Dietary Olive Leaf Extract Differentially Modulates Antioxidant Defense of Normal and Aeromonas hydrophila-Infected Common Carp (Cyprinus carpio) via Keap1/Nrf2 Pathway Signaling: A Phytochemical and Biological Link
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Approval
2.2. Plant Materials and Extraction
2.3. Phytochemical Characterization and HPLC Analysis of Olive Leaf Extract
2.3.1. HPLC Analysis of OLE
2.3.2. UPLC-ESI-MS/MS Analysis for Metabolite Analysis
2.3.3. Isolation and Purification of Oleuroside-10-Carboxylic Acid (I) and Demethyl Oleuroside-10-Carboxylic Acid (II)
2.4. Fish, Diet, and Experimental Design
2.5. Challenge with A. hydrophila
2.6. Collection of Blood Samples and Tissue Specimens
2.7. Assessment of the Immunohematological Parameters
2.8. Assessment of the Serum Biochemical and Immunological Parameters
2.9. Estimation of the Intestinal Digestive Enzyme
2.10. Estimation of the Hepatic Antioxidants and Lipoperoxidation Biomarkers
2.11. Histopathological Examination
2.12. Total RNA Extraction, cDNA Synthesis and Real-Time Quantitative PCR Assay
2.13. Statistical Analysis
3. Results
3.1. Phytochemical Characterization of the OLE
3.1.1. Identification of Secoiridoids in OLE
3.1.2. Identification of Flavonoids in OLE
3.1.3. Identification of Phenolics in OLE
3.1.4. Identification of Unknown Compounds
3.1.5. Structure Elucidation of Compounds I and II
3.2. Growth Performance
3.3. Disease Resistance
3.4. Hematological Findings
3.5. Serum Biochemical and Immunological Parameters
3.6. Hepatic Antioxidants and Intestinal Digestive Enzymes and Intestinal ALP
3.7. Histopathological Observations
3.8. mRNA Expression Profile
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tacon, A.G.J.; Lemos, D.; Metian, M. Fish for health: Improved nutritional quality of cultured fish for human consumption. Rev. Fish. Sci. Aquac. 2020, 28, 449–458. [Google Scholar] [CrossRef] [Scilit]
- FAO. FAOSTAT. Available online: http://www.fao.org/faostat/en/#data/FBS (accessed on 5 October 2021).
- Gabriel, N.N.; González-Redondo, P. Review on the progress in the role of herbal extracts in tilapia culture. Cogent Food Agric. 2019, 5, 1619651. [Google Scholar] [CrossRef] [Scilit]
- Waagbø, R.; Remø, S.C. 7 Functional diets in fish health management. In Aquaculture Health Management; Kibenge, F.S.B., Powell, M.D., Eds.; Academic Press: Cambridge, MA, USA, 2020; pp. 187–234. [Google Scholar]
- Pham, D.K.; Chu, J.; Do, N.T.; Brose, F.; Degand, G.; Delahaut, P.; De Pauw, E.; Douny, C.; Van Nguyen, K.; Vu, T.D.; et al. Monitoring antibiotic use and residue in freshwater aquaculture for domestic use in Vietnam. EcoHealth 2015, 12, 480–489. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoseinifar, S.H.; Dadar, M.; Doan, H.V.; Harikrishnan, R. Feed additives impacts on shellfish microbiota, health, and development. In Microbial Communities in Aquaculture Ecosystems; Springer: Cham, Switzerland, 2019; pp. 143–163. [Google Scholar]
- El-Saadony, M.T.; Zabermawi, N.M.; Zabermawi, N.M.; Burollus, M.A.; Shafi, M.E.; Alagawany, M.; Yehia, N.; Askar, A.M.; Alsafy, S.A.; Noreldin, A.E.; et al. Nutritional aspects and health benefits of bioactive plant compounds against infectious diseases: A review. Food Rev. Int. 2021, 2021, 2138–2160. [Google Scholar] [CrossRef] [Scilit]
- Santos, L.V.; Ramos, F. Analytical strategies for the detection and quantification of antibiotic residues in aquaculture fishes: A review. Trends Food Sci. Technol. 2016, 52, 16–30. [Google Scholar] [CrossRef] [Scilit]
- Bombardelli, R.A.; Mewes, J.K.; Buzzi, A.H.; de Oliveira Pedreira, A.C.; Syperreck, M.A.; Dalmaso, A.C.S.; Chagas, T.V.; Chiella, R.J.; Meurer, F. Diets containing crude glycerin modify the ovary histology, cause reproductive harm on Nile tilapia females and impair the offspring quality. Aquaculture 2021, 533, 736098. [Google Scholar] [CrossRef] [Scilit]
- Dawood, M.A.O.; Ali, M.F.; Amer, A.A.; Gewaily, M.S.; Mahmoud, M.M.; Alkafafy, M.; Assar, D.H.; Soliman, A.A.; Van Doan, H. The influence of coconut oil on the growth, immune, and antioxidative responses and the intestinal digestive enzymes and histomorphometry features of Nile tilapia (Oreochromis niloticus). Fish Physiol. Biochem. 2021, 47, 869–880. [Google Scholar] [CrossRef] [Scilit]
- Elbialy, Z.I.; Salah, A.S.; Elsheshtawy, A.; Rizk, M.; Abualreesh, M.H.; Abdel-Daim, M.M.; Salem, S.M.R.; Askary, A.E.; Assar, D.H. Exploring the Multimodal Role of Yucca schidigera Extract in Protection against Chronic Ammonia Exposure Targeting: Growth, Metabolic, Stress and Inflammatory Responses in Nile Tilapia (Oreochromis niloticus L.). Animals 2021, 11, 2072. [Google Scholar] [CrossRef] [Scilit]
- Sakai, M. Current Status of Fish Immunostimulants. Aquaculture 1999, 172, 63–92. [Google Scholar] [CrossRef] [Scilit]
- Moustafa, E.M.; Dawood, M.A.O.; Assar, D.H.; Omar, A.A.; Elbialy, Z.I.; Farrag, F.A.; Shukry, M.; Zayedg, M.M. Modulatory effects of fenugreek seeds powder on the histopathology, oxidative status, and immune related gene expression in Nile tilapia (Oreochromis niloticus) infected with Aeromonas hydrophila. Aquaculture 2020, 515, 734589. [Google Scholar] [CrossRef] [Scilit]
- Clifford, T.; Acton, J.P.; Cocksedge, S.P.; Davies, K.A.B.; Bailey, S.J. The effect of dietary phytochemicals on nuclear factor erythroid 2-related factor 2 (Nrf2) activation: A systematic review of human intervention trials. Mol. Biol. Rep. 2021, 48, 1745–1761. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pizzino, G.; Irrera, N.; Cucinotta, M.; Pallio, G.; Mannino, F.; Arcoraci, V.; Squadrito, F.; Altavilla, D.; Bitto, A. Oxidative Stress: Harms and Benefits for Human Health. Oxid. Med. Cell. Longev. 2017, 2017, 8416763. [Google Scholar] [CrossRef] [Scilit]
- Thimmulappa, R.K.; Chattopadhyay, I.; Rajasekaran, S. Oxidative Stress Mechanisms in the Pathogenesis of Environmental Lung Diseases. In Oxidative Stress in Lung Diseases; Chakraborti, S., Parinandi, N.L., Ghosh, R., Ganguly, N.K., Chakraborti, T., Eds.; Springer: Singapore, 2020; Volume 2, pp. 103–137. [Google Scholar]
- Sharifi-Rad, M.; Anil Kumar, N.V.; Zucca, P.; Varoni, E.M.; Dini, L.; Panzarini, E.; Rajkovic, J.; Tsouh Fokou, P.V.; Azzini, E.; Peluso, I.; et al. Lifestyle, Oxidative Stress, and Antioxidants: Back and Forth in the Pathophysiology of Chronic Diseases. Front. Phys. 2020, 11, 694. [Google Scholar] [CrossRef] [Scilit]
- Matin, S.; Nemati, A.; Ghobadi, H.; Alipanah-Moghadam, R.; Rezagholizadeh, L. The effect of conjugated linoleic acid on oxidative stress and matrix metalloproteinases 2 and 9 in patients with COPD. Int. J. Chronic Obstr. Pulm. Dis. 2018, 13, 1449–1454. [Google Scholar] [CrossRef] [Scilit]
- Pisoschi, A.M.; Pop, A.; Iordache, F.; Stanca, L.; Geicu, O.I.; Bilteanu, L.; Serban, A.I. Antioxidant, anti-inflammatory and immunomodulatory roles of vitamins in COVID-19 therapy. Eur. J. Med. Chem. 2022, 232, 114175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ardó, L.; Yin, G.; Xu, P.; Váradi, L.; Szigeti, G.; Jeney, Z.; Jeney, G. Chinese herbs (Astragalus membranaceus and Lonicera japonica) and boron enhance the non-specific immune response of Nile tilapia (Oreochromis niloticus) and resistance against Aeromonas hydrophila. Aquaculture 2008, 275, 26–33. [Google Scholar] [CrossRef] [Scilit]
- Vaseeharan, B.; Thaya, R. Medicinal plant derivatives as immunostimulants: An alternative to chemotherapeutics and antibiotics in aquaculture. Aqua. Inter. 2014, 22, 3. [Google Scholar] [CrossRef] [Scilit]
- Wang, W.; Sun, J.; Liu, C.; Xue, Z. Application of immunostimulants in aquaculture: Current knowledge and future perspectives. Aquac. Res. 2017, 48, 1–23. [Google Scholar] [CrossRef] [Scilit]
- Rahimi, N.M.N.; Natrah, I.; Loh, J.Y.; Ervin-Ranzil, F.K.; Gina, M.; Lim, S.E.; Lai, K.S.; Chong, C.M. Phytocompounds as an Alternative Antimicrobial Approach in Aquaculture. Antibiotics 2022, 11, 469. [Google Scholar] [CrossRef] [Scilit]
- Kapellakis, I.E.; Tsagarakis, K.P.; Crowther, J.C. Olive oil history, production and by-product management. Rev. Environ. Sci. Biotechnol. 2008, 7, 1–26. [Google Scholar] [CrossRef] [Scilit]
- Baba, E.; Acar, Ü.; Yılmaz, S.; Zemheri, F.; Ergün, S. Dietary olive leaf (Olea europea L.) extract alters some immune gene expression levels and disease resistance to Yersinia ruckeri infection in rainbow trout Oncorhynchus mykiss. Fish. Shellfish. Immunol. 2018, 79, 28–33. [Google Scholar] [CrossRef] [Scilit]
- Gokdogan, O.; Erdogan, O. Evaluation of Energy Balance in Organic Olive (Olea europaea L.) Production in Turkey. Erwerbs-Obstbau 2018, 60, 47–52. [Google Scholar] [CrossRef] [Scilit]
- Bradaï, F.; Sánchez-Romero, C.; Martín, C. Somaclonal variation in olive (Olea europaea L.) plants regenerated via somatic embryogenesis: Influence of genotype and culture age on genetic stability. Sci. Hortic. 2019, 251, 260–266. [Google Scholar] [CrossRef] [Scilit]
- Acar-Tek, N.; Agagündüz, D. Olive leaf (Olea europaea L. folium): Potential effects on Glycemia and Lipidemia. Ann. Nutr. Metab. 2020, 76, 10–15. [Google Scholar] [CrossRef] [Scilit]
- Cho, W.Y.; Kim, D.H.; Lee, H.J.; Yeon, S.J.; Lee, C.H. Evaluation of effect of extraction solvent on selected properties of olive leaf extract. J. Food Qual. 2020, 2020, 3013649. [Google Scholar] [CrossRef] [Scilit]
- Benavente-Garcıa, O.; Castillo, J.; Lorente, J.; Ortuno, A.; Del Rio, J. Antioxidant activity of phenolics extracted from Olea europaea L. leaves. Food Chem. 2000, 68, 457–462. [Google Scholar] [CrossRef] [Scilit]
- Waterman, E.; Lockwood, B. Active components and clinical applications of olive oil. Altern. Med. 2007, 12, 331–342. [Google Scholar]
- Micol, V.; Caturla, N.; Pérez-Fons, L.; Más, V.; Pérez, L.; Estepa, A. The olive leaf extract exhibits antiviral activity against viral haemorrhagic septicaemia rhabdovirus (VHSV). Antivir. Res. 2005, 66, 129–136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zemheri-Navruz, F.; Acar, Ü.; Yılmaz, S. Dietary supplementation of olive leaf extract increases haematological, serum biochemical parameters and immune related genes expression level in common carp (Cyprinus carpio) juveniles. Fish Shellfish. Immunol. 2019, 89, 672–676. [Google Scholar] [CrossRef] [Scilit]
- FAO. Fishery and Aquaculture Statistics Yearbook; FAO Publications: Rome, Italy, 2014; p. 103. [Google Scholar]
- FAO. Available online: https://www.fao.org/fishery/en/aqspecies/fcp (accessed on 20 June 2023).
- Ljubojevic, D.; Radosavljevic, V.; Puvaca, N.; Zivkov Balos, M.; Dorpevic, V.; Jovanovic, R.; Cirkovic, M. Interactive effects of dietary protein level and oil source on proximate composition and fatty acid composition in common carp (Cyprinus carpio L.). J. Food Compos. Anal. 2015, 37, 44–50. [Google Scholar] [CrossRef] [Scilit]
- Yousefi, M.; Hoseini, S.M.; Vatnikov, Y.A.; Nikishov, A.A.; Kulikov, E.V. Thymol as a new anesthetic in common carp (Cyprinus carpio): Efficacy and physiological effects in comparison with eugenol. Aquaculture 2018, 495, 376–383. [Google Scholar] [CrossRef] [Scilit]
- Way, K.; Haenen, O.; Stone, D.; Adamek, M.; Bergmann, S.M.; Bigarré, L.; Diserens, N.; El-Matbouli, M.; Gjessing, M.C.; JungSchroers, V.; et al. Emergence of carp edema virus (CEV) and its significance to European common carp and koi Cyprinus carpio. Dis. Aquat. Org. 2017, 126, 155–166. [Google Scholar] [CrossRef] [Scilit]
- Baloch, A.A.; Abdelsalam, E.E.E.; Piačková, V. Cytokines Studied in Carp (Cyprinus carpio L.) in Response to Important Diseases. Fishes 2022, 7, 3. [Google Scholar] [CrossRef] [Scilit]
- Pridgeon, J.; Klesius, P. Virulence of Aeromonas hydrophila to channel catfish Ictaluras punctatus fingerlings in the presence and absence of bacterial extracellular products. Dis. Aquat. Org. 2011, 95, 209–215. [Google Scholar] [CrossRef] [Scilit]
- Guz, L.; Kozinska, A. Antibiotic susceptibility of Aeromonas hydrophila and A. sobria isolated from farmed carp (Cyprinus carpio L.). Bull. Vet. Inst. Pulawy 2004, 48, 391–395. [Google Scholar]
- Stratev, D.; Stoev, S.; Vashin, I.; Daskalov, H. Some varieties of pathological changes in eximentalper infection of carps (Cyprinus carpio) with Aeromonas hydrophila. J. Aquacult. Eng. Fish. Res. 2015, 1, 191–202. [Google Scholar] [CrossRef] [Scilit]
- Plumb, J.A.; Hanson, L.A. Health Maintenance and Principal Microbial Diseases of Cultured Fishes; John Wiley & Sons: Hoboken, NJ, USA, 2011. [Google Scholar]
- Dong, H.T.; Techatanakitarnan, C.; Jindakittikul, P.; Thaiprayoon, A.; Taengphu, S.; Charoensapsri, W.; Khunrae, P.; Rattanarojpong, T.; Senapin, S. Aeromonas jandaei and Aeromonas veronii caused disease and mortality in Nile tilapia, Oreochromis niloticus (L.). J. Fish. Dis. 2017, 40, 1395–1403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Savournin, C.; Baghdikian, B.; Elias, R.; Dargouth-Kesraoui, F.; Boukef, K.; Balansard, G. Rapid high-performance liquid chromatography analysis for the quantitative determination of oleuropein in Olea europaea leaves. J. Agricult. Food Chem. 2001, 49, 618–621. [Google Scholar] [CrossRef] [Scilit]
- Salah, A.S.; El-Nagar, S.H.; Elsheshtawy, A.; Al-Dhuayan, I.; Fouad, A.M.; Alnamshan, M.M.; Kadira, H.I.; Alaqeel, N.K.; El-Shobokshy, S.A.; Shukry, M.; et al. Exploring the multimodal role of Cnicus benedictus extract in the modulation of growth, hematobiochemical, histopathological, antioxidative performance, and immune-related gene expression of Oreochromis niloticus challenged with Aeromonas hydrophila. Front. Mar. Sci. 2022, 9, 993616. [Google Scholar] [CrossRef] [Scilit]
- Elsheshtawy, A.; Yehia, N.; Elkemary, M.; Sloiman, H. Investigation of Nile tilapia Summer Mortality in Kafr El-Sheikh Governorate. Egypt. Gen. Aqua. Organ. 2019, 3, 17–25. [Google Scholar] [CrossRef]
- Abdel-Tawwab, M.; El-Araby, D.A. Immune and antioxidative effects of dietary licorice (Glycyrrhiza glabra L.) on performance of Nile tilapia, Oreochromis niloticus (L.) and its susceptibility to Aeromonas hydrophila infection. Aquaculture 2021, 530, 735828. [Google Scholar] [CrossRef] [Scilit]
- Natt, M.P.; Herrick, C.A. A new blood diluent for counting the erythrocytes and leucocytes of the chicken. Poult. Sci. 1952, 31, 735–738. [Google Scholar] [CrossRef] [Scilit]
- Stoskoph, M. Fish Medicine; W.B. Saunders Company: Readfield, ME, USA, 1993; pp. 116, 128, 129. [Google Scholar]
- Abo-Al-Ela, H.G.; El-Nahas, A.F.; Mahmoud, S.; Ibrahim, E.M. Vitamin C modulates the immunotoxic effect of 17α-methyltestosterone in Nile tilapia. Biochemistry 2017, 56, 2042–2050. [Google Scholar] [CrossRef] [Scilit]
- Burtis, C.A.; Ashwood, E.R. Tietz Text Book of Clinical Chemistry; W.B. Saunders Co. Ltd.: Readfield, ME, USA, 1999; p. 523. [Google Scholar]
- Dumas, B.T.; Biggs, H.G. Slandered Methods of Clinical Chemistry; Academic Press: New York, NY, USA, 1972; p. 7. [Google Scholar]
- Reitman, S.; Frankel, S. A colorimetric method for the determination of serum oxalacetic and glutamic pyruvic transaminase. Am. J. Glutamic Clin. Pathol. 1957, 28, 56–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richmond, W. Enzymatic determination of cholesterol. Clin. Chem. 1973, 19, 1350. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Henry, R.J.; Canmon, D.C.; Winkelman, J.W. Clinical Chemistry: Principles and Techniques, 11th ed.; Happer and Row Publishers: New York, NY, USA, 1974; p. 1629. [Google Scholar]
- Szasz, G.; Waldenstrom, J.; Gruber, W. Creatine kinase in serum: 6. Inhibition by endogenous polyvalent cations, and effect of chelators on the activity and stability of some assay components. Clin. Chem. 1979, 25, 446–452. [Google Scholar] [CrossRef] [Scilit]
- Kaneko, J.J. Clinical Biochemistry of Domestic Animals, 4th ed.; Academic Press: Cambridge, MA, USA, 1989; pp. 146–159, 612–647. [Google Scholar]
- Demers, N.E.; Bayne, C.J. The immediate effects of stress on hormones and plasma lysozyme in rainbow trout. Dev. Comp. Immunol. 1997, 21, 363–373. [Google Scholar] [CrossRef] [Scilit]
- Secombes, C.J. Isolation of salmonid macrophages and analysis of their killing activity. Technol. Fish Immunol. 1990, 1, 137–163. [Google Scholar]
- Garcia-Carreño, F.L.; Haard, N.F. Characterization of proteinase classes in langostilla (Pleuroncodes planipes) and crayfish (Pacifastacus astacus) extracts. J. Food Biochem. 1993, 17, 97–113. [Google Scholar] [CrossRef] [Scilit]
- Junge, W.; Wortmann, W.; Wilke, B.; Waldenström, J.; Kurrle-Weittenhiller, A.; Finke, J.; Klein, G. Development and evaluation of assays for the determination of total and pancreatic amylase at 37 °C according to the principle recommended by the IFCC. Clin. Biochem. 2001, 34, 607–615. [Google Scholar] [CrossRef] [Scilit]
- Panteghini, M.M.D.; Bais, R. Ezymes. In Tietz Fundamentals of Clinical Chemistry, 6th ed.; Burtis, C.A., Ashwood, E.R., Bdsm, D., Eds.; Saunders ELSEVIER: Philadelphia, PA, USA, 2008; pp. 317–336. [Google Scholar]
- Bassey, O.A.; Lowry, O.H.; Brock, M.J. A Method for the Rapid Determination of Alkaline Phosphates with Five Cubic Millimetres of Serum. J. Biol. Chem. 1946, 164, 321–325. [Google Scholar] [CrossRef] [Scilit]
- Wright, P.J.; Leatherwood, P.D.; Plummer, D.T. Enzymes in Rats: Alkaline Phosphatase. Enzymologia 1972, 42, 317–327. [Google Scholar] [PubMed]
- Ohkawa, H.; Ohishi, N.; Yagi, K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem. 1979, 95, 351–358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McCord, J.M.; Fridovich, I. Superoxide Dismutase: An enzyme function for erythrocuprein (hemocurrein). J. Biol. Chem. 1969, 244, 6049–6055. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aebi, H. Catalase in vitro. Methods Enzymol. 1984, 105, 121–126. [Google Scholar] [PubMed]
- Paglia, D.E.; Valentine, W.N. Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase. J. Lab. Clin. Med. 1967, 70, 158–169. [Google Scholar]
- Agus, H.H.; Sumer, S.; Erkoc, F. Toxicity and molecular effects of di-n-butyl phthalate (DBP) on CYP1A, SOD, and GPx in Cyprinus carpio (common carp). Environ. Monit. Assess 2015, 187, 423. [Google Scholar] [CrossRef] [Scilit]
- Jia, R.; Cao, L.P.; Du, J.L.; Wang, J.H.; Liu, Y.J.; Jeney, G.; Xu, P.; Yin, G.J. Effects of carbon tetrachloride on oxidative stress, inflammatory response and hepatocyteapoptosisincommon carp (Cyprinus carpio). Aquat. Toxicol. 2014, 152, 11–19. [Google Scholar] [CrossRef] [Scilit]
- Chen, W.; Lin, H.; Li, W. Molecular cloning and expression profiles of IGFBP-1a in common carp (Cyprinus carpio) and its expression regulation by growth hormone in hepatocytes. Comp. Biochem. Physiol. Part B 2018, 221–222, 50–59. [Google Scholar] [CrossRef] [Scilit]
- Jiang, W.D.; Hu, K.; Zhang, J.X.; Liu, Y.; Jiang, J.; Wu, P.; Zhao, J.; Kuang, S.Y.; Tang, L.; Tang, W.N.; et al. Soyabean glycinin depresses intestinal growth and function in juvenile Jian carp (Cyprinus carpio var Jian): Protective effects of glutamine. Br. J. Nutr. 2015, 114, 1569–1583. [Google Scholar] [CrossRef] [Scilit]
- Pelyhe, C.; Kövesi, B.; Zándoki, E.; Kovács, B.; Szabó-Fodor, J.; Mézes, M.; Balogh, K. Short-term effects of T-2 toxin or deoxynivalenol on lipid peroxidation and the glutathione system in common carp. Acta Vet. Hung. 2016, 64, 449–466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)). Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Ghalwash, H.R.; Salah, A.S.; El-Nokrashy, A.M.; Abozeid, A.M.; Zaki, V.H.; Mohamed, R.A. Dietary supplementation with Bacillus species improves growth, intestinal histomorphology, innate immunity, antioxidative status and expression of growth and appetite-regulating genes of Nile tilapia fingerlings. Aquacult. Res. 2021, 53, 1378–1394. [Google Scholar] [CrossRef] [Scilit]
- Tian, H.; Liu, Y.; Tian, Y.; Alabia, I.D.; Qin, Y.; Sun, H.; Li, J.; Ma, S.; Saitoh, S.I. A Comprehensive Monitoring and Assessment System for Multiple Fisheries Resources in the Northwest Pacific Based on Satellite Remote Sensing Technology. Front. Mar. Sci. 2022, 9, 808282. [Google Scholar] [CrossRef] [Scilit]
- Ben Saad, A.; Tiss, M.; Keskes, H.; Chaari, A.; Sakavitsi, M.E.; Hamden, K.; Halabalaki, M.; Allouche, N. Antihyperlipidemic, Antihyperglycemic, and Liver Function Protection of Olea europaea var. Meski Stone and Seed Extracts: LC-ESI-HRMS-Based Composition Analysis. J. Diabetes Res. 2021, 2021, 6659415. [Google Scholar] [CrossRef] [Scilit]
- Ammar, S.; Contreras, M.D.M.; Gargouri, B.; Segura-Carretero, A.; Bouaziz, M. RP-HPLC-DAD-ESI-QTOF-MS based metabolic profiling of the potential Olea europaea by-product “wood” and its comparison with leaf counterpart. Phytochem. Anal. 2017, 28, 217–229. [Google Scholar] [CrossRef] [Scilit]
- Essafi, H.; Trabelsi, N.; Benincasa, C.; Tamaalli, A.; Perri, E.; Zarrouk, M. Phytochemical profile, antioxidant and antiproliferative activities of olive leaf extracts from autochthonous Tunisian cultivars. Acta Aliment. 2019, 48, 384–390. [Google Scholar] [CrossRef] [Scilit]
- Obeid, H.K.; Bedgood, D.R., Jr.; Prenzler, P.D.; Robards, K. Chemical screening of olive biophenol extracts by hyphenated liquid chromatography. Anal. Chim. Acta 2007, 603, 176–189. [Google Scholar] [CrossRef] [Scilit]
- Benincasa, C.; Romano, E.; Pellegrino, M.; Perri, E. Characterization of phenolic profiles of Italian single cultivar olive leaves (Olea europaea L.) by mass spectrometry. Mass Spectrom. Purif. Technol. 2018, 4, 1–8. [Google Scholar] [CrossRef]
- Ben Mohamed, M.; Guasmi, F.; Ben Ali, S.; Radhouani, F.; Faghim, J.; Triki, T.; Kammoun, N.G.; Baffi, C.; Lucini, L.; Benincasa, C. The LC-MS/MS characterization of phenolic compounds in leaves allows classifying olive cultivars grown in South Tunisia. Biochem. Syst. Ecol. 2018, 78, 84–90. [Google Scholar] [CrossRef] [Scilit]
- Abbattista, R.; Ventura, G.; Calvano, C.D.; Cataldi, T.R.; Losito, I. Bioactive compounds in waste by-products from olive oil production: Applications and structural characterization by mass spectrometry techniques. Foods 2021, 10, 1236. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bajoub, A.; Carrasco-Pancorbo, A.; Ouazzani, N.; Fernández-Gutiérrez, A. Potential of LC–MS phenolic profiling combined with multivariate analysis as an approach for the determination of the geographical origin of north Moroccan virgin olive oils. Food Chem. 2015, 166, 292–300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quirantes-Piné, R.; Lozano-Sánchez, J.; Herrero, M.; Ibáñez, E.; Segura-Carretero, A.; Fernández-Gutiérrez, A. HPLC–ESI–QTOF–MS as a powerful analytical tool for characterising phenolic compounds in olive-leaf extracts. Phytochem. Anal. 2013, 24, 213–223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Talhaoui, N.; Gómez-Caravaca, A.M.; León, L.; De la Rosa, R.; Segura-Carretero, A.; Fernández-Gutiérrez, A. Determination of phenolic compounds of ‘Sikitita’ olive leaves by HPLC-DAD-TOF-MS. Comparison with its parents Arbequina’ and ‘Picual’ olive leaves. LWT—Food Sci. Technol. 2014, 58, 28–34. [Google Scholar] [CrossRef] [Scilit]
- Michel, T.; Khlif, I.; Kanakis, P.; Termentzi, A.; Allouche, N.; Halabalaki, M.; Skaltsounis, A.L. UHPLC-DAD-FLD and UHPLC-HRMS/MS based metabolic profiling and characterization of different Olea europaea organs of Koroneiki and Chetoui varieties. Phytochem. Lett. 2015, 11, 424–439. [Google Scholar] [CrossRef] [Scilit]
- Kuwajima, H.; Uemura, T.; Takaishi, K.; Inoue, K.; Inouyet, H. A secoiridoid glucoside from Olea europaea. Phytochemistry 1988, 27, 1757–1759. [Google Scholar] [CrossRef] [Scilit]
- Zemheri-Navruz, F.; Acar, Ü.; Yılmaz, S. Dietary supplementation of olive leaf extract enhances growth performance, digestive enzyme activity and growth related genes expression in common carp Cyprinus carpio. Gen. Comp. Endocrinol. 2020, 296, 113541. [Google Scholar] [CrossRef] [Scilit]
- Fadl, S.E.; El-Habashi, N.; Gad, D.M.; Elkassas, W.M.; Elbialy, Z.I.; Abdelhady, D.H.; Hegazi, S.M. Effect of adding Dunaliella algae to fish diet on lead acetate toxicity and gene expression in the liver of Nile tilapia. Toxin Rev. 2019, 40, 1155–1171. [Google Scholar] [CrossRef] [Scilit]
- Mokhbatly, A.A.; Assar, D.H.; Ghazy, E.G.; Elbialy, Z.I.; Rizk, S.A.; Omar, A.A.; Gaafar, A.Y.; Dawood, M.A.O. The protective role of spirulina and β-glucan in African catfish (Clarias gariepinus) against chronic toxicity of chlorpyrifos: Hemato-biochemistry, histopathology, and oxidative stress traits. Environ. Sci. Pollut. Res. 2020, 27, 31636–31651. [Google Scholar] [CrossRef] [Scilit]
- Yilmaz, S.; Çoban, N.; Ergün, S.; Yigit, M.; Çelik, E.Ş. Combined Effects of Dietary Bacillus subtilis and Trans-cinnamic Acid on Growth Performance, Whole Body Compositions, Digestive Enzymes and Intestinal bacteria in Rainbow Trout (Oncorhynchus mykiss). J. Zool. Res. 2019, 1, 17–25. [Google Scholar] [CrossRef] [Scilit]
- Lammi, C.; Bartolomei, M.; Bollati, C.; Cecchi, L.; Bellumori, M.; Sabato, E.; Arnoldi, A. Phenolic Extracts from Extra Virgin Olive Oils Inhibit Dipeptidyl Peptidase IV Activity: In Vitro, Cellular, and In Silico Molecular Modeling Investigations. Antioxidants 2021, 10, 1133. [Google Scholar] [CrossRef] [Scilit]
- Kaleeswaran, B.; Ilavenil, S.; Ravikumar, S. Growth response, feed conversion ratio and antiprotease activity of Cynodon dactylon (L.) mixed diet in Catla catla (Ham.). J. Anim. Vet. Adv. 2011, 10, 511–517. [Google Scholar]
- Agah, M.J.; Mirakzehi, M.T.; Saleh, H. Effects of olive leaf extract (olea europea L.) On growth performance, blood metabolites and antioxidant activities in broiler chickens under heat stress. J. Anim. Plant Sci. 2019, 29, 657–666. [Google Scholar]
- Marhamatizadeh, M.H.; Ehsandoost, E.; Gholami, P.; Mohaghegh, M.D. Effect of Olive Leaf Extract on Growth and Viability of Lactobacillus acidophilus and Bifidobacterium bifidum for Production of Probiotic Milk and Yoghurt. Inter. J. Farm. Allied Sci. 2013, 2, 572–578. [Google Scholar]
- Shen, Y.; Song, S.J.; Keum, N.; Park, T. Olive leaf extract attenuates obesity in high-fat diet-fed mice by modulating the expression of molecules involved in adipogenesis and thermogenesis. Evid. Based Complement. Alternat. Med. 2014, 2014, 971890. [Google Scholar] [CrossRef] [Scilit]
- Kabaran, S. Olive Oil: Antioxidant Compounds and Their Potential Effects over Health. In Functional Foods; Intech Open: London, UK, 2018. [Google Scholar] [CrossRef] [Scilit]
- Sato, H.; Genet, C.; Strehle, A.; Thomas, C.; Lobstein, A.; Wagner, A.; Mioskowski, C.; Auwerx, J.; Saladin, R. Anti-hyperglycemic activity of a TGR5 agonist isolated from Olea europaea. Biochem. Biophys. Res. Commun. 2007, 3, 793–798. [Google Scholar] [CrossRef] [Scilit]
- Carnevale, R.; Silvestri, R.; Loffredo, L.; Novo, M.; Cammisotto, V.; Castellani, V.; Bartimoccia, S.; Nocella, C.; Violi, F. Oleuropein, a component of extra virgin olive oil, lowers postprandial glycaemia in healthy subjects. Br. J. Clin. Pharmacol. 2018, 84, 1566–1574. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Chen, T.; Wang, H.; Wu, X.; Cao, Q.; Wen, K.; Deng, K.Y.; Xin, H. Engineered Bacteria of MG1363-pMG36e-GLP-1 Attenuated Obesity-Induced by High Fat Diet in Mice. Front. Cell. Infect. Microbiol. 2021, 11, 595575. [Google Scholar] [CrossRef] [Scilit]
- Hsu, T.M.; Hahn, J.D.; Konanur, V.R.; Lam, A.; Kanoski, S.E. Hippocampal GLP-1 Receptors Influence Food Intake, Meal Size, and Effort-Based Responding for Food through Volume Transmission. Neuropsychopharmacology 2015, 40, 327–337. [Google Scholar] [CrossRef] [Scilit]
- Cremonini, E.; Iglesias, D.E.; Matsukuma, K.E.; Hester, S.N.; Wood, S.M.; Bartlett, M.; Fraga, C.G.; Oteiza, P.I. Supplementation with cyanidin and delphinidin mitigates high fat diet-induced endotoxemia and associated liver inflammation in mice. Food Funct. 2022, 13, 781. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sudjana, A.N.; D’Orazio, C.; Ryan, V.; Rasool, N.; Ng, J.; Islam, N.; Riley, T.V.; Hammer, K.A. Antimicrobial activity of commercial Olea europaea (olive) leaf extract. Int. J. Antimicrob. Agents 2009, 33, 461–463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gullón, B.; Gullón, P.; Eibes, G.; Cara, C.; De Torres, A.; López-Linares, J.C.; Ruiz, E.; Castro, E. Valorisation of olive agro-industrial by-products as a source of bioactive compounds. Sci. Total Environ. 2018, 645, 533–542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Centrone, M.; Ranieri, M.; Di Mise, A.; D’Agostino, M.; Venneri, M.; Valenti, G.; Tamma, G. Health benefits of olive oil and by-products and possible innovative applications for industrial processes. Funct. Foods Health Dis. 2021, 11, 295–309. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Wandler, A.M.; Postlethwait, J.H.; Guillemin, K. Dynamic evolution of the LPS-detoxifying enzyme intestinal alkaline phosphatase in zebrafish and other vertebrates. Front. Immun. 2012, 3, 314. [Google Scholar] [CrossRef] [Scilit]
- Wang, W.; Chen, S.-W.; Zhu, J.; Zuo, S.; Ma, Y.-Y.; Chen, Z.-Y.; Zhang, J.-L.; Chen, G.-W.; Liu, Y.-C.; Wang, P.-Y. Intestinal alkaline phosphatase inhibits the translocation of bacteria of gut-origin in mice with peritonitis: Mechanism of action. PLoS ONE 2015, 10, e0124835. [Google Scholar] [CrossRef] [Scilit]
- Bates, J.M.; Akerlund, J.; Mittge, E.; Guillemin, K. Intestinal alkaline phosphatase detoxifies lipopolysaccharide and prevents inflammation in zebrafish in response to the gut microbiota. Cell Host Microbe 2007, 2, 371–382. [Google Scholar] [CrossRef] [Scilit]
- Wenk, C. Herbs, botanicals and other related substances. In Proceedings of the 11th European Poultry Conference, Bremen, Germany, 6–10 September 2002. [Google Scholar]
- Shiry, N.; Soltanian, S.; Shomali, T.; Paknejad, H.; Hoseinifar, H. Immunomodulatory effects of orally administrated florfenicol in rainbow trout (Oncorhynchus mykiss) following experimental challenge with streptococcosis/lactococcosis. Int. Immunopharmacol. 2019, 73, 236–245. [Google Scholar] [CrossRef] [Scilit]
- Gholamhosseini, A.; Kheirandish, M.R.; Shiry, N.; Akhlaghi, M.; Soltanian, S.; Roshanpour, H.; Banaee, M. Use of a methanolic olive leaf extract (Olea europaea) against white spot virus syndrome in shrimp Litopenaeus vannamei, comparing changes in hematological, biochemical and immunological parameters. Aquaculture 2020, 528, 735556. [Google Scholar] [CrossRef] [Scilit]
- Gisbert, K.B.; Andree Quintela, J.C.; Calduch-Giner, J.A.; Ipharraguerre, I.R.; Perez Sanchez, J. Olive oil bioactive compounds increase body weight, and improve gut health and integrity in gilthead sea bream (Sparus aurata). Br. J. Nutr. 2017, 117, 351–363. [Google Scholar] [CrossRef] [Scilit]
- Biller, J.D.; Takahashi, L.S. Oxidative stress and fish immune system: Phagocytosis and leukocyte respiratory burst activity. An. Acad. Bras. Cienc. 2018, 90, 3403–3414. [Google Scholar] [CrossRef] [Scilit]
- Leouifoudi, I.; Harnafi, H.; Zyad, A. Olive mill waste extracts: Polyphenolscontent, antioxidant, and antimicrobial activities. Adv. Pharmacol. Sci. 2015, 2015, 714138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rebollada-Merino, A.; B’arcena, C.; Ugarte-Ruiz, M.; Porras, N.; Mayoral-Alegre, F.J.; Tomè-Sanchez, I.; Domínguez, L.; Rodríguez-Bertos, A. Effects on intestinal mucosal morphology, productive parameters and microbiota composition after supplementation with fermented defatted alperujo (FDA) in laying hens. Antibiotics 2019, 8, 215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Branciari, R.; Ranucci, D.; Ortenzi, R.; Roila, R.; Trabalza-Marinucci, M.; Servili, M.; Papa, P.; Galarini, R.; Valiani, A. Dietary Administration of Olive Mill Wastewater Extract Reduces Campylobacter spp. Prevalence in Broiler Chickens. Sustainability 2016, 8, 837. [Google Scholar] [CrossRef] [Scilit]
- Lee, K.K.; Ellis, A.E. Glycerophospholipid: Cholesterol acyltransferase complexed with lipopolysaccharide (LPS) is a major lethal exotoxin and cytolysin of Aeromonas salmonicida: LPS stabilizes and enhances toxicity of the enzyme. J. Bacteriol. 1990, 172, 5382–5393. [Google Scholar] [CrossRef] [Scilit]
- Hirst, I.D.; Hastings, T.S.; Ellis, A.E. Utilization of haem compounds by Aeromonas salmonicida. J. Fish Dis. 1994, 17, 365–373. [Google Scholar] [CrossRef] [Scilit]
- Benjamin, M.M. Outline of Veterinary Clinical Pathology, 4th ed.; Iowa State University Press: Ames, IA, USA, 1984; pp. 123–129. [Google Scholar]
- Udoh, J.; Emah, A.U.; George, I.E.; Philip, A.E. Growth performance and haematological response of Clarias gariepinus broodstock fed diets enriched with bitter leaf meal. Bioflux 2017, 10, 1281–1296. [Google Scholar]
- Roitt, M.I.; Brostoff, J.; Male, K.D. Immunology; Churchill Livingstone: Edinburg, UK; London, UK; Melbourne, Australia; New York, NY, USA, 1985. [Google Scholar]
- Adel, M.; Dadar, M.; Khajavi, S.H.; Pourgholam, R.; Karimí, B.; Velisek, J. Hematological, biochemical and histopathological changes in Caspian brown trout (Salmo trutta caspius Kessler, 1877) following exposure to sublethal concentrations of chlorpyrifos. Toxin Rev. 2017, 36, 73–79. [Google Scholar] [CrossRef] [Scilit]
- Farag, M.R.; Alagawany, M.; Taha, H.S.; Ismail, T.A.; Khalil, S.R.; Abou-Zeid, S.M. Immune response and susceptibility of Nile tilapia fish to Aeromonas hydrophila infection following the exposure to Bifenthrin and/or supplementation with Petroselinum crispum essential oil. Ecotoxicol. Environm. Saf. 2021, 216, 112205. [Google Scholar] [CrossRef] [Scilit]
- Mohamed, R.A.; Elbialy, Z.I.; Abd El Latif, A.S.; Shukry, M.; Assar, D.H.; El Nokrashy, A.M.; Elsheshtawy, A.; Dawood, M.A.O.; Bilal, B.; Van Doan, H.; et al. Dietary clenbuterol modifies the expression of genes involved in the regulation of lipid metabolism and growth in the liver, skeletal muscle, and adipose tissue of Nile tilapia (Oreochromis niloticus). Aquac. Rep. 2020, 17, 100319. [Google Scholar] [CrossRef] [Scilit]
- Van Doan, H.; Hoseinifar, S.H.; Srigarm, K.; Jaturasitha, S.; Yuangsoi, B.; Dawood, M.A.O.; Esteban, M.A.; Ringo, E.; Faggio, C. Effects of Assam tea extract on growth, skin mucus, serum immunity and disease resistance of Nile tilapia (Oreochromis niloticus) against Streptococcus agalactiae. Fish Shellfish. Immunol. 2019, 93, 428–435. [Google Scholar] [CrossRef] [Scilit]
- Hoseinifar, S.H.; Shakouri, M.; Yousefi, S.; Van Doan, H.; Shafiei, S.; Yousefi, M.; Mazandarani, M.; Mozanzadeh, M.T.; Tulino, M.G.; Faggio, C. Humoral and skin mucosal immune parameters, intestinal immune related genes expression and antioxidant defense in rainbow trout (Oncorhynchus mykiss) fed olive (Olea europea L.) waste. Fish. Shellfish. Immunol. 2020, 100, 171–178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vallejos-Vidal, E.; Reyes-López, F.; Teles, M.; MacKenzie, S. The response of fish to immunostimulant diets. Fish Shellfish. Immunol. 2016, 56, 34–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, T.H.; Qiu, F.; Waller, G.R.; Chou, C.H. Three new flavonol galloylglycosides from leaves of Acacia confusa. J. Nat. Prod. 2000, 63, 710–712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Magnadottir, B. Immunological Control of Fish Diseases. Mar. Biotechnol. 2010, 12, 361–379. [Google Scholar] [CrossRef] [Scilit]
- Reverte, M.; Snäkä, T.; Fasel, N. The Dangerous Liaisons in the Oxidative Stress Response to Leishmania Infection. Pathogens 2022, 11, 409. [Google Scholar] [CrossRef] [Scilit]
- Hazreen-Nita, M.H.; Abdul Kari, Z.; Mat, K.; Rusli, N.D.; Sukri, M.; Hasnita, S.A.M.; Harun, C.; Lee, S.W.; Rahman, M.M.; Norazmi-Lokman, N.H.; et al. Olive oil by-products in aquafeeds: Opportunities and challenges. Aquacult. Rep. 2022, 22, 100998. [Google Scholar] [CrossRef] [Scilit]
- Lee, O.H.; Lee, B.Y. Antioxidant and antimicrobial activities of individual and combined phenolics in Olea europaea leaf extract. Bioresour. Technol. 2010, 101, 3751–3754. [Google Scholar] [CrossRef] [Scilit]
- Abdel-Razek, A.G.; Badr, A.N.; Shehata, M.G. Characterization of olive oil byproducts: Antioxidant activity, its ability to reduce aflatoxigenic fungi hazard and its aflatoxins. Annu. Res. Rev. Biol. 2017, 14, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Checconi, P.; De Angelis, M.; Marcocci, M.E.; Fraternale, A.; Magnani, M.; Palamara, A.T.; Nencioni, L. Redox-Modulating Agents in the Treatment of Viral Infections. Int. J. Mol. Sci. 2020, 21, 4084. [Google Scholar] [CrossRef] [Scilit]
- Ahn, Y.J.; Kim, H. Lutein as a Modulator of Oxidative Stress-Mediated Inflammatory Diseases. Antioxidants 2021, 10, 1448. [Google Scholar] [CrossRef] [Scilit]
- Kobayashi, E.H.; Suzuki, T.; Funayama, R.; Nagashima, T.; Hayashi, M.; Sekine, H.; Tanaka, N.; Moriguchi, T.; Motohashi, H.; Nakayama, K.; et al. Nrf2 suppresses macrophage inflammatory response by blocking proinflammatory cytokine transcription. Nat. Commun. 2016, 7, 11624. [Google Scholar] [CrossRef] [Scilit]
- Al-Quraishy, S.; Othman, M.S.; Dkhil, M.A.; Abdel Moneim, A.E. Olive (Olea europaea) leaf methanolic extract prevents HCl/ethanol-induced gastritis in rats by attenuating inflammation and augmenting antioxidant enzyme activities. Biomed. Pharmacother. 2017, 91, 338–349. [Google Scholar] [CrossRef] [Scilit]
- Bedouhene, S.; Moulti-Mati, F.; Dang, P.M.; El-Benna, J. Oleuropein and hydroxytyrosol inhibit the N-formyl-methionylleucyl-phenylalanine-induced neutrophil degranulation and chemotaxis via AKT, p38, and ERK1/2 MAP-Kinase inhibition. Inflammopharmacology 2017, 25, 673–680. [Google Scholar] [CrossRef] [Scilit]
- Bucciantini, M.; Leri, M.; Nardiello, P.; Casamenti, F.; Stefani, M. Olive polyphenols: Antioxidant and anti-inflammatory properties. Antioxidants 2021, 10, 1044. [Google Scholar] [CrossRef] [Scilit]
- Zinovkin, R.; Grebenchikov, O. Transcription factor Nrf2 as a potential therapeutic target for prevention of cytokine storm in COVID-19 patients. Biochemistry 2020, 85, 833–837. [Google Scholar] [CrossRef] [Scilit]
- Haghjooy Javanmard, S.; Ziaei, A.; Ziaei, S.; Ziaei, E.; Mirmohammad-Sadeghi, M. The effect of preoperative melatonin on nuclear erythroid 2-related factor 2 activation in patients undergoing coronary artery bypass grafting surgery. Oxid. Med. Cell. Longev. 2013, 2013, 676829. [Google Scholar] [CrossRef] [Scilit]
- Li, M.; Huang, W.; Jie, F.; Wang, M.; Zhong, Y.; Chen, Q.; Lu, B. Discovery of Keap1-Nrf2 small-molecule inhibitors from phytochemicals based on molecular docking. Food Chem. Toxicol. 2019, 133, 110758. [Google Scholar] [CrossRef] [Scilit]
- Yuan, H.; Xu, Y.; Luo, Y.; Wang, N.X.; Xiao, J.H. Role of Nrf2 in cell senescence regulation. Mol. Cell. Biochem. 2021, 476, 247–259. [Google Scholar] [CrossRef] [Scilit]
- Kong, X.; Thimmulappa, R.; Craciun, F.; Harvey, C.; Singh, A.; Kombairaju, P.; Reddy, S.P.; Remick, D.; Biswal, S. Enhancing Nrf2 Pathway by Disruption of Keap1 in Myeloid Leukocytes Protects against Sepsis. Am. J. Respir. Crit. Care Med. 2011, 184, 928–938. [Google Scholar] [CrossRef] [Scilit]
- Thimmulappa, R.K.; Scollick, C.; Traore, K.; Yates, M.; Trush, M.A.; Liby, K.T.; Sporn, M.B.; Yamamoto, M.; Kensler, T.W.; Biswal, S. Nrf2-dependent protection from LPS induced inflammatory response and mortality by CDDO-Imidazolide. Biochem. Biophys. Res. Commun. 2006, 351, 883–889. [Google Scholar] [CrossRef] [Scilit]
- Jiang, Y.; Feng, S.; Zhang, S.; Liu, H.; Feng, J.; Mu, X.; Sun, X.; Xu, P. Transcriptome signatures in common carp spleen in response to Aeromonas hydrophila infection. Fish Shellfish. Immunol. 2016, 57, 41–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Forouhar Vajargah, M.; Mohamadi Yalsuyi, A.; Hedayati, A.; Faggio, C. Histopathological lesions and toxicity in common carp (Cyprinus carpio L. 1758) induced by copper nanoparticles. Microsc. Res. Technol. 2018, 81, 724–729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zapata, A.; Amemiya, C. Phylogeny of lower vertebrates and their immunological structures. In Origin and Evolution of the Vertebrate Immune System; Springer: Berlin/Heidelberg, Germany, 2000; pp. 67–107. [Google Scholar]
- Jiang, Y.; Zhao, M.; An, W. Increased hepatic apoptosis in high-fat diet-induced NASH in rats may be associated with downregulation of hepatic stimulator substance. J. Mol. Med. 2011, 89, 1207–1217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mahmoudi, A.; Hadrich, F.; Feki, I.; Ghorbel, H.; Bouallagui, Z.; Marrekchi, R.; Fourati, H.; Sayadi, S. Oleuropein and hydroxytyrosol olive leaves rich-extracts attenuate liver injury and lipid metabolism disturbance in bisphenol A-treated rats. Food Funct. 2018, 9, 3220–3234. [Google Scholar] [CrossRef] [Scilit]
- Alhaithloul, H.A.S.; Alotaibi, M.F.; Bin-Jumah, M.; Elgebaly, H.; Mahmoud, A.M. Olea europaea leaf extract up-regulates Nrf2/ARE/HO-1 signaling and attenuates cyclophosphamide-induced oxidative stress, inflammation and apoptosis in rat kidney. Biomed. Pharmacother. 2019, 111, 676–685. [Google Scholar] [CrossRef] [Scilit]
- Deiana, M.; Serra, G.; Corona, G. Modulation of intestinal epithelium homeostasis by extra virgin olive oil phenolic compounds. Food Funct. 2018, 9, 4085–4099. [Google Scholar] [CrossRef] [Scilit]
- Cardeno, A.; Sanchez-Hidalgo, M.; Aparicio-Soto, M.; Alarcón-De-La-Lastra, C. Unsaponifiable fraction from extra virgin olive oil inhibits the inflammatory response in LPS-activated murine macrophages. Food Chem. 2014, 147, 117–123. [Google Scholar] [CrossRef] [Scilit]








| Experimental Diets | ||||
|---|---|---|---|---|
| Control | Diet 1 | Diet 2 | Diet 3 | |
| 0% OLE | 0.1% OLE | 0.2% OLE | 0.3% OLE | |
| Ingredients% | ||||
| Fish meal (65% Cp) | 10.00 | 10.00 | 10.00 | 10.00 |
| Soybean meal (45% Cp) | 39.00 | 39.00 | 39.00 | 39.00 |
| Corn gluten meal | 10.30 | 10.30 | 10.30 | 10.30 |
| Yellow corn | 10.00 | 10.00 | 10.00 | 10.00 |
| Wheat flour | 25.80 | 25.70 | 25.60 | 25.50 |
| Soybean oil | 3.70 | 3.70 | 3.70 | 3.70 |
| Vitamin premix * | 0.15 | 0.15 | 0.15 | 0.15 |
| Mineral premix ** | 0.15 | 0.15 | 0.15 | 0.15 |
| Dicalcium phosphate | 0.60 | 0.60 | 0.60 | 0.60 |
| Choline chloride | 0.20 | 0.20 | 0.20 | 0.20 |
| Stay C *** | 0.10 | 0.10 | 0.10 | 0.10 |
| Olive leaf extract | 0.00 | 0.10 | 0.20 | 0.30 |
| Composition (%) | ||||
| Crude protein | 33.61 | 33.60 | 33.59 | 33.58 |
| DE (Kcal/Kg) | 2999.78 | 2998.19 | 2996.60 | 2995.02 |
| Crude lipid | 5.90 | 5.90 | 5.90 | 5.90 |
| Ash | 4.79 | 4.79 | 4.79 | 4.79 |
| Crude fiber | 3.61 | 3.61 | 3.61 | 3.61 |
| Ca | 0.78 | 0.78 | 0.78 | 0.78 |
| P | 0.82 | 0.82 | 0.81 | 0.81 |
| Gene ID | Primer Sequence (5′–3′) | NCBI Gene Bank Acc. Number | Reference |
|---|---|---|---|
| sod | F: GGCTTTGATAAGGACAGTGGAA GACT R: GAAGTGGGACGAGACCTGTAGTG | AJ492825 | [70] |
| il1β | F: ACCGGCACACGTTACAACACTT R: GGGTGGTTGGCATCTGGTTCAT | AJ245635.1 | [71] |
| Tnfα | F: AACCAGGACCAGGCTTTCACT3 R: CATGTAGCGGCCATAGGAATC3 | AJ311800,2 | [71] |
| igfbp | F: CAAAGGCAACGCAATACGC R: GACCGTGTTTGTCACAGTTTGGA | MG919989 | [72] |
| β-actin * | F: ATCCGTAAAGACCTGTATGCCA R: GGGGAGCAATGATCTTGATCTTC | JQ619774 | [70] |
| caspase-3 | F: CTCTACGGCACCAGGTTACTACTC R: GCCATCATTTCACAAAGGGACT | KF055462 | [73] |
| pkc | F: TGGGCGTCCTGATGTTTGAG R: GGCGTTCCTTTGGTTCCTTG | JX673919 | [73] |
| nrf2 | F: TTCCCGCTGGTTTACCTTAC R: CGTTTCTTCTGCTTGTCTTT | XM_019123954.1 | [74] |
| keap1 | F: GCTCTTCGGAAACCCCT R: GCCCCAAGCCCACTACA | XM_019071157.1 |
| Control | OLE 0.1% | OLE 0.2% | OLE 0.3% | p-Value | |
|---|---|---|---|---|---|
| IBW (g) | 9.24 ± 0.19 | 9.12 ± 0.17 | 9.18 ± 0.14 | 9.26 ± 0.21 | 0.841 |
| FBW (g) | 15.72 ± 0.17 b | 16.48 ± 0.23 a | 14.11 ± 0.26 c | 12.60 ± 0.33 d | <0.0001 |
| WG (%) | 71.4 ± 2.1 b | 80.76 ± 2.77 a | 55.2 ± 3.01 c | 40.7 ± 3.12 d | <0.0001 |
| FCR | 1.64 ± 0.08 c | 1.43 ± 0.07 d | 2.08 ± 0.11 b | 2.78 ± 0.13 a | <0.0001 |
| SGR (%/day) | 0.85 ± 0.03 ab | 0.97 ± 0.04 a | 0.72 ± 0.05 b | 0.53 ± 0.02 c | 0.0003 |
| Control | OLE 0.1% | OLE 0.2% | OLE 0.3% | p-Value of Two-Way ANOVA * | ||||
|---|---|---|---|---|---|---|---|---|
| Time to Challenge | OLE Dose | Infection | Interaction | |||||
| RBCs (×106 µL−1) | Pre | 1.81 ± 0.11 | 1.83 ± 0.08 | 1.79 ± 0.14 | 1.84 ± 0.09 | 0.846 | 0.235 | 0.928 |
| Post | 1.92 ± 0.12 | 1.93 ± 0.17 | 1.89 ± 0.16 | 1.91 ± 0.11 | ||||
| Hb (g dL−1) | Pre | 6.41 ± 0.16 | 6.72 ± 0.19 | 6.53 ± 0.09 | 6.69 ± 0.14 | 0.714 | 0.047 | 0.1108 |
| Post | 6.87 ± 0.12 | 6.56 ± 0.19 | 7.08 ± 0.17 | 6.74 ± 0.21 | ||||
| PCV (%) | Pre | 23.09 ± 2.2 | 25.23 ± 1.9 | 24.21 ± 2.7 | 23.87 ± 1.9 | 0.330 | 0.203 | 0.360 |
| Post | 26.11 ± 2.34 | 25.85 ± 2.6 | 26.13 ± 3.2 | 26.78 ± 2.5 | ||||
| MCV (fL) | Pre | 127.6 ± 7.45 c | 137.9 ± 8.43 ab | 135.3 ± 6.86 ab | 129.73 bc | 0.001 | 0.053 | 0.0180 |
| Post | 136.0 ± 4.5 abc | 134.9 ± 5.2 abc | 138.3 ± 3.1 a | 140.21 ± 3.43 a | ||||
| MCH (pg) | Pre | 35.41 ± 3.21 | 36.72 ± 2.1 | 35.8 ± 3.4 | 36.34 ± 2.8 | 0.2385 | 0.3163 | 0.1407 |
| Post | 35.78 ± 1.8 | 34.09 ± 1.4 | 37.46 ± 1.09 | 35.29 ± 1.12 | ||||
| MCHC (%) | Pre | 27.80 ± 1.12 ab | 26.63 ± 1.2 ab | 26.97 ± 1.31 ab | 28.03 ± 1.42 a | 0.2385 | 0.00163 | 0.01407 |
| Post | 25.97 ± 1.31 b | 25.38b ± 1.01 b | 27.1 ± 1.91 ab | 27.2 ± 1.99 ab | ||||
| WBCs (×103 µL−1) | Pre | 22.11 ± 1.12 d | 25.6 ± 1.32 c | 23.89 ± 1.08 cd | 24.38 ± 1.2 cd | <0.0001 | <0.0001 | <0.0001 |
| Post | 28.26 ± 1.09 b | 31.45 ± 1.12 b | 33.21 ± 1.3 a | 35.42 ± 1.1 a | ||||
| Lymphocytes (×103 µL−1) | Pre | 18.34 ± 1.6 c | 21.71 ± 1.32 b | 18.9 ± 0.94 c | 20.32 ± 1.11 b | <0.0001 | <0.0001 | 0.0002 |
| Post | 20.89 ± 0.93 b | 25.08 ± 1.1 a | 26.2 ± 1.43 a | 27.99 ± 0.94 a | ||||
| Monocytes (×103 µL−1) | Pre | 0.71 ± 0.08 c | 0.81 ± 0.1 c | 1.67 ± 0.09 b | 0.75 ± 0.06 c | <0.0001 | <0.0001 | <0.0001 |
| Post | 1.49 ± 0.1 b | 2.75 ± 0.09 a | 2.81 ± 0.07 a | 2.74 ± 0.04 a | ||||
| Heterophils (×103 µL−1) | Pre | 2.48 ± 0.06 b | 2.54 ± 0.05 b | 2.47 ± 0.08 b | 2.40 ± 0.1 b | <0.45 | <0.0001 | <0.0001 |
| Post | 4.99 ± 0.1 a | 2.93 ± 0.1 b | 2.69 ± 0.08 b | 3.98 ± 0.07 a | ||||
| Basophils (×103 µL−1) | Pre | 0.58 ± 0.12 c | 0.54 ± 0.09 c | 0.85 ± 0.13 b | 0.91 ± 0.11 b | <0.0001 | 0.7445 | 0.0001 |
| Post | 0.89 ± 0.12 b | 0.69 ± 0.1 bc | 1.51 ± 0.11 a | 1.71 ± 0.15 a | ||||
| Parameter | Pre- and Post-Challenge | Control | OLE 0.1% | OLE 0.2% | OLE 0.3% | p-Value | ||
|---|---|---|---|---|---|---|---|---|
| OLE Dose | Infection | Interaction | ||||||
| Serum biochemistry | ||||||||
| Total proteins (g dL−1) | Pre | 4.64 ± 0.09 c | 5.04 ± 0.06 a | 4.76 ± 0.1 b | 5.05 ± 0.07 a | <0.0001 | 0.074 | 0.0001 |
| Post | 4.84 ± 0.03 b | 4.99 ± 0.05 a | 4.78 ± 0.04 b | 5.02 ± 0.1 a | ||||
| Albumin (g dL−1) | Pre | 1.70 ± 0.08 b | 1.79 ± 0.09 a | 1.65 ± 0.03 b | 1.59 ± 0.07 bc | 0.0001 | 0.0001 | 0.0001 |
| Post | 1.67 ± 0.07 b | 1.63 ± 0.04 b | 1.56 ± 0.06 c | 1.40 ± 0.05 d | ||||
| Globulins (g dL−1) | Pre | 2.94 ± 0.05 d | 3.30 ± 0.1 bc | 3.11 ± 0.09 c d | 3.46 ± 0.1 b | 0.0001 | 0.0001 | 0.001 |
| Post | 3.17 ± 0.1 c | 3.67 ± 0.07 a | 3.22 ± 0.08 c | 3.62 ± 0.1 a | ||||
| Cholesterol (mg dL−1) | Pre | 105.2 ± 4.2 a | 102.0 ± 3.4 a | 98.43 ± 2.5 b | 97.12 ± 1.8 b | 0.0002 | 0.0046 | 0.01 |
| Post | 101.3 ± 2.9 ab | 98.54 ± 4.1 b | 94.68 ± 2.7 c | 92.08 ± 3.5 c | ||||
| Triglycerides (mg dL−1) | Pre | 104.30 ± 3.1 bc | 88.10 ± 3.5 d | 100.7 ± 2.8 c | 108.31 ± 1.6 b | 0.0001 | 0.009 | 0.0001 |
| Post | 115.97 ± 3.6 a | 99.58 ± 2.5 c | 110.0 ± 2.8 b | 120.40 ± 2.3 a | ||||
| AST (U L−1) | Pre | 24.07 ± 1.2 d | 24.15 ± 1.6 d | 33.02 ± 1.1 c | 39.58 ± 0.8 b | 0.0001 | 0.0001 | 0.0001 |
| Post | 39.71 ± 1.8 b | 28.92 ± 1.1 cd | 39.93 ± 1.7 b | 49.37 ± 2.1 a | ||||
| ALT (U L−1) | Pre | 30.20 ± 1.2 c | 29.35 ± 2.3 c | 39.72 ± 2.1 b | 42.56 ± 1.5 b | 0.001 | 0.001 | 0.006 |
| Post | 49.10 ± 2.2 a | 38.54 ± 2.4 b | 49.95 ± 1.8 a | 52.36 ± 3.1 a | ||||
| BUN (mg dL−1) | Pre | 2.7 ± 0.1 c | 2.34 ± 0.09 d | 3.12 ± 0.1 b | 3.67 ± 0.1 a | 0.0001 | 0.0001 | 0.0001 |
| Post | 2.9 ± 0.1 c | 2.45 ± 0.07 d | 3.0 ± 0.05 bc | 3.19 ± 0.1 b | ||||
| Creatinine (mg dL−1) | Pre | 0.37 ± 0.08 d | 0.36 ± 0.04 d | 0.40 ± 0.06 c | 0.49 ± 0.03 b | 0.0001 | 0.0001 | 0.001 |
| Post | 0.45 ± 0.07 b | 0.40 ± 0.05 c | 0.43 ± 0.06 bc | 0.63 ± 0.08 a | ||||
| Intestinal enzyme activity | ||||||||
| Protease (U mg−1) | Pre | 48.20 ± 1.3 b | 52.00 ± 1.4 a | 50.03 ± 2.1 a | 44.34 ± 1.3 b | 0.0001 | 0.0001 | 0.332 |
| Post | 40.67 ± 2.1 b | 45.27 ± 1.9 a | 40.97 ± 1.7 b | 38.08 ± 1.5 c | ||||
| Amylase (U mg−1) | Pre | 77.42 ± 3.2 a | 81.08 ± 2.6 a | 79.30 ± 2.1 a | 68.32 ± 1.9 b | 0.019 | 0.016 | 0.01 |
| Post | 67.92 ± 2.7 b | 78.47 ± 2.1 a | 69.04 ± 1.7 b | 60.59 ± 2.1 c | ||||
| Lipase (U mg−1) | Pre | 65.90 ± 2.1 b | 74.80 ± 3.2 a | 60.00 ± 2.9 b | 58.60 ± 1.3 b | 0.001 | 0.001 | 0.001 |
| Post | 62.10 ± 2.9 b | 68.68 ± 2.0 ab | 58.80 ± 2.2 b | 48.32 ± 2.4 c | ||||
| Intestinal alkaline phosphatase (U mg−1) | Pre | 73.12 ± 1.21 b | 82.65 ± 1.94 a | 45.11 ± 1.2 d | 44.99 ± 1.16 d | 0.0001 | 0.0001 | 0.014 |
| Post | 54.95 ± 0.94 c | 73.34 ± 1.32 b | 58.05 ± 1.31 c | 53.16 ± 0.89 c | ||||
| Hepatic antioxidant activities (U mg−1) | ||||||||
| SOD (U mg−1) | Pre | 7.320 ± 0.2 b | 10.360 ± 0.13 a | 6.51 ± 0.1 b | 5.780 ± 0.12 c | <0.0001 | 0.0032 | 0.0145 |
| Post | 6.280 ± 0.11 b | 9.12 ± 0.10 a | 5.70 ± 0.13 c | 4.270 ± 0.14 d | ||||
| GPx (U mg−1) | Pre | 8.160 ± 0.2 b | 9.97 ± 0.09 a | 7.910 ± 0.08 b | 6.580 ± 0.09 c | <0.0001 | 0.1552 | 0.5508 |
| Post | 7.0 ± 0.11 b | 8.17 ± 0.12 a | 6.24 ± 0.08 b | 5.08 ± 0.1 c | ||||
| CAT (U mg−1) | Pre | 11.52 ± 0.45 a | 12.35 ± 0.32 a | 11.07 ± 0.4 b | 10.93 ± 0.7 b | 0.009 | 0.0174 | 0.0016 |
| Post | 10.70 ± 0.4 c | 11.45 ± 0.3 a b | 10.18 ± 1.47 | 9.95 ± 0.4 c | ||||
| MDA (nmol mg−1) | Pre | 17.19 ± 0.19 b | 14.32 ± 0.12 c | 17.79 ± 0.16 a | 19.84 ± 0.15 a | <0.0001 | 0.0053 | 0.1168 |
| Post | 20.21 ± 0.13 b | 15.38 ± 0.51 c | 19.48 ± 0.43 b | 22.87 ± 0.35 a | ||||
| Immune parameters | ||||||||
| Phagocytic activity% | Pre | 12.09 ± 1.2 a | 12.5 ± 0.9 a | 11.00 ± 1.1 b | 10.18 ± 0.7 b | <0.0001 | <0.0001 | 0.1921 |
| Post | 13.58 ± 1.9 b | 15.45 ± 1.3 a | 12.98 ± 1.7 b | 11.70 ± 1.3 c | ||||
| Lysosome activity (U mL−1) | Pre | 8.980 ± 0.11 b | 10.22 ± 0.19 a | 8.860 ± 0.1 b | 8.110 ± 0.12 b | 0.001 | 0.001 | 0.103 |
| Post | 11.71 ± 0.1 b | 13.64 ± 0.13 a | 11.16 ± 0.1 b | 10.17 ± 0.08 c | ||||
| NBT | Pre | 0.20 ± 0.02 bc | 0.34 ± 0.02 a | 0.25 ± 0.02 b | 0.29 ± 0.02 b | 0.001 | 0.01 | 0.0213 |
| Post | 0.15 ± 0.02 c | 0.39 ± 0.02 a | 0.29 ± 0.02 b | 0.32 ± 0.02 a | ||||
| IgM (mg dL−1) | Pre | 2.5 ± 0.05 c | 3.00 ± 0.1 b | 2.70 ± 0.09 c | 3.10 ± 0.1 b | 0.0001 | 0.01 | 0.016 |
| Post | 3.07 ± 0.1 b | 3.37 ± 0.07 a | 3.20 ± 0.08 a | 3.080 ± 0.1 b | ||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Assar, D.H.; Ragab, A.E.; Abdelsatar, E.; Salah, A.S.; Salem, S.M.R.; Hendam, B.M.; Al Jaouni, S.; Al Wakeel, R.A.; AbdEl-Kader, M.F.; Elbialy, Z.I. Dietary Olive Leaf Extract Differentially Modulates Antioxidant Defense of Normal and Aeromonas hydrophila-Infected Common Carp (Cyprinus carpio) via Keap1/Nrf2 Pathway Signaling: A Phytochemical and Biological Link. Animals 2023, 13, 2229. https://doi.org/10.3390/ani13132229
Assar DH, Ragab AE, Abdelsatar E, Salah AS, Salem SMR, Hendam BM, Al Jaouni S, Al Wakeel RA, AbdEl-Kader MF, Elbialy ZI. Dietary Olive Leaf Extract Differentially Modulates Antioxidant Defense of Normal and Aeromonas hydrophila-Infected Common Carp (Cyprinus carpio) via Keap1/Nrf2 Pathway Signaling: A Phytochemical and Biological Link. Animals. 2023; 13(13):2229. https://doi.org/10.3390/ani13132229
Chicago/Turabian StyleAssar, Doaa H., Amany E. Ragab, Essam Abdelsatar, Abdallah S. Salah, Shimaa M. R. Salem, Basma M. Hendam, Soad Al Jaouni, Rasha A. Al Wakeel, Marwa F. AbdEl-Kader, and Zizy I. Elbialy. 2023. "Dietary Olive Leaf Extract Differentially Modulates Antioxidant Defense of Normal and Aeromonas hydrophila-Infected Common Carp (Cyprinus carpio) via Keap1/Nrf2 Pathway Signaling: A Phytochemical and Biological Link" Animals 13, no. 13: 2229. https://doi.org/10.3390/ani13132229
APA StyleAssar, D. H., Ragab, A. E., Abdelsatar, E., Salah, A. S., Salem, S. M. R., Hendam, B. M., Al Jaouni, S., Al Wakeel, R. A., AbdEl-Kader, M. F., & Elbialy, Z. I. (2023). Dietary Olive Leaf Extract Differentially Modulates Antioxidant Defense of Normal and Aeromonas hydrophila-Infected Common Carp (Cyprinus carpio) via Keap1/Nrf2 Pathway Signaling: A Phytochemical and Biological Link. Animals, 13(13), 2229. https://doi.org/10.3390/ani13132229

