Comparative Transcriptome Analysis Provided a New Insight into the Molecular Mechanisms of Epididymis Regulating Semen Volume in Drakes
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Approval and Consent to Participate
2.2. Management of Experimental Drakes
2.3. Semen Quality Analysis of the Drakes
2.4. Sample Collection
2.5. Histological Observation
2.6. RNA-seq and Bioinformatics Analysis
2.7. Quantitative Reverse Transcription-PCR (RT-qPCR) Validation
2.8. Statistical Analysis
3. Results
3.1. Semen Quality Parameters between HVS and LVS Groups
3.2. Morphological Differences in the Epididymis between HVS and LVS Groups
3.3. Overview of RNA-seq Data
3.4. Functional Analysis of DEGs between HVS and LVS Groups
3.5. Network Analysis and RT-qPCR Validation of the DEGs Involved in Regulating Semen Volume
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tesfay, H.H.; Sun, Y.; Li, Y.; Shi, L.; Fan, J.; Wang, P.; Zong, Y.; Ni, A.; Ma, H.; Mani, A.I.; et al. Comparative studies of semen quality traits and sperm kinematic parameters in relation to fertility rate between 2 genetic groups of breed lines. Poult. Sci. 2020, 99, 6139–6146. [Google Scholar] [CrossRef] [PubMed]
- Love, C.C. Sperm quality assays: How good are they? The horse perspective. Anim. Reprod. Sci. 2018, 194, 63–70. [Google Scholar] [CrossRef] [PubMed]
- Feyisa, S.G.; Park, Y.H.; Kim, Y.M.; Lee, B.R.; Jung, K.M.; Choi, S.B.; Cho, C.Y.; Han, J.Y. Morphological defects of sperm and their association with motility, fertility, and hatchability in four Korean native chicken breeds. Asian-Australas J. Anim. Sci. 2018, 31, 1160–1168. [Google Scholar] [CrossRef]
- Ipek, A.; Sozcu, A. Comparison of hatching egg characteristics, embryo development, yolk absorption, hatch window, and hatchability of Pekin Duck eggs of different weights. Poult. Sci. 2017, 96, 3593–3599. [Google Scholar] [CrossRef] [PubMed]
- Ahammad, M.U.; Nishino, C.; Tatemoto, H.; Okura, N.; Kawamoto, Y.; Okamoto, S.; Nakada, T. Maturational changes in motility, acrosomal proteolytic activity, and penetrability of the inner perivitelline layer of fowl sperm, during their passage through the male genital tract. Theriogenology 2011, 76, 1100–1109. [Google Scholar] [CrossRef]
- Słowińska, M.; Paukszto, Ł.; Paweł, J.J.; Bukowska, J.; Kozłowski, K.; Jankowski, J.; Ciereszko, A. Transcriptome analysis of turkey (Meleagris gallopavo) reproductive tract revealed key pathways regulating spermatogenesis and post-testicular sperm maturation. Poult. Sci. 2020, 99, 6094–6118. [Google Scholar] [CrossRef]
- Xu, X.; Tan, Y.; Mao, H.; Liu, H.; Dong, X.; Yin, Z. Analysis of Long Noncoding RNA and mRNA Expression Profiles of Testes with High and Low Sperm Motility in Domestic Pigeons (Columba livia). Genes 2020, 11, 349. [Google Scholar] [CrossRef] [PubMed]
- Gao, W.; Zhang, C.; Jin, K.; Zhang, Y.; Zuo, Q.; Li, B. Analysis of lncRNA Expression Profile during the Formation of Male Germ Cells in Chickens. Animals 2020, 10, 1850. [Google Scholar] [CrossRef]
- Liu, Y.; Sun, Y.; Li, Y.; Bai, H.; Xue, F.; Xu, S.; Xu, H.; Shi, L.; Yang, N.; Chen, J. Analyses of Long Non-Coding RNA and mRNA profiling using RNA sequencing in chicken testis with extreme sperm motility. Sci. Rep. 2017, 7, 9055. [Google Scholar] [CrossRef]
- Camargo, M.; Intasqui, P.; Bertolla, R.P. Understanding the seminal plasma proteome and its role in male fertility. Basic Clin. Androl. 2018, 28, 6. [Google Scholar] [CrossRef]
- Li, Y.; Sun, Y.; Ni, A.; Shi, L.; Wang, P.; Isa, A.M.; Ge, P.; Jiang, L.; Fan, J.; Ma, H.; et al. Seminal Plasma Proteome as an Indicator of Sperm Dysfunction and Low Sperm Motility in Chickens. Mol. Cell. Proteom. 2020, 19, 1035–1046. [Google Scholar] [CrossRef] [PubMed]
- Jones, R.C. Evolution of the vertebrate epididymis. J. Reprod. Fertil. Suppl. 1998, 53, 163–181. [Google Scholar] [PubMed]
- Long, J.A. Applied Andrology in Chickens and Turkeys. In Animal Andrology, Theories and Applications; Chenoweth, P.J., Lorton, S.P., Eds.; CABI: Boston, MA, USA, 2014; pp. 197–225. [Google Scholar]
- Sullivan, R.; Mieusset, R. The human epididymis: Its function in sperm maturation. Hum. Reprod. Update 2016, 22, 574–587. [Google Scholar] [CrossRef] [PubMed]
- Budras, K.D.; Sauer, T. Morphology of the epididymis of the cock (Gallus domesticus) and its effect upon the steroid sex hormone synthesis. II. Steroid sex hormone synthesis in the tubuli epididymidis and the transformation of the ductuli aberrantes into hormone producing noduli epididymidis in the capsule of the adrenal gland of the capon. Anat. Embryol. 1975, 148, 197–213. [Google Scholar] [CrossRef]
- Budras, K.D.; Meier, U. The epididymis and its development in ratite birds (ostrich, emu, rhea). Anat. Embryol. 1981, 162, 281–299. [Google Scholar] [CrossRef] [PubMed]
- Orgebin-Crist, M.C. Sperm maturation in rabbit epididymis. Nature 1967, 216, 816–818. [Google Scholar] [CrossRef]
- Asano, A.; Tajima, A. Development and Preservation of Avian Sperm. Adv. Exp. Med. Biol. 2017, 1001, 59–73. [Google Scholar] [CrossRef]
- Janssen, S.J.; Kirby, J.D.; Hess, R.A.; Rhoads, M.; Bunick, D.; Bailey, K.L.; Parsons, C.M.; Wang, H.; Bahr, J.M. Identification of epididymal stones in diverse rooster populations. Poult. Sci. 2000, 79, 568–574. [Google Scholar] [CrossRef]
- Bahr, J.M.; Dalponte, M.; Janssen, S.; Bunick, D.; Nakai, M. Ion transporters for fluid reabsorption in the rooster (Gallus domesticus) epididymal region. Anim. Reprod. Sci. 2006, 95, 331–337. [Google Scholar] [CrossRef]
- Lecluze, E.; Jégou, B.; Rolland, A.D.; Chalmel, F. New transcriptomic tools to understand testis development and functions. Mol. Cell. Endocrinol. 2018, 468, 47–59. [Google Scholar] [CrossRef]
- Chalmel, F.; Rolland, A.D. Linking transcriptomics and proteomics in spermatogenesis. Reproduction 2015, 150, R149–R157. [Google Scholar] [CrossRef] [PubMed]
- Ouyang, Q.; Bao, D.; Lu, Y.; Hu, J.; Hu, B.; Lan, C.; Hu, S.; He, H.; Liu, H.; Li, L.; et al. A comparative study of libido in drakes: From phenotypes to molecules. Poult. Sci. 2021, 100, 101503. [Google Scholar] [CrossRef] [PubMed]
- Tang, B.; Hu, S.; Ouyang, Q.; Wu, T.; Lu, Y.; Hu, J.; Hu, B.; Li, L.; Wang, J. Comparative transcriptome analysis identifies crucial candidate genes and pathways in the hypothalamic-pituitary-gonadal axis during external genitalia development of male geese. BMC Genom. 2022, 23, 136. [Google Scholar] [CrossRef]
- Hu, J.; Chen, J.L.; Wen, J.; Zhao, G.P.; Zheng, M.Q.; Liu, R.R.; Liu, W.P.; Zhao, L.H.; Liu, G.F.; Wang, Z.W. Estimation of the genetic parameters of semen quality in Beijing-You chickens. Poult. Sci. 2013, 92, 2606–2612. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.J.; Zheng, J.X.; Yang, N. Semen quality factor as an indicator of fertilizing ability for geese. Poult. Sci. 2008, 87, 155–159. [Google Scholar] [CrossRef]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. 1000 Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef]
- Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Mao, X.; Cai, T.; Olyarchuk, J.G.; Wei, L. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics 2005, 21, 3787–3793. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Santiago-Moreno, J.; Blesbois, E. Functional Aspects of Seminal Plasma in Bird Reproduction. Int. J. Mol. Sci. 2020, 21, 5664. [Google Scholar] [CrossRef] [PubMed]
- Yin, Z.; Xu, X.; Tan, Y.; Cao, H.; Zhou, W.; Dong, X.; Mao, H. Expression analysis of microRNAs and their target mRNAs of testes with high and low sperm motility in domestic pigeons (Columba livia). Genomics 2021, 113, 257–264. [Google Scholar] [CrossRef]
- Xing, K.; Chen, Y.; Wang, L.; Lv, X.; Li, Z.; Qi, X.; Wang, X.; Xiao, L.; Ni, H.; Guo, Y.; et al. Epididymal mRNA and miRNA transcriptome analyses reveal important genes and miRNAs related to sperm motility in roosters. Poult. Sci. 2022, 101, 101558. [Google Scholar] [CrossRef] [PubMed]
- Estienne, A.; Reverchon, M.; Partyka, A.; Bourdon, G.; Grandhaye, J.; Barbe, A.; Caldas, S.E.; Rame, C.; Niżański, W.; Froment, P.; et al. Chemerin Impairs In Vitro Testosterone Production, Sperm Motility, and Fertility in Chicken: Possible Involvement of Its Receptor CMKLR1. Cells 2020, 9, 1599. [Google Scholar] [CrossRef]
- Sun, X.; Chen, X.; Zhao, J.; Ma, C.; Yan, C.; Liswaniso, S.; Xu, R.; Qin, N. Transcriptome comparative analysis of ovarian follicles reveals the key genes and signaling pathways implicated in hen egg production. BMC Genom. 2021, 22, 899. [Google Scholar] [CrossRef]
- Wu, N.; Gaur, U.; Zhu, Q.; Chen, B.; Xu, Z.; Zhao, X.; Yang, M.; Li, D. Expressed microRNA associated with high rate of egg production in chicken ovarian follicles. Anim. Genet. 2017, 48, 205–216. [Google Scholar] [CrossRef]
- Cheng, J.; Jin, X.; Shen, J.; Mu, Y.; Li, Q.; Xia, L.; Gao, Y.; Xia, Y. Whole Transcriptome Sequencing Reveals How Acupuncture and Moxibustion Increase Pregnancy Rate in Patients Undergoing In Vitro Fertilization-Embryo Transplantation. Biomed. Res. Int. 2019, 2019, 4179617. [Google Scholar] [CrossRef]
- Flynn, K.; Lothenbach, D.; Whiteman, F.; Hammermeister, D.; Swintek, J.; Etterson, M.; Johnson, R. The effects of continuous diazinon exposure on growth and reproduction in Japanese medaka using a modified Medaka Extended One Generation Reproduction Test (MEOGRT). Ecotoxicol. Environ. Saf. 2018, 162, 438–445. [Google Scholar] [CrossRef]
- Caimari, F.; Valassi, E.; Garbayo, P.; Steffensen, C.; Santos, A.; Corcoy, R.; Webb, S.M. Cushing’s syndrome and pregnancy outcomes: A systematic review of published cases. Endocrine 2017, 55, 555–563. [Google Scholar] [CrossRef]
- Ko, J.; Humbert, S.; Bronson, R.T.; Takahashi, S.; Kulkarni, A.B.; Li, E.; Tsai, L.H. p35 and p39 are essential for cyclin-dependent kinase 5 function during neurodevelopment. J. Neurosci. 2001, 21, 6758–6771. [Google Scholar] [CrossRef] [PubMed]
- Arif, A. Extraneuronal activities and regulatory mechanisms of the atypical cyclin-dependent kinase Cdk5. Biochem. Pharmacol. 2012, 84, 985–993. [Google Scholar] [CrossRef]
- Chaves, T.; Fazekas, C.L.; Horváth, K.; Correia, P.; Szabó, A.; Török, B.; Bánrévi, K.; Zelena, D. Stress Adaptation and the Brainstem with Focus on Corticotropin-Releasing Hormone. Int. J. Mol. Sci. 2021, 22, 9090. [Google Scholar] [CrossRef]
- Baronio, D.; Chen, Y.C.; Decker, A.R.; Enckell, L.; Fernández-López, B.; Semenova, S.; Puttonen, H.A.J.; Cornell, R.A.; Panula, P. Vesicular monoamine transporter 2 (SLC18A2) regulates monoamine turnover and brain development in zebrafish. Acta Physiol. 2022, 234, e13725. [Google Scholar] [CrossRef] [PubMed]
- Kádková, A.; Radecke, J.; Sørensen, J.B. The SNAP-25 Protein Family. Neuroscience 2019, 420, 50–71. [Google Scholar] [CrossRef] [PubMed]
- Gorman, K.M.; Meyer, E.; Grozeva, D.; Spinelli, E.; McTague, A.; Sanchis-Juan, A.; Carss, K.J.; Bryant, E.; Reich, A.; Schneider, A.L.; et al. Bi-allelic Loss-of-Function CACNA1B Mutations in Progressive Epilepsy-Dyskinesia. Am. J. Hum. Genet. 2019, 104, 948–956. [Google Scholar] [CrossRef]
- Hernandez, C.C.; Tian, X.; Hu, N.; Shen, W.; Catron, M.A.; Yang, Y.; Chen, J.; Jiang, Y.; Zhang, Y.; Macdonald, R.L. Dravet syndrome-associated mutations in GABRA1, GABRB2 and GABRG2 define the genetic landscape of defects of GABAA receptors. Brain Commun. 2021, 3, fcab033. [Google Scholar] [CrossRef]
- Mohrlüder, J.; Schwarten, M.; Willbold, D. Structure and potential function of gamma-aminobutyrate type A receptor-associated protein. FEBS J. 2009, 276, 4989–5005. [Google Scholar] [CrossRef]
- Herman, J.P.; McKlveen, J.M.; Ghosal, S.; Kopp, B.; Wulsin, A.; Makinson, R.; Scheimann, J.; Myers, B. Regulation of the Hypothalamic-Pituitary-Adrenocortical Stress Response. Compr. Physiol. 2016, 6, 603–621. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.Y.; Mao, L.M.; Zhang, G.C.; Papasian, C.J.; Fibuch, E.E.; Lan, H.X.; Zhou, H.F.; Xu, M.; Wang, J.Q. Activity-dependent modulation of limbic dopamine D3 receptors by CaMKII. Neuron 2009, 61, 425–438. [Google Scholar] [CrossRef]
- Jimenez, V.A.; Allen, D.C.; McClintick, M.N.; Grant, K.A. Social setting, social rank and HPA axis response in cynomolgus monkeys. Psychopharmacology 2017, 234, 1881–1889. [Google Scholar] [CrossRef] [PubMed]
- de Mendonca, P.O.R.; Costa, I.C.; Lotfi, C.F. The involvement of Nek2 and Notch in the proliferation of rat adrenal cortex triggered by POMC-derived peptides. PLoS ONE 2014, 9, e108657. [Google Scholar] [CrossRef]
- Kimura, M.; Müller-Preuss, P.; Lu, A.; Wiesner, E.; Flachskamm, C.; Wurst, W.; Holsboer, F.; Deussing, J.M. Conditional corticotropin-releasing hormone overexpression in the mouse forebrain enhances rapid eye movement sleep. Mol. Psychiatry 2010, 15, 154–165. [Google Scholar] [CrossRef]
- Roelfsema, F.; Aoun, P.; Takahashi, P.Y.; Erickson, D.; Yang, R.; Veldhuis, J.D. Regulation of Pulsatile and Entropic ACTH Secretion Under Fixed Exogenous Secretagogue Clamps. J. Clin. Endocrinol. Metab. 2017, 102, 2611–2619. [Google Scholar] [CrossRef] [PubMed]
- Sanders, K.; Mol, J.A.; Slob, A.; Kooistra, H.S.; Galac, S. Steroidogenic factor-1 inverse agonists as a treatment option for canine hypercortisolism: In vitro study. Domest. Anim. Endocrinol. 2018, 63, 23–30. [Google Scholar] [CrossRef] [PubMed]
- Smith, L.I.F.; Huang, V.; Olah, M.; Trinh, L.; Liu, Y.; Hazell, G.; Conway-Campbell, B.; Zhao, Z.; Martinez, A.; Lefrançois-Martinez, A.M.; et al. Involvement of CREB-regulated transcription coactivators (CRTC) in transcriptional activation of steroidogenic acute regulatory protein (Star) by ACTH. Mol. Cell. Endocrinol. 2020, 499, 110612. [Google Scholar] [CrossRef] [PubMed]
- Cole, T.J.; Short, K.L.; Hooper, S.B. The science of steroids. Semin. Fetal Neonatal Med. 2019, 24, 170–175. [Google Scholar] [CrossRef] [PubMed]
- Jirikowski, G.F.; Ochs, S.D.; Caldwell, J.D. Oxytocin and Steroid Actions. Curr. Top. Behav. Neurosci. 2018, 35, 77–95. [Google Scholar] [CrossRef]
Primer Name | Sequence (5′-3′) | Product Length (bp) |
---|---|---|
STAR-F | GCAGAAGATTGGGAAAGACACG | 246 |
STAR-R | AACTTGGTTTGCGAGGGGTC | |
CACNA1B-F | GATTGACTTGGGGCTGTTACTG | 144 |
CACNA1B-R | GTGTTGATGTCCTTTCCTTTGG | |
CAMK2A-F | GCGTGAAGAAAAGAAAGTCCAG | 187 |
CAMK2A-R | ATCCCAGGGTCACACATCTTC | |
CDK5R2-F | CTGCCTCTATCTCGCCTACTCC | 290 |
CDK5R2-R | AATCCGTCAGTCCTTGTCCTCC | |
DRD3-F | GATTGTGATAGTCTGGATGCTGGC | 118 |
DRD3-R | GGAGTAGATGACGAAAATAGGGTTG | |
GABRG2-F | TCCTCCAAATCCAACAAGC | 169 |
GABRG2-R | GGGAGTCAAAACCCAAGTCT | |
NR5A1-F | CAGACCCTCTTCTCCATCGTG | 363 |
NR5A1-R | CTTAGCCAGCGTGTGGTTCTC | |
SLC18A2-F | AGTCAGAAGGGGACACCATTA | 172 |
SLC18A2-R | GAAGAAAAGCAACGCCAAG | |
SNAP25-F | AATCCCTTGAGAGCACCCG | 312 |
SNAP25-R | CCATCTGCTCCCGTTCATCTA | |
GAPDH-F | GTCTCTGTCGTGGACCTGAC | 113 |
GAPDH-R | GTGTATGCCAGGATGCCCTT | |
β-actin-F | GCTATGTCGCCCTGGATTTC | 168 |
β-actin-R | CACAGGACTCCATACCCAAGAA |
Semen Variables | HVS (n = 10) | LVS (n = 10) | p-Value |
---|---|---|---|
Semen volume (mL) | 0.70 ± 0.03 | 0.21 ± 0.03 | <0.01 ** |
Sperm vitality (%) | 94.40 ± 0.20 | 94.30 ± 0.20 | 0.653 |
Sperm motility (%) | 91.30 ± 0.60 | 90.70 ± 0.60 | 0.444 |
Morphological abnormal sperm (%) | 7.10 ± 0.90 | 6.80 ± 0.90 | 0.803 |
Acrosome integrity (%) | 94.00 ± 0.90 | 95.60 ± 0.90 | 0.249 |
Sperm concentration (109/mL) | 3.61 ± 0.30 | 3.83 ± 0.30 | 0.597 |
Total sperm number (109) | 2.55 ± 0.22 | 0.81 ± 0.22 | <0.01 ** |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, X.; Ouyang, Q.; Tang, B.; Zhang, X.; Hu, J.; Hu, B.; Hu, S.; Li, L.; He, H.; Liu, H.; et al. Comparative Transcriptome Analysis Provided a New Insight into the Molecular Mechanisms of Epididymis Regulating Semen Volume in Drakes. Animals 2022, 12, 3023. https://doi.org/10.3390/ani12213023
Hu X, Ouyang Q, Tang B, Zhang X, Hu J, Hu B, Hu S, Li L, He H, Liu H, et al. Comparative Transcriptome Analysis Provided a New Insight into the Molecular Mechanisms of Epididymis Regulating Semen Volume in Drakes. Animals. 2022; 12(21):3023. https://doi.org/10.3390/ani12213023
Chicago/Turabian StyleHu, Xinyue, Qingyuan Ouyang, Bincheng Tang, Xin Zhang, Jiwei Hu, Bo Hu, Shenqiang Hu, Liang Li, Hua He, Hehe Liu, and et al. 2022. "Comparative Transcriptome Analysis Provided a New Insight into the Molecular Mechanisms of Epididymis Regulating Semen Volume in Drakes" Animals 12, no. 21: 3023. https://doi.org/10.3390/ani12213023
APA StyleHu, X., Ouyang, Q., Tang, B., Zhang, X., Hu, J., Hu, B., Hu, S., Li, L., He, H., Liu, H., & Wang, J. (2022). Comparative Transcriptome Analysis Provided a New Insight into the Molecular Mechanisms of Epididymis Regulating Semen Volume in Drakes. Animals, 12(21), 3023. https://doi.org/10.3390/ani12213023