The Sexual Effect of Chicken Embryos on the Yolk Metabolites and Liver Lipid Metabolism
Abstract
Simple Summary
Abstract
1. Introduction
2. Material and Methods
2.1. Sample Collection
2.2. Sex Determination
2.3. Metabolites Extraction
2.4. UHPLC–MS/MS Analysis
2.5. Data Processing and Metabolite Identification
2.6. RT-qPCR
3. Results
3.1. Yolk Metabolites of Chicken Embryos with Different Sexes at E7
3.2. Yolk Metabolites of Chicken Embryos with Different Sexes at E11
3.3. Yolk Metabolites of Chicken Embryos with Different Sexes at E15
3.4. Yolk Metabolites of Chicken Embryos with Different Sexes at E19
3.5. The Developmental Change of Lipid-Related Gene Expression in Embryo Livers with Different Sexes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Givisiez, P.E.N.; Filho, A.L.M.; Santos, M.R.B.; Oliveira, H.B.; Ferket, P.R.; Oliveira, C.J.B.; Malheiros, R.D. Chicken embryo development: Metabolic and morphological basis for in ovo feeding technology. Poult. Sci. 2020, 99, 6774–6782. [Google Scholar] [CrossRef]
- Van Der Wagt, I.; De Jong, I.C.; Mitchell, M.A.; Molenaar, R.; Brand, H.V.D. A review on yolk sac utilization in poultry. Poult. Sci. 2020, 99, 2162–2175. [Google Scholar] [CrossRef]
- Sun, C.; Liu, J.; Yang, N.; Xu, G. Egg quality and egg albumen property of domestic chicken, duck, goose, turkey, quail, and pigeon. Poult. Sci. 2019, 98, 4516–4521. [Google Scholar] [CrossRef] [PubMed]
- Wong, E.; Uni, Z. Centennial Review: The chicken yolk sac is a multifunctional organ. Poult. Sci. 2021, 100, 100821. [Google Scholar] [CrossRef] [PubMed]
- Dayan, J.; Reicher, N.; Melkman-Zehavi, T.; Uni, Z. Incubation temperature affects yolk utilization through changes in ex-pression of yolk sac tissue functional genes. Poult Sci. 2020, 99, 6128–6138. [Google Scholar] [CrossRef] [PubMed]
- Zechner, R.; Strauss, J.; Frank, S.; Wagner, E.; Hofmann, W.; Kratky, D.; Hiden, M. The role of lipoprotein lipase in adipose tissue development and metabolism. Int. J. Obes. 2000, 24, S53–S56. [Google Scholar] [CrossRef]
- Feoli-Fonseca, J.C.; Lévy, E.; Godard, M.; Lambert, M. Familial lipoprotein lipase deficiency in infancy: Clinical, biochemical, and molecular study. J. Pediatr. 1998, 133, 417–423. [Google Scholar] [CrossRef]
- Mullen, G.E.; Yet, L. Progress in the development of fatty acid synthase inhibitors as anticancer targets. Bioorg. Med. Chem. Lett. 2015, 25, 4363–4369. [Google Scholar] [CrossRef]
- Kautzky-Willer, A.; Harreiter, J. Sex and gender differences in therapy of type 2 diabetes. Diabetes Res. Clin. Pract. 2017, 131, 230–241. [Google Scholar] [CrossRef] [PubMed]
- Smith, C.A.; Sinclair, A. Sex determination: Insights from the chicken. BioEssays 2004, 26, 120–132. [Google Scholar] [CrossRef]
- Cui, L.; Zhang, X.; Cheng, R.; Ansari, A.R.; Elokil, A.A.; Hu, Y.; Chen, Y.; Nafady, A.A.; Liu, H. Sex differences in growth performance are related to cecal microbiota in chicken. Microb. Pathog. 2021, 150, 104710. [Google Scholar] [CrossRef]
- Zhao, L.; Wang, G.; Siegel, P.; He, C.; Wang, H.; Zhao, W.; Zhai, Z.; Tian, F.; Zhao, J.; Zhang, H.; et al. Quantitative Genetic Background of the Host Influences Gut Microbiomes in Chickens. Sci. Rep. 2013, 3, srep01163. [Google Scholar] [CrossRef]
- Liu, H.; Ding, P.; Tong, Y.; He, X.; Yin, Y.; Zhang, H.; Song, Z. Metabolomic analysis of the egg yolk during the embryonic development of broilers. Poult. Sci. 2021, 100, 101014. [Google Scholar] [CrossRef]
- Wang, Y.; Jin, G.; Ma, M.; Xiang, X. Sex differences in serum steroid hormone levels during embryonic development in hen eggs. Poult. Sci. 2019, 98, 6053–6062. [Google Scholar] [CrossRef] [PubMed]
- Roig, B.; Cadiere, A.; Bressieux, S.; Biau, S.; Faure, S.; Barbara, P.D.S. Environmental concentration of nonylphenol alters the development of urogenital and visceral organs in avian model. Environ. Int. 2014, 62, 78–85. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Cui, L.; Lu, H.; Lee, Y.H. Challenges and emergent solutions for LC-MS/MS based untargeted metabolomics in diseases. Mass Spectrom. Rev. 2018, 37, 772–792. [Google Scholar] [CrossRef] [PubMed]
- Niu, C.; Ye, W.; Cui, X.; Sun, J.; Xiao, S.; Chen, G.; Bao, S.; Chen, R. UHPLC-MS/MS method for the quantification of aloin-A in rat plasma and its application to a pharmacokinetic study. J. Pharm. Biomed. Anal. 2020, 178, 112928. [Google Scholar] [CrossRef] [PubMed]
- Hester, J.; Ventetuolo, C.; Lahm, T. Sex, Gender, and Sex Hormones in Pulmonary Hypertension and Right Ventricular Failure. Compr. Physiol. 2019, 10, 125–170. [Google Scholar] [CrossRef] [PubMed]
- Pósa, A.; Szabó, R.; Csonka, A.; Veszelka, M.; Berkó, A.M.; Baráth, Z.; Ménesi, R.; Pávó, I.; Gyongyosi, M.; László, F.; et al. Endogenous Estrogen-Mediated Heme Oxygenase Regulation in Experimental Menopause. Oxidative Med. Cell. Longev. 2015, 2015, 429713. [Google Scholar] [CrossRef]
- Liu, X.; Xue, R.; Yang, C.; Gu, J.; Chen, S.; Zhang, S. Cholestasis-induced bile acid elevates estrogen level via farnesoid X re-ceptor-mediated suppression of the estrogen sulfotransferase SULT1E1. J. Biol. Chem. 2018, 293, 12759–12769. [Google Scholar] [CrossRef]
- Di Ciaula, A.; Garruti, G.; Baccetto, R.; Molina, E.M.; Bonfrate, L.; Wang, D.Q.-H.; Portincasa, P. Bile Acid Physiology. Ann. Hepatol. 2017, 16, S4–S14. [Google Scholar] [CrossRef] [PubMed]
- Norlin, M.; Andersson, U.; Björkhem, I.; Wikvall, K. Oxysterol 7α-Hydroxylase Activity by Cholesterol 7α-Hydroxylase (CYP7A). J. Biol. Chem. 2000, 275, 34046–34053. [Google Scholar] [CrossRef] [PubMed]
- Jiao, N.; Baker, S.S.; Chapa-Rodriguez, A.; Liu, W.; Nugent, C.A.; Tsompana, M.; Mastrandrea, L.; Buck, M.J.; Baker, R.D.; Genco, R.J.; et al. Suppressed hepatic bile acid signalling despite elevated production of primary and secondary bile acids in NAFLD. Gut 2018, 67, 1881–1891. [Google Scholar] [CrossRef] [PubMed]
- Barekatain, R.; Chrystal, P.; Howarth, G.; McLaughlan, C.; Gilani, S.; Nattrass, G. Performance, intestinal permeability, and gene expression of selected tight junction proteins in broiler chickens fed reduced protein diets supplemented with arginine, glutamine, and glycine subjected to a leaky gut model. Poult. Sci. 2019, 98, 6761–6771. [Google Scholar] [CrossRef]
- Morris, J.S.M. Arginine Metabolism Revisited. J. Nutr. 2016, 146, 2579S–2586S. [Google Scholar] [CrossRef]
- De Palma, C.; Clementi, E. Nitric Oxide in Myogenesis and Therapeutic Muscle Repair. Mol. Neurobiol. 2012, 46, 682–692. [Google Scholar] [CrossRef]
- Cruzat, V.; Macedo Rogero, M.; Keane, K.N.; Curi, R.; Newsholme, P. Glutamine: Metabolism and Immune Function, Supplementation and Clinical Translation. Nutrients 2018, 10, 1564. [Google Scholar] [CrossRef]
- Gao, X.; Lee, K.; Reid, M.; Sanderson, S.M.; Qiu, C.; Li, S.; Liu, J.; Locasale, J.W. Serine Availability Influences Mitochondrial Dynamics and Function through Lipid Metabolism. Cell Rep. 2018, 22, 3507–3520. [Google Scholar] [CrossRef]
- Marceau, G.; Gallot, D.; Lemery, D.; Sapin, V. Metabolism of retinol during mammalian placental and embryonic develop-ment. Vitam. Horm. 2007, 75, 97–115. [Google Scholar]
- Suyama, K.; Adachi, S.; Sugawara, H.; Honjoh, H. Stereospecific analysis of glycerolipids of egg yolk of Japanese quail (Coturnix coturnix japonica). Lipids 1979, 14, 707–709. [Google Scholar] [CrossRef]
- Dunham, E.W.; Balasingam, M.; Privett, O.S.; Nickell, E.C. Effects of essential fatty acid deficiency on prostaglandin synthesis and fatty acid composition in rat renal medulla. Lipids 1978, 13, 892–897. [Google Scholar] [CrossRef] [PubMed]
- Liddle, G.W.; Hardman, J.G. Cyclic Adenosine Monophosphate as a Mediator of Hormone Action. N. Engl. J. Med. 1971, 285, 560–566. [Google Scholar] [CrossRef] [PubMed]
- Rezaei, M.; Wall, H.; Tarshan, M.; Ivarsson, E. Evaluation of broiler chickens’ digestibility of Neurospora intermedia biomass. Poult. Sci. 2019, 98, 5017–5022. [Google Scholar] [CrossRef] [PubMed]
- Flydal, M.; Martinez, A. Phenylalanine hydroxylase: Function, structure, and regulation. Iubmb Life 2013, 65, 341–349. [Google Scholar] [CrossRef] [PubMed]
- Yin, J.; Ren, W.; Chen, S.; Li, Y.; Han, H.; Gao, J.; Liu, G.; Wu, X.; Li, T.; Kim, S.W.; et al. Metabolic Regulation of Methionine Restriction in Diabetes. Mol. Nutr. Food Res. 2018, 62, e1700951. [Google Scholar] [CrossRef]
- Stincone, A.; Prigione, A.; Cramer, T.; Wamelink, M.M.C.; Campbell, K.; Cheung, E.; Olin-Sandoval, V.; Grüning, N.-M.; Krüger, A.; Alam, M.T.; et al. The return of metabolism: Biochemistry and physiology of the pentose phosphate pathway. Biol. Rev. 2015, 90, 927–963. [Google Scholar] [CrossRef]
- Burke, W. Sex Differences in Incubation Length and Hatching Weights of Broiler Chicks. Poult. Sci. 1992, 71, 1933–1938. [Google Scholar] [CrossRef]
Primer Name | Sequence | Accession Number | Annealing Temperature/°C | Amplicon Size |
---|---|---|---|---|
LPL-F | ATGTTCATTGATTGGATGGAGGAG | NM_205282.2 | 58 | 139 |
LPL-R | AAAGGTGGGACCAGCAGGAT | |||
FAS-F | AAGGCGGAAGTCAACGG | NM_205155.4 | 55 | 196 |
FAS-R | TTGATGGTGAGGAGTCG | |||
RPL4-F | TTATGCCATCTGTTCTGCC | NM_001007479.1 | 60 | 235 |
RPL4-R | GCGATTCCTCATCTTACCCT | |||
β-actin-F | TCTTGGGTATGGAGTCCTG | NM_205518 | 60 | 331 |
β-actin-R | TAGAAGCATTTGCGGTGG |
Items | FC | log2(FC) | Raw. p Value | −log10(p) |
---|---|---|---|---|
N-(5-acetamidopentyl)acetamide | 0.4489 | −1.1556 | 5.28 × 10−7 | 6.2771 |
PS (18:0/20:4) | 0.2523 | −1.9867 | 3.21 × 10−6 | 5.4928 |
OxPE (16:0-22:5 + 1O (1Cyc)) | 0.4755 | −1.0725 | 1.51 × 10−5 | 4.8201 |
2-[6-(1H-benzo[d]imidazol-2-yl)-2-pyridyl]-1H-benzo[d]imidazole | 2.2982 | 1.2005 | 0.00010772 | 3.9677 |
MGDG (16:0/18:2) | 0.3856 | −1.3751 | 0.00012132 | 3.9161 |
5,6-dimethyl-4-oxo-4H-pyran-2-carboxylic acid | 0.3020 | −1.7276 | 0.00014683 | 3.8332 |
HexCer-NS (d18:1/16:1) | 0.3278 | −1.6091 | 0.00014999 | 3.8239 |
Tyrosol | 0.4280 | −1.2245 | 0.00026848 | 3.5711 |
LPE (24:2) | 0.32650 | −1.6149 | 0.00036824 | 3.4339 |
Glycine anhydride | 2.0760 | 1.0538 | 0.00045261 | 3.3443 |
Items | FC | log2(FC) | Raw. p Value | −log10(p) |
---|---|---|---|---|
PE (18:0e/22:6) | 2.0357 | 1.0255 | 1.15 × 10−7 | 6.9409 |
PG (16:0/18:2) | 0.3433 | −1.5426 | 7.70 × 10−7 | 6.1136 |
Cer-NS (d18:1/18:1) | 4.7743 | 2.2553 | 4.53 × 10−6 | 5.3443 |
Coniferin | 5.2519 | 2.3928 | 1.02 × 10−5 | 4.9932 |
PMeOH (16:0-22:6) | 0.3584 | −1.4804 | 2.48 × 10−5 | 4.6053 |
SM (d14:2/22:0) | 2.7421 | 1.4553 | 6.21 × 10−5 | 4.2071 |
Cer-NS (d18:1/18:2) | 12.5100 | 3.6450 | 6.91 × 10−5 | 4.1602 |
L-Cysteine-glutathione disulfide | 3.1844 | 1.6710 | 0.00028323 | 3.5479 |
L-Dopa | 6.1579 | 2.6224 | 0.00028991 | 3.5377 |
PE (18:0e/22:5) | 0.3483 | −1.5215 | 0.00030299 | 3.5186 |
Items | FC | log2(FC) | raw. p Value | −log10(p) |
---|---|---|---|---|
4-Pyridoxic acid | 7.7167 | 2.9480 | 1.87 × 10−8 | 7.7282 |
PB-22 N-4-Hydroxypentyl-3-carboxyindole metabolite | 0.4555 | −1.1342 | 4.54 × 10−7 | 6.3427 |
Ecgonine | 0.2821 | −1.8255 | 6.58 × 10−7 | 6.1815 |
Acetylcholine | 0.4199 | −1.2518 | 1.07 × 10−5 | 4.9708 |
PC (20:4/22:6) | 0.0617 | −4.0174 | 1.18 × 10−5 | 4.9278 |
ethyl 2-cyano-3-tetrahydro-3-thiophenylaminoacrylate | 2.9046 | 1.5383 | 1.26 × 10−5 | 4.8980 |
Cresol | 0.2696 | −1.8907 | 1.82 × 10−5 | 4.7388 |
D-Lanthionine | 4.3398 | 2.1176 | 1.89 × 10−5 | 4.7226 |
Betaine | 2.3425 | 1.2280 | 2.14 × 10−5 | 4.6697 |
Linolenoyl ethanolamide | 0.2827 | −1.8223 | 2.14 × 10−5 | 4.6695 |
Items | FC | log2(FC) | Raw. p Value | −log10(p) |
---|---|---|---|---|
PC (16:0/16:2) | 0.0171 | −5.8739 | 1.82 × 10−7 | 6.7390 |
3-3,4-dimethylphenyl-3,4-dihydro-1,2,3-benzotriazin-4-one | 4.1939 | 2.0683 | 1.14 × 10−6 | 5.9436 |
Estradiol-17-glucuronide | 15.3240 | 3.9377 | 1.56 × 10−6 | 5.8079 |
D-Lanthionine | 2.9305 | 1.5511 | 1.63 × 10−6 | 5.7883 |
N-benzyl-N-isopropyl-N’-4-trifluoromethoxyphenylurea | 13.6310 | 3.7688 | 2.63 × 10−6 | 5.5796 |
N-Acetylneuraminic acid | 2.2604 | 1.1766 | 1.31 × 10−5 | 4.8825 |
Cannabidiolic acid | 452.4700 | 8.8217 | 2.09 × 10−5 | 4.6801 |
Senecionine | 2.5237 | 1.3355 | 2.82 × 10−5 | 4.5505 |
2′-Deoxyadenosine | 2.0094 | 1.0068 | 0.00026631 | 3.5746 |
Methyl indole-3-acetate | 0.4684 | −1.0942 | 0.00029525 | 3.5298 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ding, P.; Tong, Y.; Wu, S.; Yin, X.; Liu, H.; He, X.; Song, Z.; Zhang, H. The Sexual Effect of Chicken Embryos on the Yolk Metabolites and Liver Lipid Metabolism. Animals 2022, 12, 71. https://doi.org/10.3390/ani12010071
Ding P, Tong Y, Wu S, Yin X, Liu H, He X, Song Z, Zhang H. The Sexual Effect of Chicken Embryos on the Yolk Metabolites and Liver Lipid Metabolism. Animals. 2022; 12(1):71. https://doi.org/10.3390/ani12010071
Chicago/Turabian StyleDing, Peng, Yueyue Tong, Shu Wu, Xin Yin, Huichao Liu, Xi He, Zehe Song, and Haihan Zhang. 2022. "The Sexual Effect of Chicken Embryos on the Yolk Metabolites and Liver Lipid Metabolism" Animals 12, no. 1: 71. https://doi.org/10.3390/ani12010071
APA StyleDing, P., Tong, Y., Wu, S., Yin, X., Liu, H., He, X., Song, Z., & Zhang, H. (2022). The Sexual Effect of Chicken Embryos on the Yolk Metabolites and Liver Lipid Metabolism. Animals, 12(1), 71. https://doi.org/10.3390/ani12010071