Rapid Diagnostic Test to Detect and Discriminate Infectious Hematopoietic Necrosis Virus (IHNV) Genogroups U and M to Aid Management of Pacific Northwest Salmonid Populations
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Assay Development
2.2. RT-rPCR Reaction Conditions
2.3. Analytical Validation
2.4. Diagnostic Validation
3. Results
3.1. Assay Development and Fit for Purpose
3.2. Analytical Validation
3.3. Diagnostic Validation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wolf, K. Infectious hematopoietic necrosis virus. In Fish Viruses and Fish Viral Diseases; Cornell University Press: Ithaca, NY, USA, 1988; pp. 83–114. [Google Scholar]
- Bootland, L.M.; Leong, J.C. Infectious haematopoietic necrosis virus. In Fish Diseases and Disorders; Woo, P.T.K., Bruno, D.W., Eds.; CAB International: Cambridge, UK, 2009; Volume 3, pp. 66–109. [Google Scholar]
- Kurath, G. Fish novirhabdoviruses. In Rhabdoviruses: Molecular Taxonomy, Evolution, Genomics, Ecology, Host-Vector Interactions, Cytopathology and Control; Dietzgen, R.G., Kuzmin, I.V., Eds.; Caister Academic Press: Norfolk, UK, 2012; pp. 89–116. [Google Scholar]
- Kurath, G.; Garver, K.A.; Troyer, R.M.; Emmenegger, E.J.; Einer-Jensen, K.; Anderson, E.D. Phylogeography of infectious haematopoietic necrosis virus in North America. J. Gen. Virol. 2003, 84, 803–814. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garver, K.A.; Troyer, R.M.; Kurath, G. Two distinct phylogenetic clades of infectious hematopoietic necrosis virus overlap within the Columbia River basin. Dis. Aquat. Org. 2003, 55, 187–203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Breyta, R.; Jones, A.; Stewart, B.; Brunson, R.; Thomas, J.; Kerwin, J.; Bertolini, J.; Mumford, S.; Patterson, C.; Kurath, G. Emergence of MD type infectious hematopoietic necrosis virus in Washington State coastal steelhead trout. Dis. Aquat. Org. 2013, 104, 179–195. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kelley, G.O.; Bendorf, C.M.; Yun, S.C.; Kurath, G.; Hedrick, R.P. Genotypes and phylogeographical relationships of infectious hematopoietic necrosis virus in California, USA. Dis. Aquat. Org. 2007, 77, 29–40. [Google Scholar] [CrossRef] [Scilit]
- Walker, P.J.; Freitas-Astúa, J.; Bejerman, N.; Blasdell, K.R.; Breyta, R.; Dietzgen, R.G.; Fooks, A.R.; Kondo, H.; Kurath, G.; Kuzmin, I.V.; et al. ICTV Virus Taxonomy Profile: Rhabdoviridae 2022. J. Gen. Virol. 2022, 103, 001689. [Google Scholar] [CrossRef] [Scilit]
- OIE. Chapter 10.6 Infectious Haematopoietic Necrosis Virus. OIE—Aquatic Animal Health Code. 2021. Available online: https://www.woah.org (accessed on 8 July 2022).
- AFS. Suggested Procedures for the Detection and Identification of Certain Finfish and Shellfish Pathogens. 2020. Available online: https://units.fisheries.org/fhs/fish-health-section-blue-book-2020 (accessed on 8 July 2022).
- Hardiman, J.M.; Breyta, R.B.; Haskell, C.A.; Ostberg, C.O.; Hatten, J.R.; Connolly, P.J. Risk Assesment for the Reintroduction of Anadromous Salmonids Upstream of Chief Joseph and Grand Coulee Dams, Northeastern Washington; U.S. Geological Survey Open-File Report 2017–1113; 2017; Volume 87. Available online: https://pubs.er.usgs.gov/publication/ofr20171113 (accessed on 7 July 2022).
- Breyta, R.; Brito, I.; Ferguson, P.; Kurath, G.; Naish, K.A.; Purcell, M.K.; Wargo, A.R.; LaDeau, S. Transmission routes maintaining a viral pathogen of steelhead trout within a complex multi-host assemblage. Ecol. Evol. 2017, 7, 8187–8200. [Google Scholar] [CrossRef] [Scilit]
- Garver, K.; Batts, W.; Kurath, G. Virulence comparisons of infectious hematopoietic necrosis virus U and M genogroups in sockeye salmon and rainbow trout. J. Aquat. Anim. Health 2006, 18, 232–243. [Google Scholar] [CrossRef] [Scilit]
- Peñaranda, M.M.D.; Purcell, M.K.; Kurath, G. Differential virulence mechanisms of infectious hematopoietic necrosis virus (IHNV) in rainbow trout (Oncorhynchus mykiss) include host entry and virus replication kinetics. J. Gen. Virol. 2009, 90, 2172–2182. [Google Scholar] [CrossRef] [Scilit]
- Purcell, M.K.; Garver, K.A.; Conway, C.M.; Elliott, D.G.; Kurath, G. Infectious hematopoietic necrosis virus genogroup-specific virulence mechanisms in sockeye salmon (Oncorhynchus nerka) from Redfish Lake Idaho. J. Fish Dis. 2009, 32, 619–631. [Google Scholar] [CrossRef] [Scilit]
- Kurath, G.; Garver, K.A.; LaPatra, S.E.; Purcell, M.K. Resistance and protective immunity in Redfish Lake sockeye salmon exposed to M type infectious hematopoietic necrosis virus (IHNV). J. Aquat. Anim. Health 2010, 22, 129–139. [Google Scholar] [CrossRef] [Scilit]
- Black, A.; Breyta, R.; Bedford, T.; Kurath, G. Geography and host species shape the evolutionary dynamics of U genogroup infectious hematopoietic necrosis virus. Virus Evol. 2016, 2, vew034. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Breyta, R.; McKenney, D.; Tesfaye, T.; Ono, K.; Kurath, G. Increasing virulence, but not infectivity, associated with serially emergent virus strains of a fish rhabdovirus. Virus Evol. 2016, 2, vev018. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bellgraph, B.J.; Baldwin, C.; Garavelli, L.; Haque, Z.; Perkins, W.; Richmond, M.; Howell, M.; McLellan, J. Estimates of Chinook salmon spawning habitat in a blocked reach of the Columbia River upstream of Grand Coulee Dam. Northwest Sci. 2020, 94, 99–110. [Google Scholar] [CrossRef] [Scilit]
- OIE. Chapter 2.3.5 Infection with Infectious Haematopoietic Necrosis Virus. Manual of Diagnostic Tests for Aquatic Animals. 2021. Available online: https://www.woah.org (accessed on 8 July 2022).
- Purcell, M.K.; Thompson, R.L.; Garver, K.A.; Hawley, L.M.; Batts, W.N.; Sprague, L.; Sampson, C.; Winton, J.R. Development and validation of a universal reverse-transcriptase real-time PCR for infectious hematopoietic necrosis virus (IHNV). Dis. Aquat. Org. 2013, 106, 103–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cuenca, A.; Vendramin, N.; Olesen, N.J. Analytical validation of one-step realtime RT-PCR for detection of infectious hematopoietic necrosis virus (IHNV). Bull. Eur. Assoc. Fish Pathol. 2020, 40, 261–272. [Google Scholar]
- Overturf, K.; LaPatra, S.; Powell, M. Real-time PCR for the detection and quantitative analysis of IHNV in salmonids. J. Fish Dis. 2001, 24, 325–333. [Google Scholar] [CrossRef] [Scilit]
- Dhar, A.K.; Bowers, R.M.; Licon, K.S.; LaPatra, S.E. Detection and quantification of infectious hematopoietic necrosis virus in rainbow trout (Oncorhynchus mykiss) by SYBR Green real-time reverse transcriptase-polymerase chain reaction. J. Virol. Methods 2008, 147, 157–166. [Google Scholar] [CrossRef] [Scilit]
- Purcell, M.K.; Hart, S.A.; Kurath, G.; Winton, J.R. Strand-specific, real-time RT-PCR assays for quantification of genomic and positive-sense RNAs of the fish rhabdovirus infectious hematopoietic necrosis virus. J. Virol. Methods 2006, 132, 18–24. [Google Scholar] [CrossRef] [Scilit]
- Snow, M.; McKay, P.; Matejusova, I. Development of a widely applicable positive control strategy to support detection of infectious salmon anaemia virus (ISAV) using Taqman real-time PCR. J. Fish Dis. 2009, 32, 151–156. [Google Scholar] [CrossRef] [Scilit]
- Troyer, R.M.; Garver, K.A.; Ranson, J.C.; Wargo, A.R.; Kurath, G. In vivo virus growth competition assays demonstrate equal fitness of fish rhabdovirus strains that co-circulate in aquaculture. Virus Res 2008, 137, 179–188. [Google Scholar] [CrossRef] [Scilit]
- Wargo, A.R.; Garver, K.A.; Kurath, G. Virulence correlates with fitness in vivo for two M group genotypes of Infectious hematopoietic necrosis virus (IHNV). Virology 2010, 404, 51–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gardner, I.A.; Whittington, R.; Caraguel, C.; Hick, P.; Moody, N.; Corbeil, S.; Garver, K.A.; Olesen, N.J.; Berthe, F.; Purcell, M.K. Recommended reporting standards for test accuracy studies of infectious diseases of finfish, shellfish and crustaceans. Dis. Aquat. Org. 2016, 118, 91–111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Batts, W.; Purcell, M.K.; Powers, R.L. Reverse transcriptase real time PCR testing to support validation of a new diagnostic assay to detect and discriminate the infectious hematopoietic necrosis virus (IHNV) U and M genogroups: U.S. Geological Survey Data Release. 2022. Available online: https://doi.org/10.5066/P963M863 (accessed on 8 July 2022).
- Rose, J.; Schubert, M. Rhabdovirus genomes and their products. In The Rhabdoviruses; Wagner, R., Ed.; Plenum: New York, NY, USA, 1987; pp. 129–166. [Google Scholar]
- Troyer, R.M.; LaPatra, S.E.; Kurath, G. Genetic analyses reveal unusually high diversity of infectious haematopoietic necrosis virus in rainbow trout aquaculture. J. Gen. Virol. 2000, 81, 2823–2832. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Troyer, R.M.; Kurath, G. Molecular epidemiology of infectious hematopoietic necrosis virus reveals complex virus traffic and evolution within southern Idaho aquaculture. Dis. Aquat. Org. 2003, 55, 175–185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoferer, M.; Akimkin, V.; Skrypski, J.; Schütze, H.; Sting, R. Improvement of a diagnostic procedure in surveillance of the listed fish diseases IHN and VHS. J. Fish Dis. 2019, 42, 559–572. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- OIE. Principles and methods of validation of diagnostic assays for infectious diseases. In Manual of Diagnostic Tests for Aquatic Animals; World Organization for Animal Health: Paris, France, 2019; pp. 1–18. Available online: https://www.woah.org (accessed on 8 July 2022).
- Caraguel, C.; Stryhn, H.; Gagne, N.; Dohoo, I.; Hammell, K.L. Selection of a cutoff value for real-time polymerase chain reaction results to fit a diagnostic purpose: Analytical and epidemiological approaches. J. Vet. Diagn. Investig. 2011, 23, 2–15. [Google Scholar] [CrossRef] [Scilit]
- Elliott, D.G.; Applegate, L.J.; Murray, A.L.; Purcell, M.K.; McKibben, C.L. Bench-top validation testing of selected immunological and molecular Renibacterium salmoninarum diagnostic assays by comparison with quantitative bacteriological culture. J. Fish Dis. 2013, 36, 779–809. [Google Scholar] [CrossRef] [Scilit]
- Breyta, R.; Jones, A.; Kurath, G. Differential susceptibility in steelhead trout populations to an emergent MD strain of infectious hematopoietic necrosis virus. Dis. Aquat. Org. 2014, 112, 17–28. [Google Scholar] [CrossRef] [Scilit]
- Burbank, D.R.; Fehringer, T.R.; Chiaramonte, L.V. Comparison of selected nonlethal samples from adult steelhead for detection of infectious hematopoietic necrosis virus using cell culture. J. Aquat. Anim. Health 2017, 29, 67–73. [Google Scholar] [CrossRef] [Scilit]
| Primer/Probe Name | Sequence (5′–3′) |
|---|---|
| IHNV U/M 739F | ACCAAGGCTATCTATGGGATCATTCTCAT |
| IHNV U/M 817R | TGGCGCACAGTGCCTTG |
| U Probe (785-795) | HEX-CC+A+C+CGCCGCT-IABkFQ/LNA |
| M Probe (783-795) | 6-FAM-AGCC+A+T+CGC+TGCC-IABkFQ/LNA |
| Viral Species | Major Genogroup | Sub-Group | Isolate Name | Geographic Area | Year | Mean CT N Uni | Mean CT U Probe | Mean CT M Probe |
|---|---|---|---|---|---|---|---|---|
| IHNV | U | P | Auke77 | AK, USA | 1977 | 18.2 | 16.5 | bd |
| U | P | GF77 | AK, USA | 1977 | 17.0 | 13.9 | bd | |
| U | P | BC4814 | BC, Canada | 1992 | 14.8 | 13.1 | bd | |
| U | P | Blk94 | WA, USA | 1994 | 17.4 | 15.6 | bd | |
| U | P | RU1 | Russia | 2000 | 18.3 | 18.2 | bd | |
| U | P | RU9 | Russia | 2001 | 15.4 | 13.6 | bd | |
| U | P | BC203 | BC, Canada | 2002 | 17.5 | 15.9 | bd | |
| U | P | CdR12 | WA, USA | 2012 | 17.0 | 13.9 | bd | |
| U | P | MM15 | WA, USA | 2015 | 17.5 | 13.5 | bd | |
| U | C | RB1 | OR, USA | 1975 | 17.3 | 15.6 | bd | |
| U | C | RB5 | OR, USA | 2005 | 16.5 | 15.5 | bd | |
| U | C | LYF05 | WA, USA | 2005 | 17.4 | 16.4 | bd | |
| U | C | KSK08 | WA, USA | 2008 | 20.5 | 19.5 | bd | |
| U | C | LYF09 | WA, USA | 2009 | 16.3 | 15.4 | bd | |
| U | C | LYC09 | ID, USA | 2009 | 18.5 | 17.5 | bd | |
| U | C | LNFH10 | WA, USA | 2010 | 18.1 | 16.6 | bd | |
| U | C | DW10 | ID, USA | 2010 | 17.3 | 15.5 | bd | |
| U | C | 17-020 | WA, USA | 2015 | 17.8 | 18.2 | bd | |
| U | C | 17-019 | WA, USA | 2015 | 18.6 | 17.6 | bd | |
| U | C | 17-031 | WA, USA | 2016 | 25.2 | 24.3 | bd | |
| U | Asia | Shiz82 | Japan | 1982 | 21.3 | 19.6 | bd | |
| M | N | LR80 | WA, USA | 1980 | 17.4 | bd | 17.1 | |
| M | A | WRAC | ID, USA | 1982 | 18.1 | bd | 17.7 | |
| M | B | 220-90 | ID, USA | 1990 | 16.2 | bd | 16.0 | |
| M | B | 17-067 | ID, USA | 2008 | 21.6 | bd | 18.7 | |
| M | B | Hg508 | ID, USA | 2014 | 20.0 * | bd | 15.8 | |
| M | C | C30 | ID, USA | 1991 | 16.2 | bd | 15.5 | |
| M | C | 17-051 | ID, USA | 1999 | 18.0 | bd | 17.3 | |
| M | C | 17-073 | ID, USA | 2012 | 19.8 | bd | 28.0 * | |
| M | D | SK81 | WA, USA | 1981 | 14.4 | bd | 13.6 | |
| M | D | KK89 | ID, USA | 1989 | 17.3 | bd | 16.3 | |
| M | D | SK94 | WA, USA | 1994 | 16.1 | bd | 15.3 | |
| M | D | Mer95 | WA, USA | 1995 | 16.7 | bd | 16.6 | |
| M | D | Qts97 | WA, USA | 1997 | 16.1 | bd | 15.3 | |
| M | D | 17-054 | ID, USA | 1999 | 24.2 * | bd | 17.3 | |
| M | D | 17-058 | ID, USA | 1999 | 21.7 | bd | 21.0 | |
| M | D | SK02 | WA, USA | 2002 | 16.3 | bd | 15.5 | |
| M | D | Tan02 | WA, USA | 2002 | 16.8 | bd | 17.0 | |
| M | D | SK04 | WA, USA | 2004 | 15.1 | bd | 14.5 | |
| M | D | CW06 | WA, USA | 2006 | 15.7 | bd | 14.9 | |
| M | D | Qts07 | WA, USA | 2007 | 16.5 | bd | 17.7 | |
| M | D | DW09 | ID, USA | 2009 | 19.6 | bd | 18.9 | |
| M | D | Qts10 | WA, USA | 2010 | 16.3 | bd | 15.2 | |
| M | D | 17-074 | ID, USA | 2013 | 16.2 | bd | 16.0 | |
| M | D | 17-075 | ID, USA | 2013 | 18.7 | bd | 18.4 | |
| M | D | 17-081 | ID, USA | 2014 | 17.5 | bd | 16.5 | |
| M | D | Hg511 | ID, USA | 2014 | 15.5 | bd | 14.6 | |
| M | D | 17-087 | ID, USA | 2015 | 19.6 | bd | 18.6 | |
| M | D | 17-098 | ID, USA | 2015 | 20.2 | bd | 20.0 | |
| M | D | 17-100 | ID, USA | 2015 | 17.8 | bd | 17.5 | |
| M | D | 17-014 | WA, USA | 2015 | 20.4 | bd | 20.2 | |
| M | D | 17-023 | WA, USA | 2015 | 17.3 | bd | 17.1 | |
| L | I | C18 | CA, USA | 1991 | 20.5 | 18.9 | bd | |
| L | II | FR0031 | CA, USA | 2000 | 22.3 | 21.1 | bd | |
| E | - | 32/87 | France | 1987 | 21.2 | bd | 20.9 | |
| E | - | 55/94 | Austria | 1994 | 19.4 | bd | 18.9 | |
| J | - | ChAb76 | Japan | 1976 | 18.0 | 16.4 | bd | |
| J | - | RtUi02 | Korea | 2002 | 19.0 | 14.7 | bd | |
| VHSV | I | A | DK3592B | Denmark | 1986 | bd | bd | bd |
| IV | A | Makah | WA, USA | 1988 | bd | bd | bd | |
| IV | B | MI03 | MI, USA | 2003 | bd | bd | bd | |
| HIRRV | - | - | 8401H | Japan | 1984 | bd | bd | bd |
| SHRV | - | - | - | Thailand | 1986 | bd | bd | bd |
| Template Source | N Uni | U/M Assay U Probe | U/M Assay M Probe | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Slope | E | LOD | Slope | E | LOD | Slope | E | LOD | |
| APC 1 | −3.51 | 92.7% | <10 | −3.38 | 97.6% | <10 | −3.36 | 98.4% | <10 |
| gBlock 1 | −3.49 | 93.4% | <10 | −3.45 | 94.9% | <10 | −3.44 | 95.3% | <10 |
| Fish 2 | −3.50 | 93.1% | <20 | −3.33 | 99.7% | <30 | −3.29 | 101.4% | <10 |
| Test under Evaluation | Comparative Test | DSe (95% CL) | DSp (95% CL) | Overall Agreement | Κ (+SE) 1 |
|---|---|---|---|---|---|
| U/M RT-rPCR | Cell culture | 0.94 (0.80–0.99) | 0.99 (0.92–1.00) | 97.1% | 0.93 (0.10) |
| N Uni RT-rPCR | 0.94 (0.80–0.99) | 0.97 (0.82–1.00) | 95.2% | 0.90 (0.13) | |
| N Uni RT-rPCR | Cell culture | 0.97 (0.85–1.00) | 0.97 (0.82–1.00) | 96.8% | 0.93 (0.13) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Batts, W.N.; Capps, T.R.; Crosson, L.M.; Powers, R.L.; Breyta, R.; Purcell, M.K. Rapid Diagnostic Test to Detect and Discriminate Infectious Hematopoietic Necrosis Virus (IHNV) Genogroups U and M to Aid Management of Pacific Northwest Salmonid Populations. Animals 2022, 12, 1761. https://doi.org/10.3390/ani12141761
Batts WN, Capps TR, Crosson LM, Powers RL, Breyta R, Purcell MK. Rapid Diagnostic Test to Detect and Discriminate Infectious Hematopoietic Necrosis Virus (IHNV) Genogroups U and M to Aid Management of Pacific Northwest Salmonid Populations. Animals. 2022; 12(14):1761. https://doi.org/10.3390/ani12141761
Chicago/Turabian StyleBatts, William N., Tony R. Capps, Lisa M. Crosson, Rachel L. Powers, Rachel Breyta, and Maureen K. Purcell. 2022. "Rapid Diagnostic Test to Detect and Discriminate Infectious Hematopoietic Necrosis Virus (IHNV) Genogroups U and M to Aid Management of Pacific Northwest Salmonid Populations" Animals 12, no. 14: 1761. https://doi.org/10.3390/ani12141761
APA StyleBatts, W. N., Capps, T. R., Crosson, L. M., Powers, R. L., Breyta, R., & Purcell, M. K. (2022). Rapid Diagnostic Test to Detect and Discriminate Infectious Hematopoietic Necrosis Virus (IHNV) Genogroups U and M to Aid Management of Pacific Northwest Salmonid Populations. Animals, 12(14), 1761. https://doi.org/10.3390/ani12141761

