. 2017, 40, 116–121. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Zhang, P.; Zhang, X.; Li, X.; Bai, Y.; Ao, Y.; Hexig, B.; Guo, X.; Liu, D. FGF21 knockout mice generated using CRISPR/Cas9 reveal genetic alterations that may affect hair growth. Gene 2020, 733, 144242. [Google Scholar] [CrossRef] [Scilit]
- Kiso, M.; Hamazaki, T.S.; Itoh, M.; Kikuch, S.; Nakagawa, H.; Okochi, H. Synergistic effect of PDGF and FGF2 for cell proliferation and hair inductive activity in murine vibrissal dermal papilla in vitro. J. Derm. Sci. 2015, 79, 110–118. [Google Scholar] [CrossRef] [Scilit]
- Genander, M.; Cook, P.J.; Ramskold, D.; Keyes, B.E.; Mertz, A.F.; Sandberg, R.; Fuchs, E. BMP signaling and its pSMAD1/5 target genes differentially regulate hair follicle stem cell lineages. Cell Stem Cell 2014, 15, 619–633. [Google Scholar] [CrossRef] [Scilit]
- Oshimori, N.; Fuchs, E. Paracrine TGF-beta signaling counterbalances BMP-mediated repression in hair follicle stem cell activation. Cell Stem Cell 2012, 10, 63–75. [Google Scholar] [CrossRef] [Scilit]
- Ahn, K.; Kairo, A.; Chu, E.Y.; Wine-Lee, L.; Reddy, S.T.; Croft, N.J.; Cebra-Thomas, J.A.; Metzger, D.; Chambon, P.; Lyons, K. Epithelial BMPr1a regulates differentiation and proliferation in postnatal hair follicles and is essential for tooth development. Development 2004, 131, 2257–2268. [Google Scholar] [CrossRef] [Scilit]
- Yoon, J.H.; Kim, H.J.; Kim, T.H.; Kim, K.H. Corrigendum: BMP4-induced differentiation of human hair follicle neural crest stem cells into precursor melanocytes from hair follicle bulge. Ann Derm. 2020, 32, 539. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.J.; He, J.N.; Cheng, M.; Liu, K.D.; Liu, N. Association analysis between BMP4 gene expression in the shoulder skin of fine wool sheep and the hair follicle density. Heilongjiang Anim. Sci. Vet. Med. 2016, 10, 95–98. [Google Scholar]
- Sun, W.; Ni, R.; Yin, J.F.; Musa, H.H.; Ding, T.; Chen, L. Genome array of hair follicle genes in lamb skin with different patterns. PLoS ONE 2013, 8, e68840. [Google Scholar] [CrossRef] [Scilit]



| Age | FGF2 | FGF21 | BMP4 | BMP7 |
|---|---|---|---|---|
| 90 days | 32.93 ± 7.11 | 23.48 ± 2.67 | 21.31 ± 3.94 | 16.19 ± 2.18 |
| 1 years old | 1.50 ± 0.25 | 3.51 ± 0.23 | 6.16 ± 1.05 | 5.72 ± 3.07 |
| 6 years old | 1.69 ± 0.36 | 5.06 ± 2.21 | 5.21 ± 0.84 | 6.06 ± 2.68 |
| Target | Primers Sequences (5′-3′) | Product Size (bp) |
|---|---|---|
| FGF2 | F: GCAAACCGTTACCTTGCTATGA R: TACTGCCCAGTTCGTTTCAGTG | 164 |
| FGF21 | F: GTTCAAGCACTTGGGACTGTGG R: CTGGGCATCATCCGTGTAGAG | 145 |
| BMP4 | F: GGATTACATGCGGGATCTTTAC R: GAGTTTTCGCTGGTCCCTGG | 171 |
| BMP7 | F: GACTTCAGCCTGGACAACGA R: TCGGTGAGGAAGTGGCTATCTT | 299 |
| GAPDH | F: ATGTTTGTGATGGGCGTGAA R: GGCGTGGACAGTGGTCATAAGT | 153 |
| Age | Live Weight |
|---|---|
| 1 day | 3.0 a |
| 15 days | 5.03 b |
| 1 month | 7.97 c |
| 2 months | 10.09 d |
| 3 months | 11.77 d |
| 4 months | 13.17 e |
| 5 months | 16.12 f |
| 6 months | 18.52 f |
| First yearling combing | 28.61 g |
| Second yearling combing | 28.41 g |
| Item | 3 Months | 6 Months | First Yearling Combing | Second Yearling Combing |
|---|---|---|---|---|
| Diameter/μm | 13.40 a,b | 12.80 a | 13.65 b | 13.39 a,b |
| Length/cm | 2.20 a | 4.57 b | 9.09 c | 9.11 c |
| Yield/g | - | - | 869.48 b | 695.73 a |
| Production unit weight g/kg | - | - | 30.58 b | 24.54 a |
| Age | PFD (n/mm²) | SFD (n/mm²) | MSFD (n/mm²) | Ratio of MSF | S:P |
|---|---|---|---|---|---|
| Day 1 | 9.97 e | 60.75 e | 30.33 e | 0.500 a | 6.10 a |
| Day 15 | 9.37 e | 57.81 d,e | 31.01 e | 0.534 a | 6.10 a |
| Month 1 | 8.52 d | 57.56 d,e | 35.71 e,d | 0.619 b | 6.87 b |
| Month 2 | 6.80 c | 55.80 d | 39.06 d | 0.700 c | 8.23 c |
| Month 3 | 5.57 c | 54.52 c,d | 44.86 c | 0.823 d | 9.80 d |
| Month 4 | 4.52 b | 53.78 c | 49.03 b | 0.911 e | 11.95 e |
| Month 5 | 4.41 b | 51.57 b | 50.41 b | 0.971 f | 11.74 e |
| Month 6 | 3.86 a | 48.68 a | 48.68 a | 1.000 f | 12.64 e |
| 1.5 years | 4.01 a | 46.83 a | 46.83 a | 1.000 f | 11.82 e |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Diao, X.; Yao, L.; Wang, X.; Li, S.; Qin, J.; Yang, L.; He, L.; Zhang, W. Hair Follicle Development and Cashmere Traits in Albas Goat Kids. Animals 2023, 13, 617. https://doi.org/10.3390/ani13040617
Diao X, Yao L, Wang X, Li S, Qin J, Yang L, He L, Zhang W. Hair Follicle Development and Cashmere Traits in Albas Goat Kids. Animals. 2023; 13(4):617. https://doi.org/10.3390/ani13040617
Chicago/Turabian StyleDiao, Xiaogao, Lingyun Yao, Xinhui Wang, Sen Li, Jiaxin Qin, Lu Yang, Liwen He, and Wei Zhang. 2023. "Hair Follicle Development and Cashmere Traits in Albas Goat Kids" Animals 13, no. 4: 617. https://doi.org/10.3390/ani13040617
APA StyleDiao, X., Yao, L., Wang, X., Li, S., Qin, J., Yang, L., He, L., & Zhang, W. (2023). Hair Follicle Development and Cashmere Traits in Albas Goat Kids. Animals, 13(4), 617. https://doi.org/10.3390/ani13040617

