Molecular Analysis of Antimicrobial Resistance among Enterobacteriaceae Isolated from Diarrhoeic Calves in Egypt
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Considerations
2.2. Sampling, Isolation, and Identification Procedures
2.3. Antimicrobial Susceptibility Testing
2.4. DNA Extraction and Screening of Antimicrobial Resistance Genes
2.5. DNA Sequencing
3. Results
3.1. Occurrence of Multidrug Resistant Enterobacteriaceae in Diarrhoeic Calves
3.2. Occurrence of Class 1 and Class 2 Integrons
3.3. Occurrence of β-Lactamases and Florfenicol Resistance Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Sharma, R.; Taku, A.; Malik, A.; Bhat, M.; Javed, R.; Badroo, G.; Kour, A. Molecular characterization and antimicrobial profiling of Escherichia coli isolates from diarrheic calves. Indian J. Anim. Sci. 2017, 87, 1467–1471. [Google Scholar]
- Umpiérrez, A.; Bado, I.; Oliver, M.; Acquistapace, S.; Etcheverría, A.; Padola, N.L.; Vignoli, R.; Zunino, P. Zoonotic potential and antibiotic resistance of Escherichia coli in neonatal calves in Uruguay. Microbes Environ. 2017, 32, 275–282. [Google Scholar] [CrossRef] [Green Version]
- Hammerum, A.M.; Heuer, O.E. Human health hazards from antimicrobial-resistant Escherichia coli of animal origin. Clin. Infect. Dis. 2009, 48, 916–921. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pomba, C.; Rantala, M.; Greko, C.; Baptiste, K.E.; Catry, B.; Van Duijkeren, E.; Mateus, A.; Moreno, M.A.; Pyörälä, S.; Ružauskas, M. Public health risk of antimicrobial resistance transfer from companion animals. Antimicrob. Agents Chemother. 2017, 72, 957–968. [Google Scholar] [CrossRef] [PubMed]
- Rupp, M.E.; Fey, P.D. Extended spectrum β-lactamase (ESBL)-producing Enterobacteriaceae. Drugs 2003, 63, 353–365. [Google Scholar] [CrossRef]
- Adefisoye, M.A.; Okoh, A.I. Identification and antimicrobial resistance prevalence of pathogenic Escherichia coli strains from treated wastewater effluents in Eastern Cape, South Africa. Microbiologyopen 2016, 5, 143–151. [Google Scholar] [CrossRef] [Green Version]
- Hanau-Berçot, B.; Podglajen, I.; Casin, I.; Collatz, E. An intrinsic control element for translational initiation in class 1 integrons. Mol. Microbiol. 2002, 44, 119–130. [Google Scholar] [CrossRef]
- Martinez-Freijo, P.; Fluit, A.C.; Schmitz, F.-J.; Verhoef, J.; Jones, M.E. Many Class I Integrons Comprise Distinct Stable Structures Occurring in Different Species of Enterobacteriaceae Isolated from Widespread Geographic Regions in Europe. Antimicrob. Agents Chemother. 1999, 43, 686–689. [Google Scholar] [CrossRef] [Green Version]
- Recchia, G.D.; Hall, R.M. Plasmid evolution by acquisition of mobile gene cassettes: Plasmid pIE723 contains the aadB gene cassette precisely inserted at a secondary site in the incQ plasmid RSF1010. Mol. Microbiol. 1995, 15, 179–187. [Google Scholar] [CrossRef]
- Nield, B.S.; Holmes, A.J.; Gillings, M.R.; Recchia, G.D.; Mabbutt, B.C.; Nevalainen, K.H.; Stokes, H.W. Recovery of new integron classes from environmental DNA. FEMS Microbiol. Lett. 2001, 195, 59–65. [Google Scholar] [CrossRef]
- Bradford, P.A.; Petersen, P.J.; Fingerman, I.M.; White, D.G. Characterization of expanded-spectrum cephalosporin resistance in E. coli isolates associated with bovine calf diarrhoeal disease. J. Antimicrob. Agents Chemother. 1999, 44, 607–610. [Google Scholar] [CrossRef]
- Cannon, M.; Harford, S.; Davies, J. A comparative study on the inhibitory actions of chloramphenicol, thiamphenicol and some fluorinated derivatives. J. Antimicrob. Chemother. 1990, 26, 307–317. [Google Scholar] [CrossRef]
- White, D.G.; Hudson, C.; Maurer, J.J.; Ayers, S.; Zhao, S.; Lee, M.D.; Bolton, L.; Foley, T.; Sherwood, J. Characterization of chloramphenicol and florfenicol resistance in Escherichia coli associated with bovine diarrhea. J. Clin. Microbiol. 2000, 38, 4593–4598. [Google Scholar] [CrossRef] [Green Version]
- Cho, Y.-I.; Han, J.-I.; Wang, C.; Cooper, V.; Schwartz, K.; Engelken, T.; Yoon, K.-J. Case–control study of microbiological etiology associated with calf diarrhea. Vet. Microbiol. 2013, 166, 375–385. [Google Scholar] [CrossRef] [PubMed]
- Cho, Y.-i.; Yoon, K.-J. An overview of calf diarrhea-infectious etiology, diagnosis, and intervention. J. Vet. Sci. 2014, 15, 1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Constable, P.D. Antimicrobial use in the treatment of calf diarrhea. J. Vet. Intern. Med. 2004, 18, 8–17. [Google Scholar] [CrossRef]
- Izzo, M.; Kirkland, P.; Mohler, V.; Perkins, N.; Gunn, A.; House, J. Prevalence of major enteric pathogens in Australian dairy calves with diarrhoea. Aust. Vet. J. 2011, 89, 167–173. [Google Scholar] [CrossRef] [PubMed]
- Uhde, F.L.K.T.; Sager, H.; Albini, S.; Zanoni, R.; Schelling, E.; Meylan, M. Prevalence of four enteropathogens in the faeces of young diarrhoeic dairy calves in Switzerland. Vet. Rec. 2008, 163, 362–366. [Google Scholar] [CrossRef] [PubMed]
- Ewing, W.H. Edwards and Ewing’s Identification of Enterobacteriaceae; Elsevier Science Publishing Co., Inc.: New York, NY, USA, 1986. [Google Scholar]
- Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing, 27th ed.; CLSI Supplement M100; CLSI: Wayne, IL, USA, 2017; ISBN 1-56238-805-3. [Google Scholar]
- Ahmed, A.M.; Younis, E.E.; Ishida, Y.; Shimamoto, T. Genetic basis of multidrug resistance in Salmonella enterica serovars Enteritidis and Typhimurium isolated from diarrheic calves in Egypt. Acta Trop. 2009, 111, 144–149. [Google Scholar] [CrossRef] [PubMed]
- Levesque, C.; Piche, L.; Larose, C.; Roy, P.H. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob. Agents Chemother. 1995, 39, 185–191. [Google Scholar] [CrossRef] [Green Version]
- Ahmed, A.M.; Motoi, Y.; Sato, M.; Maruyama, A.; Watanabe, H.; Fukumoto, Y.; Shimamoto, T. Zoo animals as reservoirs of gram-negative bacteria harboring integrons and antimicrobial resistance genes. Appl. Environ. Microbiol. 2007, 73, 6686–6690. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahmed, A.M.; Hussein, A.I.; Shimamoto, T. Proteus mirabilis clinical isolate harbouring a new variant of Salmonella genomic island 1 containing the multiple antibiotic resistance region. J. Antimicrob. Chemother. 2007, 59, 184–190. [Google Scholar] [CrossRef] [PubMed]
- Sanger, F.; Nicklen, S.; Coulson, A.R. DNA sequencing with chain-terminating inhibitors. PNAS 1977, 74, 5463–5467. [Google Scholar] [CrossRef] [Green Version]
- Raska, K.; Rasková, H.; Urbanová, Z.; Matĕjovská, D.; Matĕjovská, V.; Palounek, V.; Polák, L. Resistance of gram-negative bacteria to antibiotics in large calf agglomerations. Acta Trop. 1979, 36, 163–170. [Google Scholar]
- Srivani, M.; Reddy, Y.N.; Subramanyam, K.; Reddy, M.R.; Rao, T.S. Prevalence and antimicrobial resistance pattern of Shiga toxigenic Escherichia coli in diarrheic buffalo calves. Vet. World 2017, 10, 774. [Google Scholar] [CrossRef] [Green Version]
- Shahrani, M.; Dehkordi, F.S.; Momtaz, H. Characterization of Escherichia coli virulence genes, pathotypes and antibiotic resistance properties in diarrheic calves in Iran. Biol. Res. 2014, 47, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Singh, B.; Kumar, V.; Sinha, D.; Bhardwaj, M.; Saraf, A.; Vadhana, P. Antimicrobial resistance profile of enteropathogens isolated from diarrhea patients: Herbal antimicrobials, a ray of hope. Ann. Pharm. Pharm. 2017, 2, 1068. [Google Scholar]
- Wall, B.; Mateus, A.; Marshall, L.; Pfeiffer, D.; Lubroth, J.; Ormel, H.; Otto, P.; Patriarchi, A. Drivers, Dynamics and Epidemiology of Antimicrobial Resistance in Animal Production; Food and Agriculture Organization of the United Nations: Rome, Italy, 2016. [Google Scholar]
- Higgins, C.F. Multiple molecular mechanisms for multidrug resistance transporters. Nature 2007, 446, 749–757. [Google Scholar] [CrossRef]
- Ahmed, A.M.; Younis, E.E.; Osman, S.A.; Ishida, Y.; El-Khodery, S.A.; Shimamoto, T. Genetic analysis of antimicrobial resistance in Escherichia coli isolated from diarrheic neonatal calves. Vet. Microbiol. 2009, 136, 397–402. [Google Scholar] [CrossRef] [PubMed]
- Li, K.; Wang, X.; Shahzad, M.; Zhang, H.; Zhao, X.; Jiang, X.; Mehmood, K.; Han, Z.; Wang, L.; Li, J. Antibiotic resistance and screening of the resistant genes of Escherichia coli (E. coli) isolated from diarrheal yak calves in Sichuan Province, China. Trop. Biomed. 2018, 35, 478–486. [Google Scholar] [PubMed]
- de Verdier, K.; Nyman, A.; Greko, C.; Bengtsson, B. Antimicrobial resistance and virulence factors in Escherichia coli from Swedish dairy calves. Acta Vet. Scand. 2012, 54, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Hakim, A.S.; Omara, S.T.; Syame, S.M.; Fouad, E.A. Serotyping, antibiotic susceptibility, and virulence genes screening of Escherichia coli isolates obtained from diarrheic buffalo calves in Egyptian farms. Vet. World 2017, 10, 769. [Google Scholar] [CrossRef] [Green Version]
- Ahmed, A.M.; Shimamoto, T. Molecular characterization of antimicrobial resistance in Gram-negative bacteria isolated from bovine mastitis in Egypt. Microbiol. Immunol. 2011, 55, 318–327. [Google Scholar] [CrossRef] [PubMed]
- Randall, L.; Cooles, S.; Osborn, M.; Piddock, L.; Woodward, M.J. Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK. J. Antimicrob. Chemother. 2004, 53, 208–216. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Du, X.; Shen, Z.; Wu, B.; Xia, S.; Shen, J. Characterization of class 1 integrons-mediated antibiotic resistance among calf pathogenic Escherichia coli. FEMS Microbiol. Lett. 2005, 245, 295–298. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hansson, K.; Sundström, L.; Pelletier, A.; Roy, P.H. IntI2 integron integrase in Tn7. J. Bacteriol. 2002, 184, 1712–1721. [Google Scholar] [CrossRef] [Green Version]
- Jain, A.; Mondal, R. TEM & SHV genes in extended spectrum β-lactamase producing Klebsiella species & their antimicrobial resistance pattern. Indian J. Med. Res. 2008, 128, 759–764. [Google Scholar]
- Cloeckaert, A.; Baucheron, S.; Flaujac, G.; Schwarz, S.; Kehrenberg, C.; Martel, J.-L.; Chaslus-Dancla, E. Plasmid-mediated florfenicol resistance encoded by the floR gene in Escherichia coli isolated from cattle. Antimicrob. Agents Chemother. 2000, 44, 2858–2860. [Google Scholar] [CrossRef] [Green Version]
Primers | Sequence (5’ to 3’) | Amplicon Size (bp) | Target | References |
---|---|---|---|---|
Integrons | ||||
5’-CS | GGCATCCAAGCAGCAAG | Variable | Class 1 integron | [22] |
3’-CS | AAGCAGACTTGACCTGA | |||
hep74 | CGGGATCCCGGACGGCATGCACGATTTGTA | Variable | Class 2 integron | [23] |
hep51 | GATGCCATCGCAAGTACGAG | |||
β-Lactamases | ||||
TEM-F | ATAAAATTCTTGAAGACGAAA | 1080 | blaTEM | [23] |
TEM-R | GACAGTTACCAATGCTTAATC | |||
CTX-M-F | CGCTTTGCGATGTGCAG | 550 | blaCTX-M | [23] |
CTX-M-R | ACCGCGATATCGTTGGT | |||
Florfenicol | ||||
StCM-F | CACGTTGAGCCTCTATATGG | 888 | floR | [24] |
StCM-R | ATGCAGAAGTAGAACGCGAC |
Target gene | Primary Denaturation | Amplification (30 Cycles) | Final Extension | ||
---|---|---|---|---|---|
Secondary Denaturation | Annealing | Extension | |||
Class 1 integron | 94 °C, 10 min | 95 °C, 60 s | 55 °C, 60 s | 72 °C, 3 min | 72 °C, 10 min |
Class 2 integron | 94 °C, 10 min | 94 °C, 60 s | 55 °C, 60 s | 72 °C, 3 min | 72 °C, 10 min |
blaCTX-M | 95 °C, 10 min | 95 °C, 30 s | 50 °C, 30 s | 72 °C, 30 s | 72 °C, 10 min |
blaTEM | 94 °C, 10 min | 94 °C, 30 s | 50 °C, 30 s | 72 °C, 60 s | 72 °C, 10 min |
floR | 94 °C, 10 min | 94 °C, 30 s | 50 °C, 30 s | 72 °C, 60 s | 72 °C, 10 min |
Bacteria | Recovered isolates | Multidrug resistant isolates | ||
---|---|---|---|---|
% | No. | % | No. | |
Escherichia coli | 26.8 | 40 | 8.7 | 13 |
Citrobacter diversus | 18 | 27 | 5.4 | 8 |
Shigella spp. | 16 | 24 | 2.7 | 4 |
Serratia spp. | 12 | 18 | 3.3 | 5 |
Providencia spp. | 6 | 9 | 1.3 | 2 |
Enterobacter spp. | 6 | 9 | 0 | - |
Klebsiella pneumoniae | 6 | 9 | 2.7 | 4 |
Proteus spp. | 4 | 6 | 0 | - |
Klebsiella oxytoca | 2.7 | 4 | 0.7 | 1 |
Morganella morganii | 2 | 3 | 0 | - |
Total | 100 | 149 | 24.8 | 37 |
Number of Resistant Isolates (37) | ||||||||
---|---|---|---|---|---|---|---|---|
Class and Antimicrobials | E. coli (n = 13) | C. diversus (n = 8) | Shigella spp. (n = 4) | Serratia spp. (n = 5) | Providencia spp. (n = 2) | K. pneumoniae (n = 4) | K. oxytoca (n = 1) | Overall Resistance |
Penicillins | ||||||||
Ampicillin | 13 | 8 | 4 | 4 | 2 | 4 | 1 | 36 (97.3%) |
Amoxicillin | 12 | 7 | 3 | 5 | 2 | 4 | 1 | 34 (91.9%) |
Quinolones and fluoroquinolone | ||||||||
Nalidixic acid | 10 | 3 | 3 | 5 | 2 | 4 | 1 | 28 (75.5%) |
Ciprofloxacin | 4 | 3 | 0 | 1 | 0 | 0 | 1 | 9 (24.3%) |
Norfloxacin | 3 | 0 | 0 | 1 | 0 | 0 | 0 | 4 (10.8%) |
Aminoglycosides | ||||||||
Streptomycin | 13 | 6 | 2 | 5 | 2 | 4 | 0 | 32 (86.5%) |
Gentamicin | 7 | 4 | 2 | 4 | 1 | 4 | 1 | 23 (62.2%) |
Spectinomycin | 9 | 3 | 3 | 3 | 2 | 4 | 0 | 24 (64.9%) |
Sulphonamides | ||||||||
Sulfamethoxazole –trimethoprim | 13 | 5 | 2 | 3 | 2 | 4 | 1 | 30 (81%) |
Cephalosporins | ||||||||
Cefotaxime | 4 | 1 | 1 | 0 | 0 | 0 | 0 | 6 (16.2%) |
Phenicols | ||||||||
Chloramphenicol | 3 | 1 | 0 | 0 | 0 | 3 | 0 | 7 (24.3%) |
Tetracyclines | ||||||||
Tetracycline | 13 | 8 | 3 | 5 | 2 | 4 | 1 | 36 (97.3%) |
No. | Bacteria | Resistance Phenotype | Class1 Integrons | Other gene(s) |
---|---|---|---|---|
1 | E. coli | AMC, AMP, CIP, GEN, NAL, NOR, SPT, STR, SXT, TET | dfrA17-aadA5 | blaTEM |
2 | Serratia spp. | AMC, AMP, GEN, NAL, STR, SXT, TET | - | blaTEM |
3 | Shigella spp. | AMC, AMP, NAL, SPT, STR, SXT, TET | dfrA17-aadA5 | blaTEM |
4 | Serratia spp. | AMC, GEN, NAL, NOR, SPT, STR, TET | - | blaTEM |
5 | Serratia spp. | AMC, AMP, CIP, NAL, SPT, STR, SXT, TET | - | blaTEM |
6 | Serratia spp. | AMC, AMP, GEN, NAL, SPT, STR, TET | - | blaTEM |
7 | E. coli | AMC, AMP, CHL, CIP, CTX, GEN, NAL, NOR, SPT, STR, SXT, TET | dfrA12-orf-aadA2 | blaTEM |
8 | E. coli | AMC, AMP, GEN, NAL, SPT, STR, SXT, TET | dfrA1-aadA1 | blaTEM |
9 | Shigella spp. | AMC, AMP, GEN, STR, TET | dfrA17-aadA5 | blaTEM |
10 | C. diversus | AMC, AMP, GEN, STR, TET | dfrA12-orf aadA2 | blaTEM |
11 | E. coli | AMC, AMP, STR, SXT, TET | dfrA17-aadA5 | blaTEM |
12 | C. diversus | AMC, AMP, NAL, STR, TET | dfrA17-aadA5 | blaTEM |
13 | E. coli | AMC, AMP, GEN, NAL, SPT, STR, SXT, TET | dfrA17-aadA5 | blaTEM |
14 | K. pneumoniae | AMC, AMP, CHL, GEN, NAL, SPT, STR, SXT, TET | dfrA12-orf aadA2 | blaTEM, floR |
15 | C. diversus | AMP, CIP, SPT, STR, TET | dfrA12-orf aadA2 | blaTEM |
16 | K. pneumoniae | AMC, AMP, CHL, GEN, NAL, SPT, STR, SXT, TET | dfrA12-orf aadA2 | blaTEM |
17 | E. coli | AMC, AMP, CHL, CTX, NAL, SPT, STR, SXT, TET | dfrA15 | blaTEM, floR |
18 | C. diversus | AMC, AMP, CHL, GEN, SPT, SXT, TET | dfrA1-aadA1 | blaTEM |
19 | C. diversus | AMC, AMP, SPT STR, SXT, TET | aac(3)-Id-aadA7 | blaTEM |
20 | E.coli | AMC, AMP, NAL, STR, SXT, TET | dfrA1-aadA1 | blaTEM |
21 | Shigella spp. | AMC, AMP, NAL, SPT, SXT, TET | dfrA12-orf aadA2 | blaTEM |
22 | E. coli | AMC, AMP, CIP, NAL, NOR, STR, SXT, TET | dfrA12-orf aadA2 | blaTEM |
23 | E. coli | AMC, AMP, GEN, SPT, STR, SXT, TET | aac(3)-Id-aadA7 | blaTEM |
24 | Providencia spp. | AMC, AMP, NAL, SPT, STR, SXT, TET | aac(3)-Id-aadA7 | blaTEM |
25 | C. diversus | AMC, AMP, CIP, GEN, NAL, SXT, TET | dfrA1-aadA1 | blaTEM |
26 | C. diversus | AMC, AMP, CTX, NAL, STR, SXT, TET | - | blaTEM |
27 | C. diversus | AMC, AMP, CIP, GEN, STR, SXT, TET | - | blaTEM |
28 | Shigella spp. | AMP, CTX, GEN, NAL, SPT | dfrA1-aadA1 | blaTEM |
29 | E. coli | AMC, AMP, CIP, GEN, SPT, STR, SXT, TET | dfrA17-aadA5 | blaTEM |
30 | E. coli | AMP, CTX, NAL, SPT, STR, SXT, TET | dfrA17-aadA5 | blaTEM |
31 | Providencia spp. | AMC, AMP, GEN, NAL, SPT, STR, SXT, TET | aac(3)-Id-aadA7 | blaTEM |
32 | E. coli | AMC, AMP, CHL, NAL, SPT, STR, SXT, TET | - | blaTEM |
33 | E. coli | AMC, AMP, CTX, GEN, NAL, STR, SXT, TET | - | blaTEM |
34 | Serratia spp. | AMC, AMP, GEN, NAL, STR, SXT, TET | - | blaTEM |
35 | K. oxytoca | AMC, AMP, CIP, GEN, NAL, SXT, TET | dfrA17-aadA5 | blaTEM |
36 | K. pneumoniae | AMC, AMP, GEN, NAL, SPT, STR, SXT, TET | dfrA12-orf-aadA2 | blaTEM |
37 | K. pneumoniae | AMC, AMP, CHL, GEN, NAL, SPT, STR, SXT, TET | dfrA1-aadA1 | blaTEM |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Meshref, A.-M.E.; Eldesoukey, I.E.; Alouffi, A.S.; Alrashedi, S.A.; Osman, S.A.; Ahmed, A.M. Molecular Analysis of Antimicrobial Resistance among Enterobacteriaceae Isolated from Diarrhoeic Calves in Egypt. Animals 2021, 11, 1712. https://doi.org/10.3390/ani11061712
Meshref A-ME, Eldesoukey IE, Alouffi AS, Alrashedi SA, Osman SA, Ahmed AM. Molecular Analysis of Antimicrobial Resistance among Enterobacteriaceae Isolated from Diarrhoeic Calves in Egypt. Animals. 2021; 11(6):1712. https://doi.org/10.3390/ani11061712
Chicago/Turabian StyleMeshref, Abdel-Moamen E., Ibrahim E. Eldesoukey, Abdulaziz S. Alouffi, Saleh A. Alrashedi, Salama A. Osman, and Ashraf M. Ahmed. 2021. "Molecular Analysis of Antimicrobial Resistance among Enterobacteriaceae Isolated from Diarrhoeic Calves in Egypt" Animals 11, no. 6: 1712. https://doi.org/10.3390/ani11061712
APA StyleMeshref, A.-M. E., Eldesoukey, I. E., Alouffi, A. S., Alrashedi, S. A., Osman, S. A., & Ahmed, A. M. (2021). Molecular Analysis of Antimicrobial Resistance among Enterobacteriaceae Isolated from Diarrhoeic Calves in Egypt. Animals, 11(6), 1712. https://doi.org/10.3390/ani11061712