Study of Transcriptomic Analysis of Yak (Bos grunniens) and Cattle (Bos taurus) Pulmonary Artery Smooth Muscle Cells under Oxygen Concentration Gradients and Differences in Their Lung Histology and Expression of Pyruvate Dehydrogenase Kinase 1-Related Factors
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Ethics
2.2. Sample Collection
2.3. RNA Extraction
2.4. Library Construction and Sequencing
2.5. Identification of Differentially Expressed Genes
2.6. Transcriptome Sequencing Data Processing and Bioinformatics Analysis
2.6.1. GO Enrichment Analysis of Differentially Expressed Genes
2.6.2. KEGG Enrichment Analysis of Differentially Expressed Genes
2.7. Lung Tissue Sample Processing, Staining, and Testing
2.7.1. Preparation of Lung Tissue Sections
2.7.2. H&E Staining
2.7.3. Masson Staining
2.7.4. PAS Staining
2.7.5. Immunohistochemistry
2.8. RT-qPCR Assay
2.8.1. Synthesis of Gene Primers
2.8.2. Reverse Transcription
2.9. Western Blot Assay
2.9.1. Protein Sample Preparation
2.9.2. Western Blot Analysis
2.10. Statistical Analysis
3. Results
3.1. Gene Expression Distribution
3.2. Inter-Sample Correlation
3.3. Principal Component Analysis
3.4. Transcriptome Differential Gene Analysis
3.5. Enrichment Analysis
3.5.1. GO Function Enrichment Analysis
3.5.2. KEGG Pathway Enrichment Analysis
3.6. Results of H&E Staining
3.7. Results of Masson Staining
3.8. Results of PAS Staining
3.9. Results of Immunohistochemical Staining and Optical Density Analysis
3.10. PDK1 and Its Related Factors’ mRNA Expression in Adult Cattle and Yak Lungs
3.11. Protein Expression of PDK1 and Related Factors in the Lungs of Adult Yaks and Cattle
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chen, S.Y.; Li, C.; Luo, Z.; Li, X.; Jia, X.; Lai, S.J. Favoring Expression of Yak Alleles in Interspecies F1 Hybrids of Cattle and Yak Under High-Altitude Environments. Front. Vet. Sci. 2022, 9, 892663. [Google Scholar] [CrossRef] [PubMed]
- Honda, T.; Hirakawa, Y.; Nangaku, M. The role of oxidative stress and hypoxia in renal disease. Kidney Res. Clin. Pract. 2019, 38, 414–426. [Google Scholar] [CrossRef] [PubMed]
- Qi, X.; Zhang, Q.; He, Y.; Yang, L.; Zhang, X.; Shi, P.; Yang, L.; Liu, Z.; Zhang, F.; Liu, F.; et al. The Transcriptomic Landscape of Yaks Reveals Molecular Pathways for High Altitude Adaptation. Genome Biol. Evol. 2019, 11, 72–85. [Google Scholar] [CrossRef]
- Lan, D.; Xiong, X.; Ji, W.; Li, J.; Mipam, T.D.; Ai, Y.; Chai, Z. Transcriptome profile and unique genetic evolution of positively selected genes in yak lungs. Genetica 2018, 146, 151–160. [Google Scholar] [CrossRef] [PubMed]
- Xin, J.W.; Chai, Z.X.; Zhang, C.F.; Zhang, Q.; Zhu, Y.; Cao, H.W.; Yangji, C.; Chen, X.Y.; Jiang, H.; Zhong, J.C.; et al. Differences in proteomic profiles between yak and three cattle strains provide insights into molecular mechanisms underlying high-altitude adaptation. J. Anim. Physiol. Anim. Nutr. 2022, 106, 485–493. [Google Scholar] [CrossRef]
- Gao, X.; Wang, S.; Wang, Y.F.; Li, S.; Wu, S.X.; Yan, R.G.; Zhang, Y.W.; Wan, R.D.; He, Z.; Song, R.D.; et al. Long read genome assemblies complemented by single cell RNA-sequencing reveal genetic and cellular mechanisms underlying the adaptive evolution of yak. Nat. Commun. 2022, 13, 4887. [Google Scholar] [CrossRef] [PubMed]
- Tucker, A.; McMurtry, I.F.; Reeves, J.T.; Alexander, A.F.; Will, D.H.; Grover, R.F. Lung vascular smooth muscle as a determinant of pulmonary hypertension at high altitude. Am. J. Physiol. 1975, 228, 762–767. [Google Scholar] [CrossRef]
- Buravkova, L.B.; Andreeva, E.R.; Gogvadze, V.; Zhivotovsky, B. Mesenchymal stem cells and hypoxia: Where are we? Mitochondrion 2014, 19 Pt A, 105–112. [Google Scholar] [CrossRef]
- Lavrentieva, A.; Majore, I.; Kasper, C.; Hass, R. Effects of hypoxic culture conditions on umbilical cord-derived human mesenchymal stem cells. Cell Commun. Signal. 2010, 8, 18. [Google Scholar] [CrossRef]
- Tan, X.; Feng, L.; Huang, X.; Yang, Y.; Yang, C.; Gao, Y. Histone deacetylase inhibitors promote eNOS expression in vascular smooth muscle cells and suppress hypoxia-induced cell growth. J. Cell. Mol. Med. 2017, 21, 2022–2035. [Google Scholar] [CrossRef]
- Stenmark, K.R.; Fagan, K.A.; Frid, M.G. Hypoxia-induced pulmonary vascular remodeling: Cellular and molecular mechanisms. Circ. Res. 2006, 99, 675–691. [Google Scholar] [CrossRef] [PubMed]
- Thompson, A.A.R.; Lawrie, A. Targeting Vascular Remodeling to Treat Pulmonary Arterial Hypertension. Trends Mol. Med. 2017, 23, 31–45. [Google Scholar] [CrossRef] [PubMed]
- Huetsch, J.C.; Suresh, K.; Shimoda, L.A. Regulation of Smooth Muscle Cell Proliferation by NADPH Oxidases in Pulmonary Hypertension. Antioxidants 2019, 8, 56. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Song, S.; Liu, J.; Zhang, L.; Guo, X.; Lu, J.; Li, L.; Yang, C.; Fu, Q.; Zeng, B. Epigenetic regulation of programmed cell death in hypoxia-induced pulmonary arterial hypertension. Front. Immunol. 2023, 14, 1206452. [Google Scholar] [CrossRef]
- He, Y.; Yu, S.; Hu, J.; Cui, Y.; Liu, P. Changes in the Anatomic and Microscopic Structure and the Expression of HIF-1α and VEGF of the Yak Heart with Aging and Hypoxia. PLoS ONE 2016, 11, e0149947. [Google Scholar] [CrossRef]
- Ishizaki, T.; Mizuno, S.; Sakai, A.; Matsukawa, S.; Kojonazarov, B.; Zamirbek, B.; Umeda, Y.; Morikawa, M.; Anzai, M.; Ishizuka, T.; et al. Blunted activation of Rho-kinase in yak pulmonary circulation. BioMed Res. Int. 2015, 2015, 720250. [Google Scholar] [CrossRef] [PubMed]
- Dai, J.; Zhou, Q.; Chen, J.; Rexius-Hall, M.L.; Rehman, J.; Zhou, G. Alpha-enolase regulates the malignant phenotype of pulmonary artery smooth muscle cells via the AMPK-Akt pathway. Nat. Commun. 2018, 9, 3850. [Google Scholar] [CrossRef] [PubMed]
- Luna-López, R.; Ruiz Martín, A.; Escribano Subías, P. Pulmonary arterial hypertension. Hipertensión arterial pulmonar. Med. Clin. 2022, 158, 622–629. [Google Scholar] [CrossRef] [PubMed]
- Durmowicz, A.G.; Hofmeister, S.; Kadyraliev, T.K.; Aldashev, A.A.; Stenmark, K.R. Functional and structural adap-tation of the yak pulmonary circulation to residence at high altitude. J. Appl. Physiol. 1993, 74, 2276–2285. [Google Scholar] [CrossRef]
- Chen, Q.; Feng, X.; Jiang, S. Structural study on Plateau adaptability of yak lung. Sci. Agric. Sin. 2006, 39, 2107–2113. [Google Scholar]
- Wei, Q.; Yu, H.X.; Zhang, Q.W.; Li, L.; Jin, H.X.; Niu, H.L.; Xue, Q.; Liang, L. Observation and comparison of alveolar tissue structure of highland yak. Heilongjiang Anim. Husb. Vet. Med. 2011, 9, 47–49. (In Chinese) [Google Scholar]
- Meban, C. Thickness of the air–blood barriers in vertebrate lungs. J. Anat. 1980, 131, 299–307. [Google Scholar] [PubMed]
- Zhou, J.X.; Yu, S.J.; He, J.F.; Cui, Y. Comparative structural organization and morphological analyses of intrapulmonary artery of adult yak and cattle. Chin. J. Vet. Med. Sci. 2015, 35, 1840–1844+1862. (In Chinese) [Google Scholar]
- Chen, Y.X.; Cui, Y. Animal Anatomy, Histology and Embryology; China Agriculture Press: Beijing, China, 2019; pp. 296–297. [Google Scholar]
- Xin, J.W.; Chai, Z.X.; Zhang, C.F.; Zhang, Q.; Zhu, Y.; Cao, H.W.; Ji, Q.M.; Zhong, J.C. Transcriptome profiles revealed the mechanisms underlying the adaptation of yak to high-altitude environments. Sci. Rep. 2019, 9, 7558. [Google Scholar] [CrossRef]
- Qiu, Q.; Zhang, G.; Ma, T.; Qian, W.; Wang, J.; Ye, Z.; Cao, C.; Hu, Q.; Kim, J.; Larkin, D.M.; et al. The yak genome and adaptation to life at high altitude. Nat. Genet. 2012, 44, 946–949. [Google Scholar] [CrossRef]
- Guo, S.; Cao, M.; Wang, X.; Xiong, L.; Wu, X.; Bao, P.; Chu, M.; Liang, C.; Yan, P.; Pei, J.; et al. Changes in Transcriptomic Profiles in Different Reproductive Periods in Yaks. Biology 2021, 10, 1229. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Luo, Y.; Xu, J.; Sun, Y.; Ma, Z.; Chen, S. Effects of oxygen concentrations on developmental competence and transcriptomic profile of yak oocytes. Zygote 2020, 28, 459–469. [Google Scholar] [CrossRef] [PubMed]
- Huo, S.; Chen, Z.; Li, S.; Wang, J.; Ma, J.; Yang, Y.; Zhaxi, Y.; Zhao, Y.; Zhang, D.; Long, R. A comparative transcriptome and proteomics study of post-partum ovarian cycle arrest in yaks (Bos grunniens). Reprod. Domest. Anim. 2021, 57, 292–303. [Google Scholar] [CrossRef] [PubMed]
- Xiong, L.; Pei, J.; Wu, X.; Kalwar, Q.; Yan, P.; Guo, X. Effect of Gender to Fat Deposition in Yaks Based on Transcriptomic and Metabolomics Analysis. Front. Cell Dev. Biol. 2021, 9, 653188. [Google Scholar] [CrossRef]
- Zhang, L.; Zhang, Y.; Zhou, J.; Yao, Y.; Li, R.; Zhou, M.; Chen, S.; Qiao, Z.; Yang, K. Combined transcriptome and proteome analysis of yak PASMCs under hypoxic and normoxic conditions. PeerJ 2022, 10, e14369. [Google Scholar] [CrossRef] [PubMed]
- Ge, Q.; Guo, Y.; Zheng, W.; Cai, Y.; Qi, X.; Zhao, S. A comparative analysis of differentially expressed mRNAs, miRNAs and circRNAs provides insights into the key genes involved in the high-altitude adaptation of yaks. BMC Genom. 2021, 22, 744. [Google Scholar] [CrossRef] [PubMed]
- Guan, J.; Long, K.; Ma, J.; Zhang, J.; He, D.; Jin, L.; Tang, Q.; Jiang, A.; Wang, X.; Hu, Y.; et al. Comparative analysis of the microRNA transcriptome between yak and cattle provides insight into high-altitude adaptation. PeerJ 2017, 5, e3959. [Google Scholar] [CrossRef]
- Ge, Q.; Guo, Y.; Zheng, W.; Zhao, S.; Cai, Y.; Qi, X. Molecular mechanisms detected in yak lung tissue via transcriptome-wide analysis provide insights into adaptation to high altitudes. Sci. Rep. 2021, 11, 7786. [Google Scholar] [CrossRef]
- Wang, J.; Guan, J.; Yixi, K.; Shu, T.; Chai, Z.; Wang, J.; Wang, H.; Wu, Z.; Cai, X.; Zhong, J.; et al. Comparative transcriptome analysis of winter yaks in plateau and plain. Reprod. Domest. Anim. 2022, 57, 64–71. [Google Scholar] [CrossRef] [PubMed]
- Bristow, R.G.; Hill, R.P. Hypoxia and metabolism. Hypoxia, DNA repair and genetic instability. Nat. Rev. Cancer 2008, 8, 180–192. [Google Scholar] [CrossRef] [PubMed]
- Estrada, J.C.; Albo, C.; Benguría, A.; Dopazo, A.; López-Romero, P.; Carrera-Quintanar, L.; Roche, E.; Clemente, E.P.; Enríquez, J.A.; Bernad, A.; et al. Culture of human mesenchymal stem cells at low oxygen tension improves growth and genetic stability by activating glycolysis. Cell Death Differ. 2012, 19, 743–755. [Google Scholar] [CrossRef]
- Bétous, R.; Renoud, M.L.; Hoede, C.; Gonzalez, I.; Jones, N.; Longy, M.; Sensebé, L.; Cazaux, C.; Hoffmann, J.S. Human Adipose-Derived Stem Cells Expanded Under Ambient Oxygen Concentration Accumulate Oxidative DNA Lesions and Experience Procarcinogenic DNA Replication Stress. Stem Cells Transl. Med. 2017, 6, 68–76. [Google Scholar] [CrossRef]
- Ikeda, S.; Abe, F.; Matsuda, Y.; Kitadate, A.; Takahashi, N.; Tagawa, H. Hypoxia-inducible hexokinase-2 enhances anti-apoptotic function via activating autophagy in multiple myeloma. Cancer Sci. 2020, 111, 4088–4101. [Google Scholar] [CrossRef]
- Park, H.S.; Kim, J.H.; Sun, B.K.; Song, S.U.; Suh, W.; Sung, J.H. Hypoxia induces glucose uptake and metabolism of adipose-derived stem cells. Mol. Med. Rep. 2016, 14, 4706–4714. [Google Scholar] [CrossRef] [PubMed]
- Li, F.X.; Zhang, Y.S.; Yao, C.L. Characterization and role of PGK from Litopenaeus vannamei in WSSV infection. Fish Shellfish Immun. 2019, 93, 144–152. [Google Scholar] [CrossRef]
- Muller, F.L.; Colla, S.; Aquilanti, E.; Manzo, V.E.; Genovese, G.; Lee, J.; Eisenson, D.; Narurkar, R.; Deng, P.; Nezi, L.; et al. Passenger deletions generate therapeutic vulnerabilities in cancer. Nature 2012, 488, 337–342. [Google Scholar] [CrossRef] [PubMed]
- Lay, A.J.; Jiang, X.M.; Kisker, O.; Flynn, E.; Underwood, A.; Condron, R.; Hogg, P.J. Phosphoglycerate kinase acts in tumour angiogenesis as a disulphide reductase. Nature 2000, 408, 869–873. [Google Scholar] [CrossRef] [PubMed]
- Willson, J.A.; Arienti, S.; Sadiku, P.; Reyes, L.; Coelho, P.; Morrison, T.; Rinaldi, G.; Dockrell, D.H.; Whyte, M.K.B.; Walmsley, S.R. Neutrophil HIF-1α stabilization is augmented by mitochondrial ROS produced via the glycerol 3-phosphate shuttle. Blood 2022, 139, 281–286. [Google Scholar] [CrossRef] [PubMed]
- Duncan, L.; Shay, C.; Teng, Y. PGK1: An Essential Player in Modulating Tumor Metabolism. Methods Mol. Biol. 2022, 2343, 57–70. [Google Scholar] [CrossRef] [PubMed]
- Chang, Y.C.; Yang, Y.C.; Tien, C.P.; Yang, C.J.; Hsiao, M. Roles of Aldolase Family Genes in Human Cancers and Diseases. Trends Endocrin. Met. 2018, 29, 549–559. [Google Scholar] [CrossRef] [PubMed]
- Thelin, E.P.; Just, D.; Frostell, A.; Häggmark-Månberg, A.; Risling, M.; Svensson, M.; Nilsson, P.; Bellander, B.M. Protein profiling in serum after traumatic brain injury in rats reveals potential injury markers. Behav. Brain Res. 2018, 340, 71–80. [Google Scholar] [CrossRef] [PubMed]
- Chang, Y.C.; Tsai, H.F.; Huang, S.P.; Chen, C.L.; Hsiao, M.; Tsai, W.C. Enrichment of Aldolase C Correlates with Low Non-Mutated IDH1 Expression and Predicts a Favorable Prognosis in Glioblastomas. Cancers 2019, 11, 1238. [Google Scholar] [CrossRef] [PubMed]
- Rai, Y.; Watanabe, T.; Matsuyama, K.; Sakimura, K.; Uesaka, N.; Kano, M. Phospholipase C β3 is Required for Climbing Fiber Synapse Elimination in Aldolase C-positive Compartments of the Developing Mouse Cerebellum. Neuroscience 2021, 462, 36–43. [Google Scholar] [CrossRef]
- Jarrar, Y.; Zihlif, M.; Al Bawab, A.Q.; Sharab, A. Effects of Intermittent Hypoxia on Expression of Glucose Metabolism Genes in MCF7 Breast Cancer Cell Line. Curr. Cancer Drug Targets. 2020, 20, 216–222. [Google Scholar] [CrossRef]
- Wan, R.; Zhao, Z.; Zhao, M.; Hu, K.; Zhai, J.; Yu, H.; Wei, Q. Characteristics of pulmonary microvascular structure in postnatal yaks. Sci. Rep. 2021, 11, 18265. [Google Scholar] [CrossRef]
- He, J.; Wei, Y.; Cui, Y.; Zhang, Q. Distribution and Expression of Pulmonary Ionocyte-Related Factors CFTR, ATP6V0D2, and ATP6V1C2 in the Lungs of Yaks at Different Ages. Genes 2023, 14, 597. [Google Scholar] [CrossRef] [PubMed]
- Krogh, A. On the Mechanism of the Gas-Exchange in the Lungs of the Tortoise 1. Acta Physiol. 2012, 23, 248–278. [Google Scholar] [CrossRef]
- Voigtsberger, S.; Lachmann, R.A.; Leutert, A.C.; Schläpfer, M.; Booy, C.; Reyes, L.; Urner, M.; Schild, J.; Schimmer, R.C.; Beck-Schimmer, B. Sevoflurane ameliorates gas exchange and attenuates lung damage in experimental lipopolysaccharide-induced lung injury. Anesthesiology 2009, 111, 1238–1248. [Google Scholar] [CrossRef]
- Zhao, P.; Li, S.; He, Z.; Zhao, F.; Wang, J.; Liu, X.; Li, M.; Hu, J.; Zhao, Z.; Luo, Y. Physiology and Proteomic Basis of Lung Adaptation to High-Altitude Hypoxia in Tibetan Sheep. Animals 2022, 12, 2134. [Google Scholar] [CrossRef]
- Zhao, P.; Zhao, F.; Hu, J.; Wang, J.; Liu, X.; Zhao, Z.; Xi, Q.; Sun, H.; Li, S.; Luo, Y. Physiology and Transcriptomics Analysis Reveal the Contribution of Lungs on High-Altitude Hypoxia Adaptation in Tibetan Sheep. Front. Physiol. 2022, 13, 885444. [Google Scholar] [CrossRef] [PubMed]
- Anand, I.; Heath, D.; Williams, D.; Deen, M.; Ferrari, R.; Bergel, D.; Harris, P. The pulmonary circulation of some domestic animals at high altitude. Int. J. Biometeorol. 1988, 32, 56–64. [Google Scholar] [CrossRef]
- Mataloun, M.M.; Leone, C.R.; Mascaretti, R.S.; Dohlnikoff, M.; Rebello, C.M. Effect of postnatal malnutrition on hyperoxia-induced newborn lung development. Braz. J. Med. Biol. Res. 2009, 42, 606–613. [Google Scholar] [CrossRef]
- Hu, J.-W.; Cui, Y.; Yu, S.J. Histological characteristics of coronary artery of yak in different ages. Chin. Vet. Sci. 2010, 40, 631–635. [Google Scholar]
- Jandl, K.; Mutgan, A.C.; Eller, K.; Schaefer, L.; Kwapiszewska, G. The basement membrane in the cross-roads between the lung and kidney. Matrix Biol. 2021, 105, 31–52. [Google Scholar] [CrossRef] [PubMed]
- Lee, P.; Chandel, N.S.; Simon, M.C. Cellular adaptation to hypoxia through hypoxia inducible factors and beyond. Nat. Rev. Mol. Cell Biol. 2020, 21, 268–283. [Google Scholar] [CrossRef] [PubMed]
- Seong, H.A.; Jung, H.; Choi, H.S.; Kim, K.T.; Ha, H. Regulation of transforming growth factor-beta signaling and PDK1 kinase activity by physical interaction between PDK1 and serine-threonine kinase receptor-associated protein. J. Biol. Chem. 2005, 280, 42897–42908. [Google Scholar] [CrossRef]
- He, Y.; Munday, J.S.; Perrott, M.; Wang, G.; Liu, X. Association of Age with the Expression of Hypoxia-Inducible Factors HIF-1α, HIF-2α, HIF-3α and VEGF in Lung and Heart of Tibetan Sheep. Animals 2019, 9, 673. [Google Scholar] [CrossRef]
- Boussat, S.; Eddahibi, S.; Coste, A.; Fataccioli, V.; Gouge, M.; Housset, B.; Adnot, S.; Maitre, B. Expression and regulation of vascular endothelial growth factor in human pulmonary epithelial cells. Am. J. Physiol. Lung Cell Mol. Physiol. 2000, 279, L371–L378. [Google Scholar] [CrossRef]
- Deng, H.; Tian, X.; Sun, H.; Liu, H.; Lu, M.; Wang, H. Calpain-1 mediates vascular remodelling and fibrosis via HIF-1α in hypoxia-induced pulmonary hypertension. J. Cell. Mol. Med. 2022, 26, 2819–2830. [Google Scholar] [CrossRef]
- Chen, X.; Yao, J.M.; Fang, X.; Zhang, C.; Yang, Y.S.; Hu, C.P.; Chen, Q.; Zhong, G.W. Hypoxia promotes pulmonary vascular remodeling via HIF-1α to regulate mitochondrial dynamics. J. Geriatr. Cardiol. 2019, 16, 855–871. [Google Scholar] [CrossRef] [PubMed]
- Min, Y.; Ghose, S.; Boelte, K.; Li, J.; Yang, L.; Lin, P.C. C/EBP-δ regulates VEGF-C autocrine signaling in lymphangiogenesis and metastasis of lung cancer through HIF-1α. Oncogene 2011, 30, 4901–4909. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Tian, Y.; Zhao, P.; Jin, F.; Miao, Y.; Liu, Y.; Li, J. Electroacupuncture attenuates pulmonary vascular remodeling in a rat model of chronic obstructive pulmonary disease via the VEGF/PI3K/Akt pathway. Acupunct. Med. 2022, 40, 389–400. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Wang, W.; Wang, L.; Chen, S.; Tian, B.; Huang, K.; Corrigan, C.J.; Ying, S.; Wang, W.; Wang, C. IL-33 Initiates Vascular Remodelling in Hypoxic Pulmonary Hypertension by up-Regulating HIF-1α and VEGF Expression in Vascular Endothelial Cells. EBioMedicine 2018, 33, 196–210. [Google Scholar] [CrossRef]
- Jia, Z.; Wang, S.; Yan, H.; Cao, Y.; Zhang, X.; Wang, L.; Zhang, Z.; Lin, S.; Wang, X.; Mao, J. Pulmonary Vascular Remodeling in Pulmonary Hypertension. J. Pers. Med. 2023, 13, 366. [Google Scholar] [CrossRef]
- Li, J.; Meng, X.; Wang, L.; Yu, Y.; Yu, H.; Wei, Q. Changes in the expression levels of elastic fibres in yak lungs at different growth stages. BMC Dev. Biol. 2021, 21, 9. [Google Scholar] [CrossRef]
- Zhou, J.; Yu, S.; He, J.; Cui, Y. Segmentation features and structural organization of the intrapulmonary artery of the yak. Anat. Rec. Adv. Integr. Anat. Evolut. Biol. 2013, 296, 1775–1788. [Google Scholar] [CrossRef] [PubMed]
Primer | Primer Sequence(5′~3′) | Fragment Size/bp |
---|---|---|
HK2 | F: GAGTTGGCAGGATGATTG | 190 |
R: AGAAAGACGCATGTGGTA | ||
PGK1 | F: GCTGACAAGAATGGCGTGAA | 182 |
R: TGCTTAGCCCGAGCAACA | ||
ALDOA | F: CACCAATACCCAGCACTCAC | 181 |
R: GCAGTTGGCGGTAGAAGC | ||
ALDH1A3 | F: TGGAGTATGCCAAGAAGCG | 251 |
R: TGGTTGCACTGGTCCAAAA | ||
EHHADH | F: TCCTCTGTTGGCGTTCTC | 137 |
R: ATGGAGGTTATTATCTTGCTTG | ||
PDK1 | F: AGTATGGCTCAAAGCTGCCC | 106 |
R: ACAACTTAAGTCTCGCGGCA | ||
HIF-1α | F: GGCGCGAACGACAAGAAAAA | 121 |
R: GTGGCAACTGATGAGCAAGC | ||
VEGF | F: CTGCTGTGGACTTGAGTTGGG | 107 |
R: GCTGCCGTAAGAGGGATAAAA | ||
β-actin (ACTB) | F: TCATCACCATCGGCAATGAG | 157 |
R: AGCACCGTGTTGGCGTAGAG |
Artery Type | Vascular Diameter Size (mm) |
---|---|
Elastic artery | about 150 |
Muscular artery | 1–20 |
Small artery | 0.3–1 |
Pulmonary arterioles | 0.03–0.3 |
Bronchioles of All Levels | Accompanying Pulmonary Artery Diameter in Cattle (mm) | Accompanying Pulmonary Artery Diameter in Yaks (mm) |
---|---|---|
Bronchiole | 0.1691 | 0.1905 |
Terminal bronchiole | 0.0338 | 0.0432 |
Terminal bronchiole | 0.1291 | 0.1939 |
Respiratory bronchioles | 0.0321 | 0.0728 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Zhou, M.; Liang, Y.; Li, R.; Zhang, L.; Chen, S.; Yang, K.; Ding, H.; Tan, X.; Zhang, Q.; et al. Study of Transcriptomic Analysis of Yak (Bos grunniens) and Cattle (Bos taurus) Pulmonary Artery Smooth Muscle Cells under Oxygen Concentration Gradients and Differences in Their Lung Histology and Expression of Pyruvate Dehydrogenase Kinase 1-Related Factors. Animals 2023, 13, 3450. https://doi.org/10.3390/ani13223450
Zhang Y, Zhou M, Liang Y, Li R, Zhang L, Chen S, Yang K, Ding H, Tan X, Zhang Q, et al. Study of Transcriptomic Analysis of Yak (Bos grunniens) and Cattle (Bos taurus) Pulmonary Artery Smooth Muscle Cells under Oxygen Concentration Gradients and Differences in Their Lung Histology and Expression of Pyruvate Dehydrogenase Kinase 1-Related Factors. Animals. 2023; 13(22):3450. https://doi.org/10.3390/ani13223450
Chicago/Turabian StyleZhang, Yiyang, Manlin Zhou, Yuxin Liang, Rui Li, Lan Zhang, Shuwu Chen, Kun Yang, Haie Ding, Xiao Tan, Qian Zhang, and et al. 2023. "Study of Transcriptomic Analysis of Yak (Bos grunniens) and Cattle (Bos taurus) Pulmonary Artery Smooth Muscle Cells under Oxygen Concentration Gradients and Differences in Their Lung Histology and Expression of Pyruvate Dehydrogenase Kinase 1-Related Factors" Animals 13, no. 22: 3450. https://doi.org/10.3390/ani13223450