Comparative Analysis of the Potential for Germ Cell (GC) Differentiation of Bovine Peripheral Blood Derived-Mesenchymal Stem Cells (PB-MSC) and Spermatogonial Stem Cells (SSC) in Co-Culture System with Sertoli Cells (SC)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics
2.2. Experimental Design
2.3. Isolation, Purification, and Characterization of Bull PB-MSC
2.4. Isolation, Purification, and Characterization of Bull SC
2.5. Isolation, Purification, and Characterization of Bull SSC
2.6. Co-Culture of PB-MSC or SSC with SC in 3D SACS
2.7. Q-PCR Analysis
2.8. Immunofluorescence Analysis
2.9. Statistical Analysis
3. Results
3.1. Morphology of Bull PB-MSC, SC and SSC
3.2. Morphology of PB-MSC or SSC Co-Cultured with SC in SACS 3D for 21 Days
3.3. Expression of MSC, SC and SSC Markers in Single Cultures
3.4. Expression of Pluripotency Markers in PB-MSC or SSC Co-Cultured with SC for 21 Days in 3D SACS
3.5. Expression of GC Markers in PB-MSC or SSC Co-Cultured with SC for 21 Days in 3D SACS
3.6. Gene Expression of MSC Markers in PB-MSC Co-Cultured with SC in 3D SACS for 21 Days
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wei, X.; Peng, G.; Zheng, S.; Wu, X. Differentiation of umbilical cord mesenchymal stem cells into steroidogenic cells in comparison to bone marrow mesenchymal stem cells. Cell Prolif. 2012, 45, 101–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dominici, M.L.B.K.; Le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.C.; Krause, D.S.; Horwitz, E.M. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006, 8, 315–317. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, S.; Huang, K.J.; Wu, J.C.; Hu, M.S.; Sanyal, M.; Hu, M.; Logaker, H.; Lorenz, H.P. Peripheral blood-derived mesenchymal stem cells: Candidate cells responsible for healing critical-sized calvarial bone defects. Stem Cells Transl. Med. 2015, 4, 359–368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dueñas, F.; Becerra, V.; Cortes, Y.; Vidal, S.; Sáenz, L.; Palomino, J.; Peralta, O.A. Hepatogenic and neurogenic differentiation of bone marrow mesenchymal stem cells from abattoir-derived bovine fetuses. BMC Vet. Res. 2014, 10, 154. [Google Scholar] [CrossRef] [Scilit]
- Kohyama, J.; Abe, H.; Shimazaki, T.; Koizumi, A.; Okano, H.; Hata, J.; Gojo, S. Brain from bone: Efficient “meta-differentiation” of marrow stroma-derived mature osteoblasts to neurons with Noggin or a demethylating agent. Differentiation 2001, 68, 235–244. [Google Scholar] [CrossRef] [Scilit]
- Oliveira, É.M.D. Diferenciação de Células-Tronco em Hepatócitos e Desenvolvimento de Modelo Pré-Clínico de Fibrose Hepática para Ensaios de Terapia Celular. Ph.D. Thesis, Universidade de São Paulo, Sao Paulo, Brazil, 2013. [Google Scholar] [CrossRef] [Scilit]
- Calle, A.; Gutiérrez-Reinoso, M.Á.; Re, M.; Blanco, J.; De La Fuente, J.; Monguió-Tortajada, M.; Ramírez, M.Á. Bovine peripheral blood MSC chemotax towards inflammation and embryo implantation stimuli. J. Cell. Physiol. 2021, 236, 1054–1067. [Google Scholar] [CrossRef] [Scilit]
- Vater, C.; Kasten, P.; Stiehler, M. Culture media for the differentiation of mesenchymal stromal cells. Acta Biometer. 2011, 7, 463–477. [Google Scholar] [CrossRef] [Scilit]
- Lin, W.; Xu, L.; Lin, S.; Shi, L.; Wang, B.; Pan, Q.; Li, G. Characterization of multipotent stem cells from human peripheral blood using an improved protocol. J. Orthop. Translat. 2019, 19, 18–28. [Google Scholar] [CrossRef] [Scilit]
- He, Q.; Wan, C.; Li, G. Concise review: Multipotent mesenchymal stromal cells in blood. Stem Cells 2007, 25, 69–77. [Google Scholar] [CrossRef] [Scilit]
- Gholami, K.; Pourmand, G.; Koruji, M.; Sadighigilani, M.; Navid, S.; Izadyar, F.; Abbasi, M. Efficiency of colony formation and differentiation of human spermatogenic cells in two different culture systems. Reprod. Biol. 2018, 18, 397–403. [Google Scholar] [CrossRef] [Scilit]
- Savvulidi, F.; Ptacek, M.; Vargova, K.S.; Stadnik, L. Manipulation of spermatogonial stem cells in livestock species. J. Anim. Sci. Biotechnol. 2019, 10, 46. [Google Scholar] [CrossRef] [Scilit]
- Aponte, P.M.; De Rooij, D.G. Biomanipulation of bovine spermatogonial stem cells. Anim. Reprod. 2018, 5, 16–22. [Google Scholar]
- Han, Y.; Li, X.; Zhang, Y.; Han, Y.; Chang, F.; Ding, J. Mesenchymal stem cells for regenerative medicine. Cells 2019, 8, 886. [Google Scholar] [CrossRef] [Scilit]
- Vellasamy, S.; Sandrasaigaran, P.; Vidyadaran, S.; George, E.; Ramasamy, R. Isolation and characterization of mesenchymal stem cells derived from human placenta tissue. Stem Cells 2012, 4, 53. [Google Scholar] [CrossRef] [Scilit]
- Cortez, J.; Bahamonde, J.; De Los Reyes, M.; Palomino, J.; Torres, C.G.; Peralta, O.A. In vitro differentiation of bovine bone marrow-derived mesenchymal stem cells into male germ cells by exposure to exogenous bioactive factors. Reprod. Domest. Anim. 2018, 53, 700–709. [Google Scholar] [CrossRef] [Scilit]
- Cordero, P.; Guerrero-Moncayo, A.; De Los Reyes, M.; Varas-Godoy, M.; Cortez, J.; Torres, C.G.; Peralta, O.A. Overexpression of DAZL, STRA8, and BOULE genes and treatment with BMP4 or retinoic acid modulate the expression of MSC overexpressing germ cell genes. Front. Vet. Sci. 2021, 8, 667547. [Google Scholar] [CrossRef] [Scilit]
- Ruwanpura, S.M.; Mclachlan, R.I.; Meachem, S.J. Hormonal regulation of male germ cell development. J. Endocrinol. 2010, 205, 117–131. [Google Scholar] [CrossRef] [Scilit]
- Segunda, M.N.; Bahamonde, J.; Muñoz, I.; Sepulveda, S.; Cortez, J.; De Los Reyes, M.; Peralta, O.A. Sertoli cell-mediated differentiation of bovine fetal mesenchymal stem cells into germ cell lineage using an in vitro coculture system. Theriogenology 2019, 130, 8–18. [Google Scholar] [CrossRef] [Scilit]
- Xie, L.; Lin, L.; Tang, Q.; Li, W.; Huang, T.; Huo, X.; Ma, L. Sertoli cell-mediated differentiation of male germ cell-like cells from human umbilical cord Wharton’s jelly-derived mesenchymal stem cells in an in vitro coculture system. Eur. J. Med. Res. 2015, 20, 9. [Google Scholar] [CrossRef] [Scilit]
- Rossi, P.; Dolci, S. Paracrine mechanisms involved in the control of early stages of mammalian spermatogenesis. Front. Endocrinol. 2013, 4, 181. [Google Scholar] [CrossRef] [Scilit]
- Huleihel, M.; Nourashrafeddin, S.; Plant, T.M. Application of three-dimensional culture systems to study mammalian spermatogenesis, with an emphasis on the rhesus monkey (Macaca mulatta). Asian J. Androl. 2015, 17, 972. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lie, P.P.; Cheng, C.Y.; Mruk, D.D. Signaling pathways regulating the blood—Testis barrier. Int. J. Biochem. Cell Biol. 2013, 45, 621–625. [Google Scholar] [CrossRef] [Scilit]
- Monteiro, C.D.; Bicudo, S.D.; Toma, H.S. O papel das células de Sertoli na espermatogênese. Pubvet 2010, 855, 1–17. [Google Scholar]
- Jabari, A.; Gilani, M.A.S.; Koruji, M.; Gholami, K.; Mohsenzadeh, M.; Khadivi, F.; Movassagh, S.A. Three-dimensional coculture of human spermatogonial stem cells with Sertoli cells in soft agar culture system supplemented by growth factors and Laminin. Acta Histochem. 2020, 122, 151572. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Song, W.; Kawazoe, N.; Chen, G. The osteogenic differentiation of mesenchymal stem cells by controlled cell–cell interaction on micropatterned surfaces. J. Biomed. Mater. Res. 2013, 101, 3388–3395. [Google Scholar] [CrossRef] [Scilit]
- Hamidabadi, H.G.; Bojnordi, M.N. Coculture of mouse spermatogonial stem cells with sertoli cell as a feeder layer, stimulates the proliferation and spermatogonial stemness profile. Middle East Fertil. Soc. J. 2018, 23, 107–111. [Google Scholar] [CrossRef] [Scilit]
- Zheng, Y.; Tian, X.; Zhang, Y.; Qin, J.; An, J.; Zeng, W. In vitro propagation of male germline stem cells from piglets. J. Assist. Reprod. Genet. 2013, 30, 945–952. [Google Scholar] [CrossRef] [Scilit]
- Stukenborg, J.B.; Wistuba, J.; Luetjens, C.M.; Elhija, M.A.; Huleihel, M.; Lunenfeld, E.; Gromoll, J.; Nieschlag, E.; Schlatt, S. Coculture of spermatogonia with somatic cells in a novel three-dimensional soft-agar-culture-system. J. Androl. 2008, 29, 312–329. [Google Scholar] [CrossRef] [Scilit]
- Schefe, J.H.; Lehmann, K.E.; Buschmann, I.R.; Unger, T.; Funke-Kaiser, H. Quantitative real-time RT-PCR data analysis: Current concepts and the novel “gene expression’s C T difference” formula. J. Mol. Med. 2006, 84, 901–910. [Google Scholar] [CrossRef] [Scilit]
- Li, N.; Ma, W.; Shen, Q.; Zhang, M.; Du, Z.; Wu, C.; Hua, J. Reconstitution of male germline cell specification from mouse embryonic stem cells using defined factors in vitro. Cell Death Differ. 2019, 26, 2115–2124. [Google Scholar] [CrossRef] [Scilit]
- Lyahyai, J.; Mediano, D.R.; Ranera, B.; Sanz, A.; Remacha, A.R.; Bolea, R.; Zaragoza, P.; Rodellar, C.; Martín-Burriel, I. Isolation and characterization of ovine mesenchymal stem cells derived from peripheral blood. BMC Vet. Res. 2012, 8, 169. [Google Scholar] [CrossRef] [Scilit]
- Moraes, D.A.; Sibov, T.T.; Pavon, L.F.; Alvim, P.Q.; Bonadio, R.S.; Da Silva, J.R.; Pic-Taylor, A.; Toledo, O.A.; Marti, L.C.; Azevedo, R.B.; et al. A reduction in CD90 (THY-1) expression results in increased differentiation of mesenchymal stromal cells. Stem Cell Res. Ther. 2016, 7, 97. [Google Scholar] [CrossRef] [Scilit]
- Xu, L.; Li, G. Circulating mesenchymal stem cells and their clinical implications. implications. J. Orthop. Translat. 2014, 2, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Chen, M.; Zhang, L.; Cui, X.; Lin, X.; Li, Y.; Wang, Y.; Gao, F. Wt1 directs the lineage specification of sertoli and granulosa cells by repressing Sf1 expression. Development 2017, 144, 44–53. [Google Scholar] [CrossRef] [Scilit]
- Piprek, R.P.; Kloc, M.; Kubiak, J.Z. Early development of the gonads: Origin and differentiation of the somatic cells of the genital ridges. In Molecular Mechanisms of Cell Differentiation in Gonad Development; Springer: Cham, Switzerland, 2016; pp. 1–22. [Google Scholar] [CrossRef] [Scilit]
- Zheng, Y.; Zhang, Y.; Qu, R.; He, Y.; Tian, X.; Zeng, W. Spermatogonial stem cells from domestic animals: Progress and prospects. Reproduction 2014, 147, R65–R74. [Google Scholar] [CrossRef] [Scilit]
- Fujihara, M.; Kim, S.M.; Minami, N.; Yamada, M.; Imai, H. Characterization and in vitro culture of male germ cells from developing bovine testis. J. Reprod. Dev. 2011, 57, 355–364. [Google Scholar] [CrossRef] [Scilit]
- Herrid, M.; Davey, R.J.; Hill, J.R. Characterization of germ cells from pre-pubertal bull calves in preparation for germ cell transplantation. Cell Tissue Res. 2007, 330, 321–329. [Google Scholar] [CrossRef] [Scilit]
- Luo, J.; Megee, S.; Dobrinski, I. Asymmetric distribution of UCH-L1 in spermatogonia is associated with maintenance and differentiation of spermatogonial stem cells. J. Cell. Physiol. 2009, 220, 460–468. [Google Scholar] [CrossRef] [Scilit]
- Ram, K.; Kannan, T.; Basha, S.; Geetha Ramesh, G.R.; William, B. In-vitro culture morphology of Spermatogonial stem cells (SSCs) in mice. Int. J. Livest. 2017, 7, 52–59. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Ye, S.; Liang, D.; Wang, P.; Fu, J.; Ma, Q.; Wang, Y. In vitro modeling of human germ cell development using pluripotent stem cells. Stem Cell Rep. 2018, 10, 509–523. [Google Scholar] [CrossRef] [Scilit]
- Nazm Bojnordi, M.; Ghasemi, H.; Narimanpour, Z. An Efficient In Vitro Culture System to Amplify Spermatogonia Stem Cell Markers. Res. Mol. Med. 2020, 8, 10–20. [Google Scholar] [CrossRef] [Scilit]
- Aponte, P.M.; Soda, T.; Van De Kant, H.J.G.; De Rooij, D.G. Basic features of bovine spermatogonial culture and effects of glial cell line-derived neurotrophic factor. Theriogenology 2006, 65, 1828–1847. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, J.; Megee, S.; Rathi, R.; Dobrinski, I. Protein gene product 9.5 is a spermatogonia-specific marker in the pig testis: Application to enrichment and culture of porcine spermatogonia. Mol. Reprod. Dev. 2006, 12, 1531–1540. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Browne, S.; Jha, A.K.; Ameri, K.; Marcus, S.G.; Yeghiazarians, Y.; Healy, K.E. TGF-β1/CD105 signaling controls vascular network formation within growth factor sequestering hyaluronic acid hydrogels. PLoS ONE 2018, 13, e0194679. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mohammadzadeh, E.; Mirzapour, T.; Nowroozi, M.R.; Nazarian, H.; Piryaei, A.; Alipour, F.; Ghaffari Novin, M. Differentiation of spermatogonial stem cells by soft agar three-dimensional culture system. Artif. Cells Nanomed. Biotechnol. 2019, 47, 1772–1781. [Google Scholar] [CrossRef] [Scilit]
- Boyer, L.A.; Lee, T.I.; Cole, M.F.; Johnstone, S.E.; Levine, S.S.; Zucker, J.P.; Young, R.A. Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 2005, 122, 947–956. [Google Scholar] [CrossRef] [Scilit]
- Silva, J.; Nichols, J.; Theunissen, T.W.; Guo, G.; Van Oosten, A.L.; Barrandon, O.; Smith, A. Nanog is the gateway to the pluripotent ground state. Cell 2009, 138, 722–737. [Google Scholar] [CrossRef] [Scilit]
- Takahashi, K.; Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006, 126, 663–676. [Google Scholar] [CrossRef] [Scilit]
- Arooj, M.; Rashid, F.A.; Gul, A. Role of epigenetic modifications in stem cell regulatory regions (Oct4, Sox2 and Nanog) and cancer. IOSR J. Pharm. Biol. Sci. 2013, 5, 76–81. [Google Scholar] [CrossRef] [Scilit]
- Niwa, H.; Miyazaki, J.I.; Smith, A.G. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 2000, 24, 372–376. [Google Scholar] [CrossRef] [Scilit]
- Sahare, M.G.; Imai, H. Recent advances of in vitro culture systems for spermatogonial stem cells in mammals. Reprod. Med. Biol. 2018, 17, 134–142. [Google Scholar] [CrossRef] [Scilit]
- Pham, H.; Tonai, R.; Wu, M.; Birtolo, C.; Chen, M. CD73, CD90, CD105 and Cadherin-11 RT-PCR screening for mesenchymal stem cells from cryopreserved human cord tissue. Int. J. Stem Cell 2018, 11, 26–38. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.L.; Li, P.Z.; Pang, J.; Wan, Y.J.; Zhang, G.M.; Fan, Y.X.; Wang, F. Induction of goat bone marrow mesenchymal stem cells into putative male germ cells using mRNA for STRA8, BOULE and DAZL. Cytotechnology 2019, 71, 563–572. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.H.; Engel, W.; Nayernia, K. Stem cell protein Piwil2 modulates expression of murine spermatogonial stem cell expressed genes. Mol. Reprod. Dev. 2006, 73, 173–179. [Google Scholar] [CrossRef] [Scilit]
- Saiti, D.; Lacham-Kaplan, O. Mouse Germ Cell Development in-vivo and in-vitro. Biomarker 2007, 2, 117727190700200024. [Google Scholar] [CrossRef] [Scilit]
- Saitou, M.; Barton, S.C.; Surani, M.A.A. Molecular programme for the specification of germ cell fate in mice. Nature 2002, 418, 2002. [Google Scholar] [CrossRef] [Scilit]
- Tanaka, S.S.; Matsui, Y. Developmentally regulated expression of mil-1 and mil-2, mouse interferon-induced transmembrane protein like genes, during formation and differentiation of primordial germ cells. Mech. Dev. 2002, 119 (Suppl. 1), S261–S267. [Google Scholar] [CrossRef] [Scilit]
- Nagano, M.; Ryu, B.Y.; Brinster, C.J.; Avarbock, M.R.; Brinster, R.L. Maintenance of mouse male germ line stem cells in vitro. Biol. Reprod. 2003, 68, 2207–2214. [Google Scholar] [CrossRef] [Scilit]






| Gene | Nucleotide Sequence (5′-3′) | Access Number | |
|---|---|---|---|
| Forward | Reverse | ||
| Housekeeping genes | |||
| β-ACTINA | CGCACCACTGGCATTGTCAT | TCCAAGGCGACGTAGCAGAG | NM_173979.3 |
| GAPDH | CCTTCATTGACCTTCACTACATGGTCTA | TGGAAGATGGTGATGGCCTTTCCATTG | NM_001034034.2 |
| Mesenchymal stem cell genes | |||
| CD73 | TGGTCCAGGCCTATGCTTTTG | GGGATGCTGCTGTTGAGAAGAA | NM_174129.3 |
| CD105 | CGGACAGTGACCGTGAAGTTG | TGTTGTGGTTGGCCTCGATTA | NM_00107639.1 |
| Hematopoietic cell genes | |||
| CD34 | CATGCCGTCTTAACCCATCT | CGGTCTACAGAGGTGGTGGT | NM_174009.1 |
| CD45 | CCACGGGTATTCAGCAAGTT | CCCAGATCATCCTCCAGAAA | NM_001206523 |
| Sertoli cell genes | |||
| WT1 | CGTGCGTACCATGTAGGGAA | CTCGTGCTTGAAGGAGTGGT | XM_015474834.2 |
| AR | CAGATGGCAGTCATTCAG | CTTGGTGAGCTGGTAGAAG | XM_001244127 |
| Spermatogonial stem cell genes | |||
| UCHL1 | AGAAGCAGCATCTCGGTTCC | CGTGGTTGAGGGTAAGTGCT | NM_001046172.2 |
| CD90 | ACTCATACCGCTCCCGAACCA | CATGTGTATGTCCCCTCGTCCTT | NM_001034765 |
| Germ cell genes | |||
| DAZL | TCCAAGTTCACCAGTTCAGG | CGT CTG TAT GCT TCT GTC CAC | NM_001081725.1 |
| STRA8 | TGTGCCCAGGTGTTCATCTC | GGGGACTGTCACCTCATTGG | XM_015463130 |
| PIWIL2 | TCGTATTGATGATGTGGATTGG | GGGAGCAGCAGGATTTCAC | XM_617223.3 |
| FRAGILIS | ATCTGCAGCGAGACCTCTGT | CCGATGGACATGATGATGAG | XM_002697323 |
| STELLA | TGCAAGTTGCCACTCAACTC | TCTTACCCCTCTCCGCCTAT | NM_00111110 |
| SCP3 | CTAGAATTGTTCAGAGCCAGAG | GTTCAAGTTCTTTCTTCAAAG | NM_001040588.2 |
| VASA | TGCTACTCCTGGAAGACTGA | CGGTCTGCTGAACATCTCTA | NM_001007819.1 |
| Pluripotency genes | |||
| OCT4 | GAAAGAGAAAGCGGACGAG | GTGAAAGGAGACCCAGCAG | NM_174580.2 |
| NANOG | TAAGCACAGGGGGCAAAAGT | ATGGCTAAAAGGGGTGGAGG | NM_001025344.1 |
| SOX2 | CCCGTGGTTACCTCTTCTTCC | CGCTCTGCTAGTGCTGGGAC | NM_001105463.2 |
| Gene | PB-MSC+SC | SSC+SC |
|---|---|---|
| CD73 | ↓ (Q-PCR) | - |
| CD105 | ↓ (Q-PCR) | - |
| DAZL | ↑ (Q-PCR) *(IF) | ↑(Q-PCR) *(IF) |
| STRA8 | x (Q-PCR) | + (Q-PCR) *(IF) |
| PIWIL2 | ↑ (Q-PCR) *(IF) | ↑ (Q-PCR) *(IF) |
| FRAGILIS | x (Q-PCR) | < (Q-PCR) |
| STELLA | x (Q-PCR) | < (Q-PCR) *(IF) |
| OCT4 | x (Q-PCR) *(IF) | → (Q-PCR) *(IF) |
| NANOG | x (Q-PCR) | → (Q-PCR) *(IF) |
| SOX2 | x (Q-PCR) | + (Q-PCR) |
| SCP3 | x (Q-PCR) | x (Q-PCR) |
| VASA | x (Q-PCR) | x (Q-PCR) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Segunda, M.N.; Díaz, C.; Torres, C.G.; Parraguez, V.H.; De los Reyes, M.; Peralta, O.A. Comparative Analysis of the Potential for Germ Cell (GC) Differentiation of Bovine Peripheral Blood Derived-Mesenchymal Stem Cells (PB-MSC) and Spermatogonial Stem Cells (SSC) in Co-Culture System with Sertoli Cells (SC). Animals 2023, 13, 318. https://doi.org/10.3390/ani13020318
Segunda MN, Díaz C, Torres CG, Parraguez VH, De los Reyes M, Peralta OA. Comparative Analysis of the Potential for Germ Cell (GC) Differentiation of Bovine Peripheral Blood Derived-Mesenchymal Stem Cells (PB-MSC) and Spermatogonial Stem Cells (SSC) in Co-Culture System with Sertoli Cells (SC). Animals. 2023; 13(2):318. https://doi.org/10.3390/ani13020318
Chicago/Turabian StyleSegunda, Moisés N., Carlos Díaz, Cristian G. Torres, Víctor H. Parraguez, Mónica De los Reyes, and Oscar A. Peralta. 2023. "Comparative Analysis of the Potential for Germ Cell (GC) Differentiation of Bovine Peripheral Blood Derived-Mesenchymal Stem Cells (PB-MSC) and Spermatogonial Stem Cells (SSC) in Co-Culture System with Sertoli Cells (SC)" Animals 13, no. 2: 318. https://doi.org/10.3390/ani13020318
APA StyleSegunda, M. N., Díaz, C., Torres, C. G., Parraguez, V. H., De los Reyes, M., & Peralta, O. A. (2023). Comparative Analysis of the Potential for Germ Cell (GC) Differentiation of Bovine Peripheral Blood Derived-Mesenchymal Stem Cells (PB-MSC) and Spermatogonial Stem Cells (SSC) in Co-Culture System with Sertoli Cells (SC). Animals, 13(2), 318. https://doi.org/10.3390/ani13020318

