Glucose Supplementation Improves Performance and Alters Glucose Transporters’ Expression in Pectoralis major of Heat-Stressed Chickens
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Diets
2.2. Growth Performance
2.3. Carcass Yield
2.4. Tissue Collection
2.5. Gene Expression of Glucose Transporters
2.6. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A. Primer Pairs Used for RT-qPCR Analysis of P. major Glucose Transporters Gene Expression Levels
| Description | Gene | GeneBank Accession Number | Product Size (bp) | Align. | Primer Sequence |
| Glucose transporters | SGLT1 (SLC5A1) | NM_001293240 | 97 | Forward | 5′GAGGAGAAACCCGATGAAAGAG3′ |
| Reverse | 5′CTAAGCCACAGAACCAGTTGTA3′ | ||||
| GLUT1 (SLC2A1) | NM_205209.1 | 105 | Forward | 5′CTTCTGCATACACTCCTTCTCC3′ | |
| Reverse | 5′TGGACGTGAAACCAGCTAAA3′ | ||||
| GLUT8 (SLC2A8) | AB083371 | 309 | Forward | 5′GCAGCAGAGGTTATTCGCGCC3′ | |
| Reverse | 5′GCCTCCCAGTATTCCTCCAGC3′ | ||||
| GLUT10 (SLC2A10) | XM_417383.5 | 133 | Forward | 5′CCGCTGCAGATGAGGTATTT3′ | |
| Reverse | 5′GTTTCTTCTCAGAGCCGTAGTG3′ | ||||
| GLUT12 (SLC2A12) | XM_419733.5 | 110 | Forward | 5′AGAGAGTGGGGAGGTTCCC3′ | |
| Reverse | 5′TCAGGACGAGCCAAGACA3′ | ||||
| Fructose transporters | GLUT2 (SLC2A2) | NM_207178.1 | 577 | Forward | 5′ATGCTGGTGGTCAATGTCCTCTC3′ |
| Reverse | 5′TGATGCCTGAGAACTGCTGCGAT3′ | ||||
| GLUT5 (SLC2A5) | XM_417596.6 | 108 | Forward | 5′AGGCTGATCTCTGCCTTTG3′ | |
| Reverse | 5′GTCGATGTAGGTTCGGTTGTAG3′ | ||||
| B-actin | NM 205518.1 | 125 | Forward | 5′AGACATCAGGGTGTGATGGTTGGT3′ | |
| Reverse | 5′TCCCAGTTGGTGACAATACCGTGT3′ |
References
- Das, R.; Sailo, L.; Verma, N.; Bharti, P.; Saikia, J.; Imtiwati; Kumar, R. Impact of heat stress on health and performance of dairy animals: A review. Vet. World 2016, 9, 260–268. [Google Scholar] [CrossRef] [Scilit]
- Habashy, W.S.; Milfort, M.C.; Fuller, A.L.; Attia, Y.A.; Rekaya, R.; Aggrey, S.E. Effect of heat stress on protein utilization and nutrient transporters in meat-type chickens. Int. J. Biometeorol. 2017, 61, 2111–2118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, H.; Jiao, H.C.; Buyse, J.; Decuypere, E. Strategies for preventing heat stress in poultry. World’s Poult. Sci. J. 2006, 62, 71–86. [Google Scholar] [CrossRef] [Scilit]
- Ghareeb, A.F.A.; Schneiders, G.H.; Richter, J.N.; Foutz, J.C.; Milfort, M.C.; Fuller, A.L.; Yuan, J.; Rekaya, R.; Aggrey, S.E. Heat stress modulates the disruptive effects of Eimeria maxima infection on the ileum nutrient digestibility, molecular transporters, and tissue morphology in meat-type chickens. PLoS ONE 2022, 17, e0269131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quinteiro-Filho, W.M.; Ribeiro, A.; Ferraz-de-Paula, V.; Pinheiro, M.L.; Sakai, M.; Sá, L.R.M.D.; Ferreira, A.J.P.; Palermo-Neto, J. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. Poult. Sci. 2010, 89, 1905–1914. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quinteiro-Filho, W.M.; Rodrigues, M.V.; Ribeiro, A.; Ferraz-de-Paula, V.; Pinheiro, M.L.; Sá, L.R.M.D.; Ferreira, A.J.P.; Palermo-Neto, J. Acute heat stress impairs performance parameters and induces mild intestinal enteritis in broiler chickens: Role of acute hypothalamic-pituitary-adrenal axis activation. J. Anim. Sci. 2012, 90, 1986–1994. [Google Scholar] [CrossRef] [Scilit]
- Ghanima, M.M.A.; Abd El-Hack, M.E.; Othman, S.I.; Taha, A.E.; Allam, A.A.; Abdel-Moneim, A.M.E. Impact of different rearing systems on growth, carcass traits, oxidative stress biomarkers, and humoral immunity of broilers exposed to heat stress. Poult. Sci. 2020, 99, 3070–3078. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loyau, T.; Berri, C.; Bedrani, L.; Metayer-Coustard, S.; Praud, C.; Duclos, M.J.; Tesseraud, S.; Rideau, N.; Everaert, N.; Yahav, S.; et al. Thermal manipulation of the embryo modifies the physiology and body composition of broiler chickens reared in floor pens without affecting breast meat processing quality. J. Anim. Sci. 2013, 91, 3674–3685. [Google Scholar] [CrossRef] [Scilit]
- Orlowski, S.K.; Cauble, R.; Tabler, T.; Hiltz, J.Z.; Greene, E.S.; Anthony, N.B.; Dridi, S. Processing evaluation of random bred broiler populations and a common ancestor at 55 days under chronic heat stress conditions. Poult. Sci. 2020, 99, 3491–3500. [Google Scholar] [CrossRef] [Scilit]
- Vandana, G.D.; Sejian, V.; Lees, A.M.; Pragna, P.; Silpa, M.V.; Maloney, S.K. Heat stress and poultry production: Impact and amelioration. Int. J. Biometeorol. 2021, 65, 163–179. [Google Scholar] [CrossRef] [Scilit]
- Nichelmann, M.; Burmeister, A.; Janke, O.; Höchel, J.; Tzschentke, B. Avian embryonic thermoregulation: Role of Q10 in interpretation of endothermic reactions. J. Therm. Biol. 1998, 23, 369–376. [Google Scholar] [CrossRef] [Scilit]
- Ensminger, M.E.; Oldfield, J.E.; Heinemann, W.W. Feeds and Nutrition Digest: Formerly, Feeds and Nutrition–Abridged; Ensminger Publishing Company: Clovis, CA, USA, 1990. [Google Scholar]
- Yunis, R.; Cahaner, A. The effects of the naked neck (Na) and frizzle (F) genes on growth and meat yield of broilers and their interactions with ambient temperatures and potential growth rate. Poult. Sci. 1999, 78, 1347–1352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Renaudeau, D.; Collin, A.; Yahav, S.; De Basilio, V.; Gourdine, J.L.; Collier, R.J. Adaptation to hot climate and strategies to alleviate heat stress in livestock production. Animal 2012, 6, 707–728. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lara, L.J.; Rostagno, M.H. Impact of heat stress on poultry production. Animals 2013, 3, 356–369. [Google Scholar] [CrossRef] [Scilit]
- Wasti, S.; Sah, N.; Lee, C.N.; Jha, R.; Mishra, B. Dietary supplementation of alpha-lipoic acid mitigates the negative effects of heat stress in broilers. PLoS ONE 2021, 16, e0254936. [Google Scholar] [CrossRef] [Scilit]
- Garriga, C.; Hunter, R.R.; Amat, C.; Planas, J.M.; Mitchell, M.A.; Moretó, M. Heat stress increases apical glucose transport in the chicken jejunum. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2006, 290, R195–R201. [Google Scholar] [CrossRef] [Scilit]
- Lin, H.; Du, R.; Gu, X.H.; Li, F.C.; Zhang, Z.Y. A study on the plasma biochemical indices of heat stressed broilers. Asian-Aust. J. Anim. Sci. 2000, 13, 1210–1218. [Google Scholar] [CrossRef] [Scilit]
- Das, S.R.; Everett, B.M.; Birtcher, K.K.; Brown, J.M.; Januzzi, J.L., Jr.; Kalyani, R.R.; Kosiborod, M.; Magwire, M.; Morris, P.B.; Neumiller, J.J.; et al. 2020 expert consensus decision pathway on novel therapies for cardiovascular risk reduction in patients with type 2 diabetes: A report of the American College of Cardiology Solution Set Oversight Committee. J. Am. Coll. Cardiol. 2020, 76, 1117–1145. [Google Scholar] [CrossRef] [Scilit]
- Abbas, Z.; Sammad, A.; Hu, L.; Fang, H.; Xu, Q.; Wang, Y. Glucose Metabolism and Dynamics of Facilitative Glucose Transporters (GLUTs) under the Influence of Heat Stress in Dairy Cattle. Metabolites 2020, 10, 312. [Google Scholar] [CrossRef] [Scilit]
- Cankaya, M.; Hernandez, A.M.; Ciftci, M.; Beydemir, S.; Ozdemir, H.; Budak, H.; Gulcin, I.; Comakli, V.; Emircupani, T.; Ekinci, D.; et al. An analysis of expression patterns of genes encoding proteins with catalytic activities. BMC Genom. 2007, 8, 232. [Google Scholar] [CrossRef] [Scilit]
- Ma, B.; Zhang, L.; Li, J.; Xing, T.; Jiang, Y.; Gao, F. Heat stress alters muscle protein and amino acid metabolism and accelerates liver gluconeogenesis for energy supply in broilers. Poult. Sci. 2021, 100, 215–223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siddiqui, S.H.; Kang, D.; Park, J.; Khan, M.; Belal, S.A.; Shin, D.; Shim, K. Altered relationship between gluconeogenesis and immunity in broilers exposed to heat stress for different durations. Poult. Sci. 2021, 100, 101274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baker, D.H. Advances in protein–amino acid nutrition of poultry. Amino Acids 2009, 37, 29–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wasti, S.; Sah, N.; Mishra, B. Impact of Heat Stress on Poultry Health and Performances, and Potential Mitigation Strategies. Animals 2020, 10, 1266. [Google Scholar] [CrossRef] [Scilit]
- Abdel-Moneim, A.M.E.; Shehata, A.M.; Khidr, R.E.; Paswan, V.K.; Ibrahim, N.S.; El-Ghoul, A.A.; Aldhumri, S.A.; Gabr, S.A.; Mesalam, N.M.; Elbaz, A.M.; et al. Nutritional manipulation to combat heat stress in poultry–A comprehensive review. J. Therm. Biol. 2021, 98, 102915. [Google Scholar] [CrossRef] [Scilit]
- Teyssier, J.R.; Preynat, A.; Cozannet, P.; Briens, M.; Mauromoustakos, A.; Greene, E.S.; Rochell, S.J. Constant and cyclic chronic heat stress models differentially influence growth performance, carcass traits and meat quality of broilers. Poult. Sci. 2022, 101, 101963. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- SAS Institute Inc. SAS/IML® Studio 15.1 for SAS/STAT® Users; SAS Institute Inc.: Cary, NC, USA, 2018. [Google Scholar]
- Beckford, R.C.; Ellestad, L.E.; Proszkowiec-Weglarz, M.; Farley, L.; Brady, K.; Angel, R.; Liu, H.C.; Porter, T.E. Effects of heat stress on performance, blood chemistry, and hypothalamic and pituitary mRNA expression in broiler chickens. Poult. Sci. 2020, 99, 6317–6325. [Google Scholar] [CrossRef] [Scilit]
- Liu, L.; Ren, M.; Ren, K.; Jin, Y.; Yan, M. Heat stress impacts on broiler performance: A systematic review and meta-analysis. Poult. Sci. 2020, 99, 6205–6211. [Google Scholar] [CrossRef] [Scilit]
- USDA NASS. National QuickStats for Chickens; United States Department of Agricultural, National Agriculture Statistics Service: Washington, DC, USA, 2018. Available online: https://www.nass.usda.gov/Statistics_by_Subject/result.php?847EC46F-2837-35AF-8BBB-4F0B4D2E0872§or=ANIMALS%26PRODUCTS&group=POULTRY&comm=CHICKENS (accessed on 14 April 2023).
- Chan, I.; Franks, B.; Hayek, M.N. The ‘sustainability gap’ of US broiler chicken production: Trade-offs between welfare, land use and consumption. R. Soc. Open Sci. 2022, 9, 210478. [Google Scholar] [CrossRef] [Scilit]
- Qaid, M.M.; Al-Garadi, M.A. Protein and Amino Acid Metabolism in Poultry during and after Heat Stress: A Review. Animals 2021, 11, 1167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lohani, N.; Singh, M.B.; Bhalla, P.L. Rapid Transcriptional Reprogramming Associated With Heat Stress-Induced Unfolded Protein Response in Developing Brassica napus Anthers. Front. Plant Sci. 2022, 13, 905674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gonzalez-Rivas, P.A.; Chauhan, S.S.; Ha, M.; Fegan, N.; Dunshea, F.R.; Warner, R.D. Effects of heat stress on animal physiology, metabolism, and meat quality: A review. Meat Sci. 2020, 162, 108025. [Google Scholar] [CrossRef] [Scilit]
- Temim, S.; Chagneau, A.M.; Peresson, R.; Tesseraud, S. Chronic heat exposure alters protein turnover of three different skeletal muscles in finishing broiler chickens fed 20 or 25% protein diets. J. Nutr. 2000, 130, 813–819. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kpomasse, C.C.; Oke, O.E.; Houndonougbo, F.M.; Tona, K. Broiler production challenges in the tropics: A review. Vet. Med. Sci. 2021, 7, 831–842. [Google Scholar] [CrossRef] [Scilit]
- Swanson, D.L.; Zhang, Y.; Jimenez, A.G. Skeletal muscle and metabolic flexibility in response to changing energy demands in wild birds. Front. Physiol. 2022, 13, 961392. [Google Scholar] [CrossRef] [Scilit]
- Goel, A.; Ncho, C.M.; Choi, Y.H. Regulation of gene expression in chickens by heat stress. J. Anim. Sci. Biotechnol. 2021, 12, 11. [Google Scholar] [CrossRef] [Scilit]
- Farrell, C.L.; Pardridge, W.M. Blood-brain barrier glucose transporter is asymmetrically distributed on brain capillary endothelial lumenal and ablumenal membranes: An electron microscopic immunogold study. Proc. Natl. Acad. Sci. USA 1991, 88, 5779–5783. [Google Scholar] [CrossRef] [Scilit]
- Ferraris, R.P.; Diamond, J. Regulation of intestinal sugar transport. Physiol. Rev. 1997, 77, 257–302. [Google Scholar] [CrossRef] [Scilit]
- Barfull, A.; Garriga, C.; Tauler, A.; Planas, J.M. Regulation of SGLT1 expression in response to Na(+) intake. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2002, 282, R738–R743. [Google Scholar] [CrossRef] [Scilit]
- Wright, E.M.; Loo, D.D.; Hirayama, B.A. Biology of human sodium glucose transporters. Physiol. Rev. 2011, 91, 733–794. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gamberucci, A.; Marcolongo, P.; Németh, C.E.; Zoppi, N.; Szarka, A.; Chiarelli, N.; Hegedűs, T.; Ritelli, M.; Carini, G.; Willaert, A.; et al. GLUT10-Lacking in Arterial Tortuosity Syndrome-Is Localized to the Endoplasmic Reticulum of Human Fibroblasts. Int. J. Mol. Sci. 2017, 18, 1820. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanz Fernandez, M.V.; Stoakes, S.K.; Abuajamieh, M.; Seibert, J.T.; Johnson, J.S.; Horst, E.A.; Rhoads, R.P.; Baumgard, L.H. Heat stress increases insulin sensitivity in pigs. Physiol. Rep. 2015, 3, e12478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lacombe, V.A. Expression and regulation of facilitative glucose transporters in equine insulin-sensitive tissue: From physiology to pathology. Int. Sch. Res. Not. Vet. Sci. 2014, 2014, 409547. [Google Scholar] [CrossRef] [Scilit]

| Treatment | Metabolizable Energy Intake (ME), kcal/Bird | ||
|---|---|---|---|
| Feed | Glucose Water | Total | |
| TN0 | 4113.47 | 0 | 4113.47 |
| TN6 | 3721.34 | 595.98 | 4317.32 |
| HS0 | 3673.09 | 0 | 3673.09 |
| HS6 | 3192.47 | 598.15 | 3790.62 |
| Treatment | Body Weight at Day 28 (g/Bird) | Body Weight at Day 35 (g/Bird) | Body Weight Gain (g/Bird) | Feed Intake (g/Bird) | Feed Conversion Ratio | Water Intake (mL/Bird) | Water Conversion Ratio |
|---|---|---|---|---|---|---|---|
| TN0 | 1630.35 | 2220.96 a | 590.61 a | 1316.31 a | 2.30 bc | 2585.38 ab | 4.59 bc |
| TN6 | 1700.32 | 2318.85 a | 618.53 a | 1190.83 b | 1.94 c | 2483.11 b | 4.05 c |
| HS0 | 1639.76 | 1990.19 b | 350.43 b | 1175.39 bc | 3.41 a | 3443.72 a | 8.30 a |
| HS6 | 1681.98 | 2066.69 ab | 384.71 b | 1021.59 c | 2.84 ab | 2492.28 ab | 6.95 ab |
| SEM | 18.6194 | 53.3621 | 41.5027 | 51.7322 | 0.202 | 326.3200 | 0.7424 |
| p value | 0.2034 | 0.0016 | 0.0004 | 0.0113 | 0.0004 | 0.0441 | 0.0019 |
| Temperature | |||||||
| TN | 1665.33 | 2269.91 a | 604.57 a | 1252.25 a | 2.12 b | 2534.24 | 4.32 b |
| HS | 1660.87 | 2028.44 b | 367.57 b | 1113.90 b | 3.13 a | 2968.03 | 7.62 a |
| SEM | 18.6001 | 37.7718 | 29.3468 | 38.3656 | 0.143 | 225.8314 | 0.5249 |
| p value | 0.8674 | 0.0003 | <0.0001 | 0.0104 | <0.0001 | 0.1869 | 0.0003 |
| Glucose | |||||||
| 0% | 1634.63 | 2105.58 | 470.52 | 1245.85 a | 2.86 a | 3014.55 | 6.45 |
| 6% | 1691.98 | 2192.77 | 501.62 | 1106.21 b | 2.39 b | 2487.72 | 5.50 |
| SEM | 18.6001 | 37.7718 | 29.3468 | 38.3656 | 0.1430 | 225.8314 | 0.5026 |
| p value | 0.0572 | 0.1148 | 0.4841 | 0.0197 | 0.0332 | 0.1175 | 0.2173 |
| Treatment | Eviscerated Weight * (g) | Carcass Yield (%) | Abdominal Fat (%) | P. major (%) | P. minor (%) | Thigh (%) | Drumstick (%) | Wings (%) |
|---|---|---|---|---|---|---|---|---|
| TN0 | 1675.78 a | 72.62 | 0.93 | 17.57 a | 3.41 | 11.82 | 10.31 a | 7.22 |
| TN6 | 1682.11 a | 72.71 | 0.83 | 17.93 a | 3.50 | 11.62 | 10.01 a | 7.36 |
| HS0 | 1514.56 b | 73.59 | 1.21 | 14.84 b | 3.09 | 10.96 | 8.78 b | 6.84 |
| HS6 | 1654.35 a | 73.77 | 1.22 | 16.94 a | 3.25 | 11.86 | 9.77 ab | 7.18 |
| SEM | 33.0543 | 0.6576 | 0.1287 | 0.5295 | 0.1570 | 0.3191 | 0.3352 | 0.1529 |
| p value | 0.0015 | 0.9531 | 0.7433 | 0.0005 | 0.2701 | 0.1701 | 0.0129 | 0.1062 |
| Temperature | ||||||||
| TN | 1678.94 a | 72.66 | 0.88 b | 17.75 a | 3.46 | 11.72 | 10.16 a | 7.29 |
| HS | 1573.83 b | 73.68 | 1.22 a | 15.89 b | 3.17 | 11.41 | 9.24 b | 7.01 |
| SEM | 23.3729 | 0.4650 | 0.0910 | 0.3744 | 0.1110 | 0.2257 | 0.2370 | 0.1081 |
| p value | 0.0051 | 0.1270 | 0.0116 | 0.0007 | 0.0738 | 0.3305 | 0.0100 | 0.0682 |
| Glucose | ||||||||
| 0% | 1595.17 b | 73.11 | 1.07 | 16.20 b | 3.25 | 11.39 | 9.55 | 7.03 |
| 6% | 1668.23 a | 73.24 | 1.02 | 17.44 a | 3.38 | 11.74 | 9.86 | 7.27 |
| SEM | 23.3729 | 0.4650 | 0.0910 | 0.3744 | 0.1110 | 0.2257 | 0.2370 | 0.1081 |
| p value | 0.0308 | 0.8389 | 0.6921 | 0.0254 | 0.4164 | 0.2744 | 0.3108 | 0.1178 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ariyo, O.W.; Kwakye, J.; Sovi, S.; Aryal, B.; Ghareeb, A.F.A.; Hartono, E.; Milfort, M.C.; Fuller, A.L.; Rekaya, R.; Aggrey, S.E. Glucose Supplementation Improves Performance and Alters Glucose Transporters’ Expression in Pectoralis major of Heat-Stressed Chickens. Animals 2023, 13, 2911. https://doi.org/10.3390/ani13182911
Ariyo OW, Kwakye J, Sovi S, Aryal B, Ghareeb AFA, Hartono E, Milfort MC, Fuller AL, Rekaya R, Aggrey SE. Glucose Supplementation Improves Performance and Alters Glucose Transporters’ Expression in Pectoralis major of Heat-Stressed Chickens. Animals. 2023; 13(18):2911. https://doi.org/10.3390/ani13182911
Chicago/Turabian StyleAriyo, Oluwatomide Williams, Josephine Kwakye, Selorm Sovi, Bikash Aryal, Ahmed F. A. Ghareeb, Evan Hartono, Marie C. Milfort, Alberta L. Fuller, Romdhane Rekaya, and Samuel E. Aggrey. 2023. "Glucose Supplementation Improves Performance and Alters Glucose Transporters’ Expression in Pectoralis major of Heat-Stressed Chickens" Animals 13, no. 18: 2911. https://doi.org/10.3390/ani13182911
APA StyleAriyo, O. W., Kwakye, J., Sovi, S., Aryal, B., Ghareeb, A. F. A., Hartono, E., Milfort, M. C., Fuller, A. L., Rekaya, R., & Aggrey, S. E. (2023). Glucose Supplementation Improves Performance and Alters Glucose Transporters’ Expression in Pectoralis major of Heat-Stressed Chickens. Animals, 13(18), 2911. https://doi.org/10.3390/ani13182911

