Dietary Glutamine Supplementation Alleviated Inflammation Responses and Improved Intestinal Mucosa Barrier of LPS-Challenged Broilers
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Care and Management
2.2. Diets and Experimental Design
2.3. Sample Collection
2.4. Growth Performance
2.5. Determination of Pro-Inflammatory Cytokines Concentration in Plasma
2.6. Analysis of D-LA and DAO Activity in Plasma
2.7. Intestine Morphology Measurement
2.8. Total RNA Extraction and Real-Time PCR Measurement
2.9. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. The Concentration of Pro-Inflammatory Cytokines in Plasma
3.3. Intestine Permeability
3.4. Intestine Morphology
3.5. mRNA Expressions of Intestine Tight Junction Protein
3.6. mRNA Abundances of TLR-4/FAK/MyD88/IRAK4 Signaling Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Alexander, C.; Rietschel, E.T. Invited review: Bacterial lipopolysaccharides and innate immunity. J. Endotoxin. Res. 2001, 7, 167–202. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.C.; Yeh, W.C.; Ohashi, P.S. LPS/TLR4 signal transduction pathway. Cytokine 2008, 42, 145–151. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhang, H.; Chen, Y.P.; Yang, M.X.; Zhang, L.L.; Lu, Z.X.; Zhou, Y.M.; Wang, T. Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers. Anim. Feed Sci. Technol. 2015, 208, 119–131. [Google Scholar] [CrossRef]
- Tan, J.; Liu, S.; Guo, Y.; Applegate, T.J.; Eicher, S.D. Dietary L-arginine supplementation attenuates lipopolysaccharide-induced inflammatory response in broiler chickens. Br. J. Nutr. 2014, 111, 1394–1404. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, R.; Song, Z.; Zhao, J.; Huo, D.; Fan, Z.; Hou, D.X.; He, X. Dietary L-theanine alleviated lipopolysaccharide-induced immunological stress in yellow-feathered broilers. Anim. Nutr. (Zhongguo Xu Mu Shou Yi Xue Hui) 2018, 4, 265–272. [Google Scholar] [CrossRef] [PubMed]
- Gadde, U.D.; Oh, S.; Lee, Y.; Davis, E.; Zimmerman, N.; Rehberger, T.; SoonLillehoj, H. Dietary Bacillus subtilis-based direct-fed microbials alleviate LPS-induced intestinal immunological stress and improve intestinal barrier gene expression in commercial broiler chickens. Res. Vet. Sci. 2017, 114, 236–243. [Google Scholar] [CrossRef]
- Groschwitz, K.R.; Hogan, S.P. Intestinal barrier function: Molecular regulation and disease pathogenesis. J. Allergy Clin. Immunol. 2009, 124, 3–20. [Google Scholar] [CrossRef] [Green Version]
- Wu, Q.; Zhou, Y.; Wu, Y.; Zhang, L.; Wang, T. The effects of natural and modified clinoptilolite on intestinal barrier function and immune response to LPS in broiler chickens. Vet. Immunol. Immunopathol. 2013, 153, 70–76. [Google Scholar] [CrossRef]
- Gilani, S.; Howarth, G.S.; Kitessa, S.M.; Forder, R.E.A.; Tran, C.D.; Hughes, R.J. New biomarkers for intestinal permeability induced by lipopolysaccharide in chickens. Anim. Prod. Sci. 2016, 56, 1984–1997. [Google Scholar] [CrossRef]
- Wang, B.; Wu, G.; Zhou, Z.; Dai, Z.; Sun, Y.; Ji, Y.; Li, W.; Wang, W.; Liu, C.; Han, F. Glutamine and intestinal barrier function. Amino Acids 2015, 47, 2143–2154. [Google Scholar] [CrossRef]
- Turner, J.R. Intestinal mucosal barrier function in health and disease. Nat. Rev. Immunol. 2009, 9, 799–809. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Rao, J.N.; Wang, J. Posttranscriptional Regulation of Intestinal Epithelial Tight Junction Barrier by RNA-binding Proteins and microRNAs. Tissue Barriers 2014, 2, e28320. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- González-Mariscal, L.; Betanzos, A.; Nava, P.; Jaramillo, B.E. Tight junction proteins. Prog. Biophys. Mol. Biol. 2003, 81, 1–44. [Google Scholar] [CrossRef]
- Lee, Y.; Lee, S.; Gadde, U.D.; Oh, S.; Lee, S.; Lillehoj, H.S. Dietary Allium hookeri reduces inflammatory response and increases expression of intestinal tight junction proteins in LPS-induced young broiler chicken. Res. Vet. Sci. 2017, 112, 149–155. [Google Scholar] [CrossRef] [PubMed]
- Park, E.J.; Thomson, A.B.R.; Clandinin, M.T. Protection of intestinal occludin tight junction protein by dietary gangliosides in lipopolysaccharide-induced acute inflammation. J. Pediatr. Gastroenterol. Nutr. 2010, 50, 321–328. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.H.; Kim, H. The Roles of Glutamine in the Intestine and Its Implication in Intestinal Diseases. Int. J. Mol. Sci. 2017, 18, 1051. [Google Scholar] [CrossRef] [Green Version]
- Moore, S.R.; Guedes, M.M.; Costa, T.B.; Vallance, J.; Maier, E.A.; Betz, K.J.; Aihara, E.; Mahe, M.M.; Lima, A.A.; Oriá, R.B.; et al. Glutamine and alanyl-glutamine promote crypt expansion and mTOR signaling in murine enteroids. Am. J. Physiol.-Gastrointest. Liver 2015, 308, G831–G839. [Google Scholar] [CrossRef] [Green Version]
- Sakamoto, M.I.; Murakami, A.E.; Silveira, T.G.V.; Fernandes, J.I.M.; de Oliveira, C.A.L. Influence of glutamine and vitamin E on the performance and the immune responses of broiler chickens. Braz. J. Poult. Sci. 2006, 8, 243–249. [Google Scholar] [CrossRef] [Green Version]
- Zhang, B.; Lin, M.; Yu, C.; Li, J.; Zhang, L.; Zhou, P.; Yang, W.; Gao, F.; Zhou, G. Alanyl-glutamine supplementation regulates mTOR and ubiquitin proteasome proteolysis signaling pathways in piglets. Nutrition 2016, 32, 1123–1131. [Google Scholar] [CrossRef]
- Soares, A.D.; Costa, K.A.; Wanner, S.P.; Santos, R.G.; Fernandes, S.O.; Martins, F.S.; Nicoli, J.R.; Coimbra, C.C.; Cardoso, V.N. Dietary glutamine prevents the loss of intestinal barrier function and attenuates the increase in core body temperature induced by acute heat exposure. Br. J. Nutr. 2014, 112, 1601–1610. [Google Scholar] [CrossRef] [Green Version]
- Zhang, B.; Yu, C.; Lin, M.; Fu, Y.; Zhang, L.; Meng, M.; Xing, S.; Li, J.; Sun, H.; Gao, F.; et al. Regulation of skeletal muscle protein synthetic and degradative signaling by alanyl-glutamine in piglets challenged with Escherichia coli lipopolysaccharide. Nutrition 2015, 31, 749–756. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.; Meier, S.A.; Knabe, D.A. Dietary Glutamine Supplementation Prevents Jejunal Atrophy in Weaned Pigs. J. Nutr. 1996, 126, 2578–2584. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.L.; Yang, Q.; Song, P.Y.; Xie, Y.X.; Wang, Q.R.; Sun, Z.W. Effects of dietary L-glutamine supplementation on plasma biochemical parameters, immune performance, intestinal inflammatory factors expression and mucosal immune of broilers challenged by lipopolysaccharide. Chin. J. Anim. Nutr. 2020, 32, 2611–2623. (In Chinese) [Google Scholar] [CrossRef]
- Zhang, W.; Jiang, Y.; Zhu, Q.; Gao, F.; Dai, S.; Chen, J.; Zhou, G. Sodium butyrate maintains growth performance by regulating the immune response in broiler chickens. Br. Poult. Sci. 2011, 52, 292–301. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−∆∆Ct Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Wang, W.; Li, Z.; Han, Q.; Guo, Y.; Zhang, B.; D’inca, R. Dietary live yeast and mannan-oligosaccharide supplementation attenuate intestinal inflammation and barrier dysfunction induced by Escherichia coli in broilers. Br. J. Nutr. 2016, 116, 1878–1888. [Google Scholar] [CrossRef] [Green Version]
- Fowler, J.; Kakani, R.; Haq, A.; Byrd, J.A.; Bailey, C.A. Growth promoting effects of prebiotic yeast cell wall products in starter broilers under an immune stress and Clostridium perfringens challenge. J. Appl. Poult. Res. 2015, 24, 66–72. [Google Scholar] [CrossRef]
- Hu, X.F.; Guo, Y.M.; Li, J.H.; Yan, G.L.; Bun, S.; Huang, B.Y. Effects of an early lipopolysaccharide challenge on growth and small intestinal structure and function of broiler chickens. Can. J. Anim. Sci. 2011, 91, 379–384. [Google Scholar] [CrossRef] [Green Version]
- Vichaya, E.G.; Hunt, S.C.; Dantzer, R. Lipopolysaccharide Reduces Incentive Motivation While Boosting Preference for High Reward in Mice. Neuropsychopharmacol. Off. Publ. Am. Coll. Neuropsychopharmacol. 2014, 39, 2884–2890. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Zhao, L.; Cao, F.; Ahmad, H.; Wang, G.; Wang, T. Effects of feeding fermented Ginkgo biloba leaves on small intestinal morphology, absorption, and immunomodulation of early lipopolysaccharide-challenged chicks. Poult. Sci. 2013, 92, 119–130. [Google Scholar] [CrossRef]
- Zhang, P.; Shi, B.L.; Su, J.L.; Yue, Y.X.; Cao, Z.X.; Chu, W.B.; Li, K.; Yan, S.M. Relieving effect of Artemisia argyi aqueous extract on immune stress in broilers. J. Anim. Physiol. Anim. Nutr. 2017, 101, 251–258. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Shen, J.; Zhao, C.; Wang, X.; Yao, J.; Gong, Y.; Yang, X. Dietary Astragalus polysaccharide alleviated immunological stress in broilers exposed to lipopolysaccharide. Int. J. Biol. Macromol. 2015, 72, 624–632. [Google Scholar] [CrossRef] [PubMed]
- Dai, S.F.; Wang, L.K.; Wen, A.Y.; Wang, L.X.; Jin, G.M. Dietary glutamine supplementation improves growth performance, meat quality and colour stability of broilers under heat stress. Br. Poult. Sci. 2009, 50, 333–340. [Google Scholar] [CrossRef]
- Jin, S.; Yang, H.; Jiao, Y.; Pang, Q.; Wang, Y.; Wang, M.; Shan, A.; Feng, X. Anas platyrhynchosDietary Curcumin Alleviated Acute Ileum Damage of Ducks (Anas platyrhynchos) Induced by AFB1 through Regulating Nrf2-ARE and NF-κB Signaling Pathways. Foods 2021, 10, 1370. [Google Scholar] [CrossRef]
- Wu, Q.; Liu, N.; Wu, X.; Wang, G.; Lin, L. Glutamine alleviates heat stress-induced impairment of intestinal morphology, intestinal inflammatory response, and barrier integrity in broilers. Poult. Sci. 2018, 97, 2675–2683. [Google Scholar] [CrossRef]
- Xue, G.; Barekatain, R.; Wu, S.; Choct, M.; Swick, R. Dietary L-glutamine supplementation improves growth performance, gut morphology, and serum biochemical indices of broiler chickens during necrotic enteritis challenge. Poult. Sci. 2018, 97, 1334–1341. [Google Scholar] [CrossRef] [PubMed]
- Viveros, A.; Chamorro, S.; Pizarro, M.; Arija, I.; Centeno, C.; Brenes, A. Effects of dietary polyphenol-rich grape products on intestinal microflora and gut morphology in broiler chicks. Poult. Sci. 2011, 90, 566–578. [Google Scholar] [CrossRef]
- Deventer, S.J.V. Tumour necrosis factor and Crohn’s disease. Gut 1997, 40, 443–448. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.; Zhang, H.; Cheng, Y.; Li, Y.; Wen, C.; Zhou, Y. Dietary l-threonine supplementation attenuates lipopolysaccharide-induced inflammatory responses and intestinal barrier damage of broiler chickens at an early age. Br. J. Nutr. 2018, 119, 1254–1262. [Google Scholar] [CrossRef]
- Xu, C.; Sun, R.; Qiao, X.; Xu, C.; Shang, X.; Niu, W. Protective effect of glutamine on intestinal injury and bacterial community in rats exposed to hypobaric hypoxia environment. World J. Gastroenterol. 2014, 20, 4662–4674. [Google Scholar] [CrossRef]
- Achamrah, N.; Déchelotte, P.; Coëffier, M. Glutamine and the regulation of intestinal permeability: From bench to bedside. Curr. Opin. Clin. Nutr. 2017, 20, 86–91. [Google Scholar] [CrossRef] [PubMed]
- Turner, J.R.; Buschmann, M.M.; Romero-Calvo, I.; Sailer, A.; Shen, L. The role of molecular remodeling in differential regulation of tight junction permeability. Semin. Cell Dev. Biol. 2014, 36, 204–212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, H.; Zhang, C.; Wu, G.; Sun, Y.; Wang, B.; He, B.; Dai, Z.; Wu, Z. Glutamine enhances tight junction protein expression and modulates corticotropin-releasing factor signaling in the jejunum of weanling piglets. J. Nutr. 2015, 145, 25–31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beutheu, S.; Ghouzali, I.; Galas, L.; Déchelotte, P.; Coëffier, M. Glutamine and arginine improve permeability and tight junction protein expression in methotrexate-treated Caco-2 cells. Clin. Nutr. 2013, 32, 863–869. [Google Scholar] [CrossRef]
- Vincent, G.D.; Nan, L.; Justin, T.; Christopher, M.W.; Josef, N. Glutamine and barrier function in cultured Caco-2 epithelial cell monolayers. J. Nutr. 2003, 133, 2176–2179. [Google Scholar] [CrossRef] [Green Version]
- Guo, S.; Nighot, M.; Al-Sadi, R.; Alhmoud, T.; Nighot, P.; Ma, T.Y. Lipopolysaccharide Regulation of Intestinal Tight Junction Permeability Is Mediated by TLR4 Signal Transduction Pathway Activation of FAK and MyD88. J. Immunol. 2015, 195, 4999–5010. [Google Scholar] [CrossRef]
- Luo, H.; Guo, P.; Zhou, Q. Role of TLR4/NF-κB in damage to intestinal mucosa barrier function and bacterial translocation in rats exposed to hypoxia. PLoS ONE 2012, 7, e46291. [Google Scholar] [CrossRef] [Green Version]
- Sukhotnik, I.; Khateeb, K.; Mogilner, J.; Helou, H.; Lurie, M.; Coran, A.; Shiloni, E. Dietary glutamine supplementation prevents mucosal injury and modulates intestinal epithelial restitution following ischemia-reperfusion injury in the rat. Dig. Dis. Sci. 2007, 52, 1497–1504. [Google Scholar] [CrossRef]
- Ewaschuk, J.B.; Murdoch, G.K.; Johnson, I.R.; Madsen, K.L.; Field, C.J. Glutamine supplementation improves intestinal barrier function in a weaned piglet model of Escherichia coli infection. Br. J. Nutr. 2011, 106, 870–877. [Google Scholar] [CrossRef] [Green Version]
Ingredients (g/kg Diet) | Nutrient Content (g/kg Diet) | ||
---|---|---|---|
Maize | 563.0 | Crude protein ‡ | 210.8 |
Wheat bran | 51.30 | Metabolism energy (MJ/kg) | 121.2 |
Soybean meal | 285.0 | Calcium (%) | 10.00 |
Corn gluten meal | 43.0 | Phosphorus (%) | 4.50 |
DL-Methionine | 1.50 | DL-Methionine (%) | 8.60 |
Phytase | 0.40 | L-Lysine (%) | 10.60 |
Choline | 1.50 | Threonine (%) | 8.0 |
Dicalcium phosphate | 18.70 | ||
Limestone | 12.60 | ||
Salt | 1.50 | ||
Soybean oil | 16.50 | ||
Vitamin and mineral premix † | 5.00 |
Genes | Primers (5′→3′) | Product Size | Gene Bank 1 |
---|---|---|---|
Occludin | Sense: GTTACTACTACAGCCCCTTGTTGG | 142 bp | NM_205128.1 |
Antisense: AGCAGGATGACGATGAGGAA | |||
Claudin-1 | Sense: AAGAAGATGCGGATGGCTGT | 158 bp | NM_001013611.2 |
Antisense: AAGAGGGCTGATCCAAACTCAA | |||
ZO-1 | Sense: CTTCAGGTGTTTCTCTTCCTCCTC | 131 bp | XM_015278980.2 |
Antisense: CTGTGGTTTCATGGCTGGATC | |||
TLR4 | Sense: TTCGGTTGGTGGACCTGAATCTTG | 114 bp | NM_001030693.1 |
Antisense:ACAGCTTCTCAGCAGGCAATTCC | |||
FAK | Sense: CTGTCCTACGCCGACCTCAT | 74 bp | NM_205435.1 |
Antisense: TTGCTGTCACCCTTATCCTTG | |||
MyD88 | Sense: AAGGTGTCGGAGGATGGTGGTC | 120 bp | NM_001030962.4 |
Antisense: GGAATCAGCCGCTTGAGACGAG | |||
IRAK4 | Sense: TGGTTCGCTGCTTGACAGACTTG | 98 bp | NM_001030738.1 |
Antisense: TGATGCCATTCGCAGTACCTTGAG | |||
β-actin | Sense: ATTGTCCACCGCAAATGCTTC | 113 bp | NM_205518.1 |
Antisense:AAATAAAGCCATGCCAATCTCGTC |
Item | Saline | LPS | SEM | p Value | ||||
---|---|---|---|---|---|---|---|---|
Ala | Gln | Ala | Gln | LPS | Gln | LPS × Gln | ||
ADG (g) | 46.36 | 50.14 | 41.80 | 45.50 | 0.586 | <0.001 | <0.001 | 0.954 |
ADFI (g) | 72.07 | 75.48 | 68.59 | 70.99 | 0.774 | 0.003 | 0.021 | 0.661 |
F/G (g/g) | 1.55 | 1.51 | 1.65 | 1.56 | 0.016 | 0.009 | 0.016 | 0.508 |
Item | Saline | LPS | SEM | p Value | ||||
---|---|---|---|---|---|---|---|---|
Ala | Gln | Ala | Gln | LPS | Gln | LPS × Gln | ||
Duodenum | ||||||||
Villus height (μm) | 945.2 | 1016.4 | 851.8 | 885.1 | 15.474 | <0.001 | 0.027 | 0.401 |
Crypt depth (μm) | 183.9 | 168.2 | 196.7 | 183.3 | 3.603 | 0.043 | 0.039 | 0.852 |
H:C (μm/μm) | 5.15 | 6.09 | 4.38 | 4.90 | 0.152 | <0.001 | 0.002 | 0.339 |
Jejunum | ||||||||
Villus height (μm) | 880.2 | 961.9 | 802.3 | 835.7 | 13.178 | <0.001 | 0.004 | 0.194 |
Crypt depth (μm) | 172.7 c | 160.8 d | 205.7 a | 182.1 b | 3.164 | <0.001 | <0.001 | 0.018 |
H:C (μm/μm) | 5.09 | 6.00 | 3.91 | 4.59 | 0.152 | <0.001 | <0.001 | 0.417 |
Ileum | ||||||||
Villus height (μm) | 656.1 | 700.8 | 541.1 | 581.9 | 11.629 | <0.001 | <0.001 | 0.779 |
Crypt depth (μm) | 184.7 | 181.0 | 190.7 | 188.2 | 1.148 | 0.002 | 0.128 | 0.761 |
H:C (μm/μm) | 3.56 | 3.87 | 3.07 | 3.25 | 0.059 | <0.001 | <0.001 | 0.168 |
Item | Saline | LPS | SEM | p value | ||||
---|---|---|---|---|---|---|---|---|
Ala | Gln | Ala | Gln | LPS | Gln | LPS × Gln | ||
Duodenum | ||||||||
Claudin-1 | 1.05 | 1.50 | 0.85 | 1.11 | 0.069 | 0.001 | 0.006 | 0.323 |
Occludin | 1.03 | 1.18 | 0.77 | 0.85 | 0.042 | <0.001 | 0.019 | 0.383 |
ZO-1 | 1.04 | 1.18 | 0.71 | 0.92 | 0.051 | 0.006 | 0.115 | 0.936 |
Jejunum | ||||||||
Claudin-1 | 1.00 | 1.47 | 0.41 | 0.89 | 0.088 | <0.001 | <0.001 | 0.840 |
Occludin | 1.01 | 1.25 | 0.73 | 0.91 | 0.056 | 0.001 | 0.013 | 0.699 |
ZO-1 | 0.99 | 1.26 | 0.65 | 0.87 | 0.062 | <0.001 | 0.005 | 0.748 |
Ileum | ||||||||
Claudin-1 | 1.01 | 1.37 | 0.63 | 0.89 | 0.066 | <0.001 | <0.001 | 0.398 |
Occludin | 1.07 | 1.21 | 0.72 | 0.84 | 0.066 | 0.004 | 0.234 | 0.879 |
ZO-1 | 1.00 | 1.24 | 0.87 | 0.99 | 0.044 | 0.011 | 0.016 | 0.382 |
Item | Saline | LPS | SEM | p Value | ||||
---|---|---|---|---|---|---|---|---|
Ala | Gln | Ala | Gln | LPS | Gln | LPS × Gln | ||
Duodenum | ||||||||
TLR4 | 1.00 b | 0.74 c | 1.46 a | 0.97 b | 0.042 | <0.001 | <0.001 | 0.003 |
FAK | 1.06 | 0.62 | 1.21 | 0.81 | 0.051 | 0.037 | <0.001 | 0.785 |
MyD88 | 1.03 | 0.77 | 1.26 | 1.03 | 0.058 | 0.031 | 0.029 | 0.852 |
IRAK4 | 1.08 | 0.67 | 1.26 | 1.05 | 0.051 | 0.001 | <0.001 | 0.230 |
Jejunum | ||||||||
TLR4 | 1.04 | 0.56 | 1.31 | 0.98 | 0.066 | 0.003 | 0.001 | 0.479 |
FAK | 1.03 | 0.71 | 1.21 | 0.90 | 0.044 | 0.013 | <0.001 | 0.988 |
MyD88 | 1.01 | 0.53 | 1.35 | 0.87 | 0.064 | 0.002 | <0.001 | 0.998 |
IRAK4 | 1.01 | 0.77 | 1.26 | 0.91 | 0.057 | 0.038 | 0.004 | 0.541 |
Ileum | ||||||||
TLR4 | 1.01 | 0.68 | 1.63 | 1.12 | 0.059 | <0.001 | <0.001 | 0.186 |
FAK | 1.01 | 0.88 | 1.14 | 0.96 | 0.025 | 0.016 | 0.0011 | 0.548 |
MyD88 | 1.05 a | 0.48 c | 1.11 a | 0.84 b | 0.042 | <0.001 | <0.001 | 0.001 |
IRAK4 | 1.04 | 0.57 | 1.27 | 0.88 | 0.072 | 0.038 | 0.002 | 0.749 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, B.; Zhong, Q.; Liu, N.; Song, P.; Zhu, P.; Zhang, C.; Sun, Z. Dietary Glutamine Supplementation Alleviated Inflammation Responses and Improved Intestinal Mucosa Barrier of LPS-Challenged Broilers. Animals 2022, 12, 1729. https://doi.org/10.3390/ani12131729
Zhang B, Zhong Q, Liu N, Song P, Zhu P, Zhang C, Sun Z. Dietary Glutamine Supplementation Alleviated Inflammation Responses and Improved Intestinal Mucosa Barrier of LPS-Challenged Broilers. Animals. 2022; 12(13):1729. https://doi.org/10.3390/ani12131729
Chicago/Turabian StyleZhang, Bolin, Qingzhen Zhong, Ning Liu, Peiyong Song, Peng Zhu, Caichao Zhang, and Zewei Sun. 2022. "Dietary Glutamine Supplementation Alleviated Inflammation Responses and Improved Intestinal Mucosa Barrier of LPS-Challenged Broilers" Animals 12, no. 13: 1729. https://doi.org/10.3390/ani12131729
APA StyleZhang, B., Zhong, Q., Liu, N., Song, P., Zhu, P., Zhang, C., & Sun, Z. (2022). Dietary Glutamine Supplementation Alleviated Inflammation Responses and Improved Intestinal Mucosa Barrier of LPS-Challenged Broilers. Animals, 12(13), 1729. https://doi.org/10.3390/ani12131729