Next Article in Journal
Behavioural Diversity Study in Bottlenose Dolphin (Tursiops truncatus) Groups and Its Implications for Welfare Assessments
Previous Article in Journal
Changes of Plasma Analytes Reflecting Metabolic Adaptation to the Different Stages of the Lactation Cycle in Healthy Multiparous Holstein Dairy Cows Raised in High-Welfare Conditions
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Analysis of Antimicrobial Resistance among Enterobacteriaceae Isolated from Diarrhoeic Calves in Egypt

by
Abdel-Moamen E. Meshref
1,†,
Ibrahim E. Eldesoukey
1,*,†,
Abdulaziz S. Alouffi
2,*,
Saleh A. Alrashedi
3,
Salama A. Osman
4 and
Ashraf M. Ahmed
1
1
Department of Bacteriology, Mycology and Immunology, Faculty of Veterinary Medicine, Kafrelsheikh University, Kafrelsheikh 33516, Egypt
2
King Abdulaziz City for Science and Technology, Riyadh 11442, Saudi Arabia
3
Central Laboratory at Al Watania Poultry Company, Riyadh 51441, Saudi Arabia
4
Department of Animal Medicine and Infectious Diseases, Faculty of Veterinary Medicine, Kafrelsheikh University, Kafrelsheikh 33516, Egypt
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Animals 2021, 11(6), 1712; https://doi.org/10.3390/ani11061712
Submission received: 20 April 2021 / Revised: 3 June 2021 / Accepted: 5 June 2021 / Published: 8 June 2021
(This article belongs to the Section Veterinary Clinical Studies)

Simple Summary

Bacterial antimicrobial resistance is a serious global health challenge. This study investigated the occurrence of major antimicrobial resistance genes, including integrons, ß-lactamases, and florfenicol in Enterobacteriaceae that were isolated from diarrhoeic calves in Egypt. From 120 calves, 149 isolates of bacteria were recovered, identified, and screened phenotypically against 12 antimicrobials, and molecularly for the presence of the resistance determinants of integrons, ß-lactamases and florfenicol. The findings revealed that 24.8% of the isolates exhibited multidrug resistance. Escherichia coli was found to be the most prevalent multidrug resistant species. Class 1 integrons, blaTEM, and floR genes were detected at incidence rates of 18.8%, 24.8%, and 1.3%, respectively, whereas class 2 integrons and blaCTX-M were not detected in any isolates. The higher incidence of the antimicrobial resistance genes indicate the importance of regular monitoring of the antibiotic susceptibilities of isolated bacteria to minimise the risk of human exposure to pathogens that are resistant to antimicrobials.

Abstract

The present study was designed to investigate the presence of genes that conferred resistance to antimicrobials among Enterobacteriaceae that were isolated from diarrhoeic calves. A total of 120 faecal samples were collected from diarrhoeic calves that were raised in Kafr El-Sheikh governorate, Egypt. The samples were screened for Enterobacteriaceae. A total of 149 isolates of bacteria were recovered and identified; Escherichia coli was found to be the most overwhelming species, followed by Citrobacter diversus, Shigella spp., Serratia spp., Providencia spp., Enterobacter spp., Klebsiella pneumoniae, Proteus spp., Klebsiella oxytoca, and Morganella morganii. All isolates were tested for susceptibility to 12 antimicrobials; resistant and intermediately resistant strains were screened by conventional polymerase chain reaction for the presence of antimicrobial resistance genes. Of the 149 isolates, 37 (24.8%) exhibited multidrug resistant phenotypes. The most prevalent multidrug resistant species were E. coli, C. diversus, Serratia spp., K. pneumoniae, Shigella spp., Providencia spp., and K. oxytoca. Class 1 integrons were detected in 28 (18.8%) isolates. All isolates were negative for class 2 integrons. The blaTEM gene was identified in 37 (24.8%) isolates, whereas no isolates carried the blaCTX-M gene. The florfenicol gene (floR) was detected in two bacterial isolates (1.3%). The findings of this study reveal that calves may act as potential reservoirs of multidrug resistant bacteria that can be easily transmitted to humans.

1. Introduction

Neonatal diarrhoea in young, pre-weaned calves remains one of the main causes of the animals’ morbidity and mortality, and it causes major economic losses in many dairy and beef herds [1]. Antibiotic therapy is used widely in animal medicine to prevent and treat several bacterial infections, including calf diarrhoea [2]. However, the indiscriminate use of antibiotics is associated with evolution of antimicrobial resistance in bacterial pathogens [3].The emergence of antimicrobial resistance among pathogens is a growing concern in veterinary medicine. These resistant organisms pose a threat, not only to animals, but also possibly to humans [4]. Gram-negative bacteria that include members of the family Enterobacteriaceae are medically important infectious agents that are present in large numbers in animal guts and are believed to be closely associated with antibiotic resistance [5].
Increasing drug resistance in bacteria is mainly due to mobile genetic elements, such as plasmids, transposons, and integrons, which can be spread easily through bacterial populations [6]. Integrons are the genetic elements most able to capture individual antibiotic resistance genes and, in the process, promote their transcription and expression [7,8]. They are widely disseminated in antibiotic-resistant, clinical isolates of Gram-negative bacteria, and their presence limits the options that are available to treat infectious diseases in humans and animals [9]. To date, nine classes of integrons have been identified; however, integron classes 1 and 2 are the most common in Gram-negative bacteria [10].
Penicillin derivatives (β-lactams) are broad-spectrum, antibacterial agents that are widely used in human and veterinary medicine. Resistance to ampicillin in bacteria is mediated primarily by β-lactamases. Many different β-lactamases have been described, but TEM-, SHV-, OXA-, CMY-, and CTX-M-type β-lactamases are the most predominant [11].
For many years, chloramphenicol was considered the ideal drug to treat salmonellosis in humans and animals. Resistance to chloramphenicol is known to be mediated by plasmid-located enzymes called chloramphenicol acetyltransferases (CAT) [12]. Florfenicol is related to chloramphenicol and shows a similar spectrum of activity, except that it is active at lower concentrations than chloramphenicol against different bacterial isolates [13]. Several studies were published worldwide in recent years that document the bacterial causes of calf diarrhoea as well as antibacterial susceptibility patterns of isolated bacteria [14,15,16,17,18]. However, few publications address the issue of the molecular basis of antimicrobial resistance in bacteria that have been isolated from diarrhoeic calves. Therefore, the objective of the current study was to assess the phenotypes and prevalence of antimicrobial resistance genes in Enterobacteriaceae that had been isolated from diarrhoeic calves in Egypt. This assessment would include integrons, ß-lactamases, and florfenicol.

2. Materials and Methods

2.1. Ethical Considerations

Ethical approval was obtained from the research, publication, and ethics committee of the Faculty of Veterinary Medicine, Kafrelsheikh University, Egypt, which complies with all relevant Egyptian legislation. The ethical approval number is KFS 2017/3.

2.2. Sampling, Isolation, and Identification Procedures

A total of 120 faecal swabs were collected from untreated diarrhoeic calves (from one day old up to six months old) that had been raised in raised in three farms including Sakha Mehallet Mousa and Al Karada farms, Kafr El-Sheikh governorate, northern Egypt. Faecal samples were taken using sterile rectal swabs after digital stimulation of the rectal mucosa. Each swab was immersed in a small, sterile, plastic tube that contained 5 mL of sterile normal saline. Then the tube was tightly closed, labelled, and submitted immediately in an ice bag to the bacteriology laboratory of the Faculty of Veterinary Medicine, Kafrelsheikh University, Egypt, where it was cultured for Enterobacteriaceae. Briefly, about 1 mL from each sample was inoculated into 9 mL of nutrient broth. After aerobic incubation at 37 °C for 24–48 h, a loopful of the cultivated nutrient broth was streaked onto the surface of the MacConkey agar (Oxoid, Hampshire, UK). After incubation at 37 °C, colonies that showed the morphological characteristics of members of the Enterobacteriaceae family were placed into individual nutrient agar slants as pure culture for further identification. Films were prepared from the isolated colonies, stained with Gram′s stain and examined microscopically. The isolates thus obtained were identified by conventional techniques [19]. All bacterial isolates were also confirmed biochemically through use of the API 20E system (bioMérieux, Marcy-l’Étoile, France).

2.3. Antimicrobial Susceptibility Testing

Bacterial isolates were tested in vitro for their susceptibility to 12 antimicrobial agents (Oxoid, Hampshire, UK). This was performed through use of a Kirby–Bauer disc diffusion assay, according to the standards and interpretive criteria described by the Clinical and Laboratory Standards Institute (CLSI) [20]. The following antimicrobial agents were tested: ampicillin (AMP), 10 µg; amoxicillin–clavulanic acid (AMC), 30 µg; cefotaxime (CTX), 30 µg; chloramphenicol (CHL), 30 µg; ciprofloxacin (CIP), 30 µg; gentamicin (GEN), 10 µg; nalidixic acid (NAL), 30 µg; norfloxacin (NOR), 10 µg; sulfamethoxazole–trimethoprim (SXT), 25 µg; streptomycin (STR), 10 µg; spectinomycin (SPT), 100 µg; and tetracycline (TET), 30 µg. Susceptibility of the isolates to antimicrobial agents was categorised (as susceptible, intermediate or resistant) by measurement of the inhibition zone, according to interpretive criteria that adhered to the CLSI guidelines. The isolates that displayed resistance to ≥ two different antimicrobial classes were categorised as multidrug resistant.

2.4. DNA Extraction and Screening of Antimicrobial Resistance Genes

Genomic DNA of bacterial isolates was extracted through boiling methods. Briefly, a smooth, single colony was inoculated in 5 mL of nutrient broth and incubated at 37 °C for 12 h, and then 200 µL of overnight culture was mixed with 800 µL of distilled water and boiled for 10 min in a heat block. After boiling, the tubes were immediately placed on ice for 5 min followed by centrifugation at 14,000 rpm for 5 min. The supernatant, which contained bacterial DNA, was transferred to a new tube and stored at −20 °C [21]. All isolates were tested more than once for the presence of genes that were resistant to integrons (class1 and 2), ß-lactamases (blaCTX-M and blaTEM), and florfenicol (floR). Primer sequences, target genes and polymerase chain reaction (PCR) products are summarised in Table 1.
Several PCR protocols were used to detect the target genes of the isolates (Table 2).The PCR products were loaded onto 1.0% agarose gel (Sigma-Aldrich Co., St. Louis, MO, USA) that was stained with 0.5 µg/mL ethidium bromide (Sigma-Aldrich Co., St. Louis, MO, USA). The amplified DNAs were electrophoresed at 100 V for 60 min on a mini, horizontal electrophoresis unit (Bio-Rad, Hercules, CA, USA). The gel was then visualised and photographed under an ultraviolet transilluminator.

2.5. DNA Sequencing

DNA sequencing of class I integrons was carried out on purified PCR amplicons (QIAquick Gel Extraction Kit, Qiagen Inc., Tokyo, Japan) by application of an ABI automated DNA sequencer (Model 373; Perkin-Elmer, Waltham, MA, USA). DNA strands of the PCR product were sequenced by the dideoxy chain-termination method [25] through use of an ABI automated DNA sequencer (Model 373; Perkin–Elmer, Waltham, MA, USA). The primers 5’CS and 3’CS, which amplify the region between the 5’conserved segment (CS) and the 3’CS of class 1 integrons, were used to sequence from each end of the amplicons as previously described [24]. The sequences were compared with those that are held in GenBank through use of the basic local alignment search tool (BLAST) (http://www.ncbi.nih.gov, accessed on 20 March 2021)

3. Results

3.1. Occurrence of Multidrug Resistant Enterobacteriaceae in Diarrhoeic Calves

From 120 faecal samples that were analysed from calves with diarrhoea, 149 bacterial isolates were recovered. Based on cultural, morphological, and biochemical characteristics, 10 different types of bacteria were isolated and identified (Table 3). Escherichia coli (E. coli) was the predominant species (40 isolates; 26.8%), followed by Citrobacter diversus (C. diversus) (27 isolates; 18%), Shigella spp. (24 isolates; 16%), Serratia spp. (18 isolates; 12%), Providencia spp. (nine isolates; 6%), Enterobacter spp. (nine isolates; 6%), Klebsiella pneumoniae (K. pneumoniae) (nine isolates; 6%), Proteus spp. (six isolates; 4%), Klebsiella oxytoca (K. oxytoca) (four isolates; 2.5%,) and Morganella morganii (M. morganii) (three isolates; 2%).
The results of antimicrobial disc diffusion tests for the identified bacterial isolates showed that 37 out of the 149 (24.8%) isolates contained multidrug resistant (MDR) phenotypes. As shown in Table 3, E. coli was found to be the predominant MDR species (13 isolates; 8.7%), followed by C. diversus (eight isolates; 5.4%), Serratia spp. (five isolates; 3.3%), K. pneumoniae (four isolates; 2.7%), Shigella spp. (four isolates; 2.7%), Providencia spp. (two isolates; 1.3%) and K. oxytoca (one isolate; 0.7%). However, none of the isolates of Enterobacter, M. morganii, or Proteus spp. were found to be multidrug resistant. As summarised in Table 4, the highest level of resistance that was determined among the MDR bacteria was against ampicillin and tetracycline (36 isolates; 97.3% each), followed by amoxicillin–clavulanic acid (34 isolates; 91.9%), streptomycin (32 isolates; 86.5%), sulfamethoxazole–trimethoprim (30 isolates; 81%), nalidixic acid (28 isolates; 75.5%), spectinomycin (24 isolates; 64.9%), gentamicin (23 isolates; 62.2%), ciprofloxacin (nine isolates; 24.3%), chloramphenicol (seven isolates; 18.9%), cefotaxime (six isolates; 16.2%), and norfloxacin (four isolates; 10.8%).

3.2. Occurrence of Class 1 and Class 2 Integrons

Using 5’CS and 3’CS primers, 0.7 kbp, 1.0 kbp, 1.6 kbp, 2.0 kbp, and 3.0 kbp of amplicons of class 1 integrons were amplified and identified in 28 (18.8%) bacterial isolates (Table 5, Figure 1). The isolates that harboured class 1 integrons were: E. coli (11 isolates); C. diversus (six isolates); K. pneumoniae (four isolates); Shigella spp. (four isolates); Providencia spp. (two isolates); and K. oxytoca (one isolate). DNA sequencing of class 1 integrons identified five different gene cassettes as follows: dihydrofolate reductase types dfrA1 and dfrA17, which confer resistance to trimethoprim; aminoglycoside adenylyltransferase types aadA1, aadA2, and aadA5, which confer resistance to streptomycin and spectinomycin; chloramphenicol acetyltransferase (catB3), which confers resistance to chloramphenicol; streptothricin acetyltransferase (sat1), which confers resistance to streptothricin; and the β-lactamase gene (blaPse1), which confers resistance to ampicillin. It was of note that all isolates were negative for class 2 integrons.

3.3. Occurrence of β-Lactamases and Florfenicol Resistance Genes

The blaTEM is a narrow-spectrum, β-lactamase gene, which confers resistance against penicillins and first-generation cephalosporins. It was screened in all isolates. PCR and DNA-sequencing identified blaTEM in 37 (24.8%) bacterial isolates. The most common isolates that harboured blaTEM were: E. coli (13 isolates); C. diversus (eight isolates); Serratia spp. (five isolates); K. pneumoniae (four isolates); Shigella spp. (four isolates); Providencia spp. (two isolates); and K. oxytoca (one isolate) (Table 5, Figure 2). It was of note that all isolates were negative for the blaCTX-M resistance gene. The florfenicol resistance gene, floR, which confers resistance to chloramphenicol and florfenicol, was identified in two bacterial isolates (1.3%) of E. coli and K. pneumoniae (Table 5, Figure 3).

4. Discussion

In the last few years, considerable attention has been paid to the emergence of antimicrobial resistance among animal pathogens worldwide. This resistance can pose a serious risk regarding the transmission of resistant strains to humans and the environment [1]. In the current study, 149 isolates of Enterobacteriaceae were identified from calves with diarrhoea and examined for selected antimicrobial resistance genes. Our findings revealed that 37 (24.8%) isolates showed MDR to two or more antimicrobial agents. The phenotypic characterisation of the tested isolates against 12 antimicrobial agents showed that the isolates exhibited high resistance to ampicillin, tetracycline, amoxicillin–clavulanic acid, streptomycin, sulfamethoxazole–trimethoprim, and nalidixic acid.
Resistant phenotypes of bacteria that have been isolated from diarrhoeic calves have been described in many countries. However, the resistance pattern of the isolated bacteria varies among countries. For example, a study that was carried out by Raska et al. [26] reported that almost 100% of Gram-negative bacteria that were isolated from calves were resistant to ampicillin, tetracycline, and sulphonamides. The greatest E. coli resistance to antimicrobials tetracycline and ampicillin was recorded in India [27] and Iran [28]. Moreover, a recent study conducted among human patients in India stated that 82.9%, 54.1%, and 51.9% of bacterial strains that had been isolated from diarrhoeic patients were resistant to ampicillin, tetracycline, and cotrimoxazole, respectively [29]. Our data support a finding that has been reported by earlier studies, which indicates that bacteria of animal origin are commonly resistant to tetracycline, penicillins, and sulphonamides [30]. One possible explanation for the higher resistance of the recovered isolates to these groups of antibiotics (penicillin and tetracyclines) is that they are the most widely used antibiotics for the prevention and treatment of calf diarrhoea in conventional dairies, because they are relatively cheap, can be given orally, and have relatively few side effects.
MDR is defined as the propensity of a cell to exhibit resistance to a wide variety of structurally and functionally unrelated molecules [31]. In the current study, E. coli was found to be the predominant multidrug resistant species (13 isolates; 8.7%). This frequency of resistance is similar to that reported in Egypt (10.4%) [32] and in China (4.9%) [33], but lower than the frequencies recorded in Sweden (61%) [34], India (84%) [1], and Egypt (64.3%) [35]. A similar level of MDR among Gram-negative bacteria isolated from cattle with mastitis was reported in Egypt [36]. Such variations in antibiotic resistance in various countries may reflect differences in antimicrobial treatments that are used.
Integrons are considered to contain the most genetic elements that are responsible for dissemination of antimicrobial resistance among bacteria, especially Gram-negative bacteria [9]. In the present investigation, class 1 integrons were detected in 28 (18.8%) of the bacterial isolates. Class 1 integrons that harbour similar gene cassettes to those contained in these groups have been reported in Salmonella enterica that have been isolated from humans and animals in the UK [37] and from MDR Salmonella isolates from diarrhoeic calves in Egypt [21]. Class 1 integrons were reported in E. coli strains that were isolated from diarrhoeic calves in Egypt [32] and China [38] at incidence rates of 10.4% and 59%, respectively. Class 2 integrons are of similar structure to that of class 1 integrons, but they are associated with transposon Tn7 [39]. In this study, all isolates were negative for class 2 integrons. Similar observations were reported previously in Egypt [32] and Uruguay [2].
In this study, blaTEM-1 was detected in all MDR isolates, which represented 24.8% of the recovered bacteria. However, all examined isolates were negative for the blaCTX-M resistance gene. Previous studies declared higher percentages of β-lactamase resistance in Gram-negative bacteria that were isolated from diarrhoeic calves: for example, Klebsiella spp. (48.4%) [40], E. coli (100%) [32] and Salmonella spp. (55.5%) [21]. However, a recent investigation carried out in Egypt described the discovery of blaTEM-1 in 71.4% of E. coli isolated from calves with diarrhoea [35]. Meanwhile, CMY-,CTX-M-, OXA-, SHV-, and TEM-β-lactamases were detected previously in E. coli and Salmonella spp. that were isolated from diarrhoeic neonatal calves in Egypt [21].
In the current study, the florfenicol resistance gene, floR, was identified only in two (0.013%) bacterial isolates: E. coli and K. pneumoniae. This finding was identical to that of earlier studies that were performed in Egypt [32] and France [41]. Moreover, the floR gene has been detected previously in Gram-negative bacteria that were isolated from cattle with mastitis in Egypt [36], E. coli isolated from neonatal diarrhoeic calves [21] and E. coli isolated from cattle in France [41].

5. Conclusions

Antimicrobial resistance in bacteria is a serious global health challenge due to the indiscriminate use of antimicrobials in the treatment of infectious diseases in animals. The findings of this study reveal that calves may act as potential reservoirs for multidrug resistant bacteria that can be transmitted easily to humans. The finding of increased incidence of antimicrobial-resistant genes indicates the importance of regular monitoring of the antibiotic susceptibilities of isolated bacteria to minimise the risk of human exposure to pathogens that are resistant to antimicrobials.

Author Contributions

Conceptualization, I.E.E.; data curation, A.S.A.; formal analysis, A.S.A.; investigation, A.-M.E.M. and S.A.A.; methodology, A.-M.E.M.; supervision, S.A.O. and A.M.A.; visualisation, I.E.E.; writing—original draft, I.E.E. and S.A.A.; writing—review and editing, S.A.O. and A.M.A. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Institutional Ethics Committee of the Faculty of Veterinary Medicine, Kafrelsheikh University, Egypt. The research complied with all relevant Egyptian legislation. The ethical approval number is KFS 2017/3.

Data Availability Statement

The authors confirm that the data that support the findings of this study are available within the article.

Conflicts of Interest

The authors do not have any conflict of interest to declare.

References

  1. Sharma, R.; Taku, A.; Malik, A.; Bhat, M.; Javed, R.; Badroo, G.; Kour, A. Molecular characterization and antimicrobial profiling of Escherichia coli isolates from diarrheic calves. Indian J. Anim. Sci. 2017, 87, 1467–1471. [Google Scholar]
  2. Umpiérrez, A.; Bado, I.; Oliver, M.; Acquistapace, S.; Etcheverría, A.; Padola, N.L.; Vignoli, R.; Zunino, P. Zoonotic potential and antibiotic resistance of Escherichia coli in neonatal calves in Uruguay. Microbes Environ. 2017, 32, 275–282. [Google Scholar] [CrossRef]
  3. Hammerum, A.M.; Heuer, O.E. Human health hazards from antimicrobial-resistant Escherichia coli of animal origin. Clin. Infect. Dis. 2009, 48, 916–921. [Google Scholar] [CrossRef] [PubMed]
  4. Pomba, C.; Rantala, M.; Greko, C.; Baptiste, K.E.; Catry, B.; Van Duijkeren, E.; Mateus, A.; Moreno, M.A.; Pyörälä, S.; Ružauskas, M. Public health risk of antimicrobial resistance transfer from companion animals. Antimicrob. Agents Chemother. 2017, 72, 957–968. [Google Scholar] [CrossRef] [PubMed]
  5. Rupp, M.E.; Fey, P.D. Extended spectrum β-lactamase (ESBL)-producing Enterobacteriaceae. Drugs 2003, 63, 353–365. [Google Scholar] [CrossRef]
  6. Adefisoye, M.A.; Okoh, A.I. Identification and antimicrobial resistance prevalence of pathogenic Escherichia coli strains from treated wastewater effluents in Eastern Cape, South Africa. Microbiologyopen 2016, 5, 143–151. [Google Scholar] [CrossRef]
  7. Hanau-Berçot, B.; Podglajen, I.; Casin, I.; Collatz, E. An intrinsic control element for translational initiation in class 1 integrons. Mol. Microbiol. 2002, 44, 119–130. [Google Scholar] [CrossRef]
  8. Martinez-Freijo, P.; Fluit, A.C.; Schmitz, F.-J.; Verhoef, J.; Jones, M.E. Many Class I Integrons Comprise Distinct Stable Structures Occurring in Different Species of Enterobacteriaceae Isolated from Widespread Geographic Regions in Europe. Antimicrob. Agents Chemother. 1999, 43, 686–689. [Google Scholar] [CrossRef]
  9. Recchia, G.D.; Hall, R.M. Plasmid evolution by acquisition of mobile gene cassettes: Plasmid pIE723 contains the aadB gene cassette precisely inserted at a secondary site in the incQ plasmid RSF1010. Mol. Microbiol. 1995, 15, 179–187. [Google Scholar] [CrossRef]
  10. Nield, B.S.; Holmes, A.J.; Gillings, M.R.; Recchia, G.D.; Mabbutt, B.C.; Nevalainen, K.H.; Stokes, H.W. Recovery of new integron classes from environmental DNA. FEMS Microbiol. Lett. 2001, 195, 59–65. [Google Scholar] [CrossRef]
  11. Bradford, P.A.; Petersen, P.J.; Fingerman, I.M.; White, D.G. Characterization of expanded-spectrum cephalosporin resistance in E. coli isolates associated with bovine calf diarrhoeal disease. J. Antimicrob. Agents Chemother. 1999, 44, 607–610. [Google Scholar] [CrossRef]
  12. Cannon, M.; Harford, S.; Davies, J. A comparative study on the inhibitory actions of chloramphenicol, thiamphenicol and some fluorinated derivatives. J. Antimicrob. Chemother. 1990, 26, 307–317. [Google Scholar] [CrossRef]
  13. White, D.G.; Hudson, C.; Maurer, J.J.; Ayers, S.; Zhao, S.; Lee, M.D.; Bolton, L.; Foley, T.; Sherwood, J. Characterization of chloramphenicol and florfenicol resistance in Escherichia coli associated with bovine diarrhea. J. Clin. Microbiol. 2000, 38, 4593–4598. [Google Scholar] [CrossRef]
  14. Cho, Y.-I.; Han, J.-I.; Wang, C.; Cooper, V.; Schwartz, K.; Engelken, T.; Yoon, K.-J. Case–control study of microbiological etiology associated with calf diarrhea. Vet. Microbiol. 2013, 166, 375–385. [Google Scholar] [CrossRef] [PubMed]
  15. Cho, Y.-i.; Yoon, K.-J. An overview of calf diarrhea-infectious etiology, diagnosis, and intervention. J. Vet. Sci. 2014, 15, 1. [Google Scholar] [CrossRef] [PubMed]
  16. Constable, P.D. Antimicrobial use in the treatment of calf diarrhea. J. Vet. Intern. Med. 2004, 18, 8–17. [Google Scholar] [CrossRef]
  17. Izzo, M.; Kirkland, P.; Mohler, V.; Perkins, N.; Gunn, A.; House, J. Prevalence of major enteric pathogens in Australian dairy calves with diarrhoea. Aust. Vet. J. 2011, 89, 167–173. [Google Scholar] [CrossRef] [PubMed]
  18. Uhde, F.L.K.T.; Sager, H.; Albini, S.; Zanoni, R.; Schelling, E.; Meylan, M. Prevalence of four enteropathogens in the faeces of young diarrhoeic dairy calves in Switzerland. Vet. Rec. 2008, 163, 362–366. [Google Scholar] [CrossRef] [PubMed]
  19. Ewing, W.H. Edwards and Ewing’s Identification of Enterobacteriaceae; Elsevier Science Publishing Co., Inc.: New York, NY, USA, 1986. [Google Scholar]
  20. Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing, 27th ed.; CLSI Supplement M100; CLSI: Wayne, IL, USA, 2017; ISBN 1-56238-805-3. [Google Scholar]
  21. Ahmed, A.M.; Younis, E.E.; Ishida, Y.; Shimamoto, T. Genetic basis of multidrug resistance in Salmonella enterica serovars Enteritidis and Typhimurium isolated from diarrheic calves in Egypt. Acta Trop. 2009, 111, 144–149. [Google Scholar] [CrossRef] [PubMed]
  22. Levesque, C.; Piche, L.; Larose, C.; Roy, P.H. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob. Agents Chemother. 1995, 39, 185–191. [Google Scholar] [CrossRef]
  23. Ahmed, A.M.; Motoi, Y.; Sato, M.; Maruyama, A.; Watanabe, H.; Fukumoto, Y.; Shimamoto, T. Zoo animals as reservoirs of gram-negative bacteria harboring integrons and antimicrobial resistance genes. Appl. Environ. Microbiol. 2007, 73, 6686–6690. [Google Scholar] [CrossRef] [PubMed]
  24. Ahmed, A.M.; Hussein, A.I.; Shimamoto, T. Proteus mirabilis clinical isolate harbouring a new variant of Salmonella genomic island 1 containing the multiple antibiotic resistance region. J. Antimicrob. Chemother. 2007, 59, 184–190. [Google Scholar] [CrossRef] [PubMed]
  25. Sanger, F.; Nicklen, S.; Coulson, A.R. DNA sequencing with chain-terminating inhibitors. PNAS 1977, 74, 5463–5467. [Google Scholar] [CrossRef]
  26. Raska, K.; Rasková, H.; Urbanová, Z.; Matĕjovská, D.; Matĕjovská, V.; Palounek, V.; Polák, L. Resistance of gram-negative bacteria to antibiotics in large calf agglomerations. Acta Trop. 1979, 36, 163–170. [Google Scholar]
  27. Srivani, M.; Reddy, Y.N.; Subramanyam, K.; Reddy, M.R.; Rao, T.S. Prevalence and antimicrobial resistance pattern of Shiga toxigenic Escherichia coli in diarrheic buffalo calves. Vet. World 2017, 10, 774. [Google Scholar] [CrossRef]
  28. Shahrani, M.; Dehkordi, F.S.; Momtaz, H. Characterization of Escherichia coli virulence genes, pathotypes and antibiotic resistance properties in diarrheic calves in Iran. Biol. Res. 2014, 47, 1–13. [Google Scholar] [CrossRef]
  29. Singh, B.; Kumar, V.; Sinha, D.; Bhardwaj, M.; Saraf, A.; Vadhana, P. Antimicrobial resistance profile of enteropathogens isolated from diarrhea patients: Herbal antimicrobials, a ray of hope. Ann. Pharm. Pharm. 2017, 2, 1068. [Google Scholar]
  30. Wall, B.; Mateus, A.; Marshall, L.; Pfeiffer, D.; Lubroth, J.; Ormel, H.; Otto, P.; Patriarchi, A. Drivers, Dynamics and Epidemiology of Antimicrobial Resistance in Animal Production; Food and Agriculture Organization of the United Nations: Rome, Italy, 2016. [Google Scholar]
  31. Higgins, C.F. Multiple molecular mechanisms for multidrug resistance transporters. Nature 2007, 446, 749–757. [Google Scholar] [CrossRef]
  32. Ahmed, A.M.; Younis, E.E.; Osman, S.A.; Ishida, Y.; El-Khodery, S.A.; Shimamoto, T. Genetic analysis of antimicrobial resistance in Escherichia coli isolated from diarrheic neonatal calves. Vet. Microbiol. 2009, 136, 397–402. [Google Scholar] [CrossRef] [PubMed]
  33. Li, K.; Wang, X.; Shahzad, M.; Zhang, H.; Zhao, X.; Jiang, X.; Mehmood, K.; Han, Z.; Wang, L.; Li, J. Antibiotic resistance and screening of the resistant genes of Escherichia coli (E. coli) isolated from diarrheal yak calves in Sichuan Province, China. Trop. Biomed. 2018, 35, 478–486. [Google Scholar] [PubMed]
  34. de Verdier, K.; Nyman, A.; Greko, C.; Bengtsson, B. Antimicrobial resistance and virulence factors in Escherichia coli from Swedish dairy calves. Acta Vet. Scand. 2012, 54, 1–10. [Google Scholar] [CrossRef]
  35. Hakim, A.S.; Omara, S.T.; Syame, S.M.; Fouad, E.A. Serotyping, antibiotic susceptibility, and virulence genes screening of Escherichia coli isolates obtained from diarrheic buffalo calves in Egyptian farms. Vet. World 2017, 10, 769. [Google Scholar] [CrossRef]
  36. Ahmed, A.M.; Shimamoto, T. Molecular characterization of antimicrobial resistance in Gram-negative bacteria isolated from bovine mastitis in Egypt. Microbiol. Immunol. 2011, 55, 318–327. [Google Scholar] [CrossRef] [PubMed]
  37. Randall, L.; Cooles, S.; Osborn, M.; Piddock, L.; Woodward, M.J. Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK. J. Antimicrob. Chemother. 2004, 53, 208–216. [Google Scholar] [CrossRef] [PubMed]
  38. Du, X.; Shen, Z.; Wu, B.; Xia, S.; Shen, J. Characterization of class 1 integrons-mediated antibiotic resistance among calf pathogenic Escherichia coli. FEMS Microbiol. Lett. 2005, 245, 295–298. [Google Scholar] [CrossRef] [PubMed]
  39. Hansson, K.; Sundström, L.; Pelletier, A.; Roy, P.H. IntI2 integron integrase in Tn7. J. Bacteriol. 2002, 184, 1712–1721. [Google Scholar] [CrossRef]
  40. Jain, A.; Mondal, R. TEM & SHV genes in extended spectrum β-lactamase producing Klebsiella species & their antimicrobial resistance pattern. Indian J. Med. Res. 2008, 128, 759–764. [Google Scholar]
  41. Cloeckaert, A.; Baucheron, S.; Flaujac, G.; Schwarz, S.; Kehrenberg, C.; Martel, J.-L.; Chaslus-Dancla, E. Plasmid-mediated florfenicol resistance encoded by the floR gene in Escherichia coli isolated from cattle. Antimicrob. Agents Chemother. 2000, 44, 2858–2860. [Google Scholar] [CrossRef]
Figure 1. Electrophoresis pattern on agarose gel (1.0%) due to amplicons generated with 5’CS-3’CS primers of class I integrons. Lane M is a 100 bp ladder as a molecular size standard. Lanes 1 to 16 represent gene groups of 0.7 kbp, 1.0 kbp, 1.6 kbp, 2.0 kbp, and 3.0 kbp amplicons of class 1 integrons.
Figure 1. Electrophoresis pattern on agarose gel (1.0%) due to amplicons generated with 5’CS-3’CS primers of class I integrons. Lane M is a 100 bp ladder as a molecular size standard. Lanes 1 to 16 represent gene groups of 0.7 kbp, 1.0 kbp, 1.6 kbp, 2.0 kbp, and 3.0 kbp amplicons of class 1 integrons.
Animals 11 01712 g001
Figure 2. Electrophoresis pattern on agarose gel (1.0%) made by the amplicons for the blaTEM genes (1080 bp). Lane M is a 100 bp ladder as a molecular size standard. Lanes 2, 6–7, 11, 13, and 14: positive isolates. Lanes 1, 3–5, 8–10, 12: negative isolates.
Figure 2. Electrophoresis pattern on agarose gel (1.0%) made by the amplicons for the blaTEM genes (1080 bp). Lane M is a 100 bp ladder as a molecular size standard. Lanes 2, 6–7, 11, 13, and 14: positive isolates. Lanes 1, 3–5, 8–10, 12: negative isolates.
Animals 11 01712 g002
Figure 3. Electrophoresis pattern on agarose gel (1.0%) caused by the amplicons for the floR gene (888 bp). Lane M is a 100 bp ladder as a molecular size standard. Lanes 2, 8: positive isolates. Lanes 1, 3–7: negative isolates.
Figure 3. Electrophoresis pattern on agarose gel (1.0%) caused by the amplicons for the floR gene (888 bp). Lane M is a 100 bp ladder as a molecular size standard. Lanes 2, 8: positive isolates. Lanes 1, 3–7: negative isolates.
Animals 11 01712 g003
Table 1. Primer names, target genes, oligonucleotide sequences, and the product sizes used in PCR and DNA sequencing.
Table 1. Primer names, target genes, oligonucleotide sequences, and the product sizes used in PCR and DNA sequencing.
PrimersSequence (5’ to 3’)Amplicon Size (bp)TargetReferences
Integrons
5’-CSGGCATCCAAGCAGCAAGVariableClass 1 integron[22]
3’-CSAAGCAGACTTGACCTGA
hep74CGGGATCCCGGACGGCATGCACGATTTGTAVariableClass 2 integron[23]
hep51GATGCCATCGCAAGTACGAG
β-Lactamases
TEM-FATAAAATTCTTGAAGACGAAA1080blaTEM[23]
TEM-RGACAGTTACCAATGCTTAATC
CTX-M-FCGCTTTGCGATGTGCAG550blaCTX-M[23]
CTX-M-RACCGCGATATCGTTGGT
Florfenicol
StCM-FCACGTTGAGCCTCTATATGG888floR[24]
StCM-RATGCAGAAGTAGAACGCGAC
Table 2. PCR amplification and DNA sequencing.
Table 2. PCR amplification and DNA sequencing.
Target genePrimary
Denaturation
Amplification (30 Cycles)Final Extension
Secondary
Denaturation
AnnealingExtension
Class 1 integron94 °C, 10 min95 °C, 60 s55 °C, 60 s72 °C, 3 min72 °C, 10 min
Class 2 integron94 °C, 10 min94 °C, 60 s55 °C, 60 s72 °C, 3 min72 °C, 10 min
blaCTX-M95 °C, 10 min95 °C, 30 s50 °C, 30 s72 °C, 30 s72 °C, 10 min
blaTEM94 °C, 10 min94 °C, 30 s50 °C, 30 s72 °C, 60 s72 °C, 10 min
floR94 °C, 10 min94 °C, 30 s50 °C, 30 s72 °C, 60 s72 °C, 10 min
Table 3. Occurrence of multidrug resistant Enterobacteriaceae isolated from diarrhoeic calves.
Table 3. Occurrence of multidrug resistant Enterobacteriaceae isolated from diarrhoeic calves.
BacteriaRecovered isolatesMultidrug resistant isolates
%No.%No.
Escherichia coli26.8408.713
Citrobacter diversus18275.48
Shigella spp.16242.74
Serratia spp.12183.35
Providencia spp.691.32
Enterobacter spp.690-
Klebsiella pneumoniae692.74
Proteus spp.460-
Klebsiella oxytoca2.740.71
Morganella morganii230-
Total10014924.837
Table 4. Results of antimicrobial susceptibility testing for multidrug resistance of Enterobacteriaceae that were isolated from diarrhoeic calves.
Table 4. Results of antimicrobial susceptibility testing for multidrug resistance of Enterobacteriaceae that were isolated from diarrhoeic calves.
Number of Resistant Isolates (37)
Class and AntimicrobialsE. coli
(n = 13)
C. diversus
(n = 8)
Shigella spp.
(n = 4)
Serratia spp.
(n = 5)
Providencia spp. (n = 2)K. pneumoniae (n = 4)K. oxytoca
(n = 1)
Overall Resistance
Penicillins
Ampicillin1384424136 (97.3%)
Amoxicillin1273524134 (91.9%)
Quinolones and fluoroquinolone
Nalidixic acid1033524128 (75.5%)
Ciprofloxacin43010019 (24.3%)
Norfloxacin30010004 (10.8%)
Aminoglycosides
Streptomycin1362524032 (86.5%)
Gentamicin742414123 (62.2%)
Spectinomycin933324024 (64.9%)
Sulphonamides
Sulfamethoxazole –trimethoprim1352324130 (81%)
Cephalosporins
Cefotaxime41100006 (16.2%)
Phenicols
Chloramphenicol31000307 (24.3%)
Tetracyclines
Tetracycline1383524136 (97.3%)
Table 5. Incidence of antimicrobial-resistant genes in multidrug resistant bacteria isolated from diarrhoeic calves.
Table 5. Incidence of antimicrobial-resistant genes in multidrug resistant bacteria isolated from diarrhoeic calves.
No.BacteriaResistance PhenotypeClass1 IntegronsOther gene(s)
1E. coliAMC, AMP, CIP, GEN, NAL, NOR, SPT, STR, SXT, TETdfrA17-aadA5blaTEM
2Serratia spp.AMC, AMP, GEN, NAL, STR, SXT, TET-blaTEM
3Shigella spp.AMC, AMP, NAL, SPT, STR, SXT, TETdfrA17-aadA5blaTEM
4Serratia spp.AMC, GEN, NAL, NOR, SPT, STR, TET-blaTEM
5Serratia spp.AMC, AMP, CIP, NAL, SPT, STR, SXT, TET-blaTEM
6Serratia spp.AMC, AMP, GEN, NAL, SPT, STR, TET-blaTEM
7E. coliAMC, AMP, CHL, CIP, CTX, GEN, NAL, NOR, SPT, STR, SXT, TETdfrA12-orf-aadA2blaTEM
8E. coliAMC, AMP, GEN, NAL, SPT, STR, SXT, TETdfrA1-aadA1blaTEM
9Shigella spp.AMC, AMP, GEN, STR, TETdfrA17-aadA5blaTEM
10C. diversusAMC, AMP, GEN, STR, TETdfrA12-orf aadA2blaTEM
11E. coliAMC, AMP, STR, SXT, TETdfrA17-aadA5blaTEM
12C. diversusAMC, AMP, NAL, STR, TETdfrA17-aadA5blaTEM
13E. coliAMC, AMP, GEN, NAL, SPT, STR, SXT, TETdfrA17-aadA5blaTEM
14K. pneumoniaeAMC, AMP, CHL, GEN, NAL, SPT, STR, SXT, TETdfrA12-orf aadA2blaTEM, floR
15C. diversusAMP, CIP, SPT, STR, TETdfrA12-orf aadA2blaTEM
16K. pneumoniaeAMC, AMP, CHL, GEN, NAL, SPT, STR, SXT, TETdfrA12-orf aadA2blaTEM
17E. coliAMC, AMP, CHL, CTX, NAL, SPT, STR, SXT, TETdfrA15blaTEM, floR
18C. diversusAMC, AMP, CHL, GEN, SPT, SXT, TETdfrA1-aadA1blaTEM
19C. diversusAMC, AMP, SPT STR, SXT, TETaac(3)-Id-aadA7blaTEM
20E.coliAMC, AMP, NAL, STR, SXT, TETdfrA1-aadA1blaTEM
21Shigella spp.AMC, AMP, NAL, SPT, SXT, TETdfrA12-orf aadA2blaTEM
22E. coliAMC, AMP, CIP, NAL, NOR, STR, SXT, TETdfrA12-orf aadA2blaTEM
23E. coliAMC, AMP, GEN, SPT, STR, SXT, TETaac(3)-Id-aadA7blaTEM
24Providencia spp.AMC, AMP, NAL, SPT, STR, SXT, TETaac(3)-Id-aadA7blaTEM
25C. diversusAMC, AMP, CIP, GEN, NAL, SXT, TETdfrA1-aadA1blaTEM
26C. diversusAMC, AMP, CTX, NAL, STR, SXT, TET-blaTEM
27C. diversusAMC, AMP, CIP, GEN, STR, SXT, TET-blaTEM
28Shigella spp.AMP, CTX, GEN, NAL, SPTdfrA1-aadA1blaTEM
29E. coliAMC, AMP, CIP, GEN, SPT, STR, SXT, TETdfrA17-aadA5blaTEM
30E. coliAMP, CTX, NAL, SPT, STR, SXT, TETdfrA17-aadA5blaTEM
31Providencia spp.AMC, AMP, GEN, NAL, SPT, STR, SXT, TETaac(3)-Id-aadA7blaTEM
32E. coliAMC, AMP, CHL, NAL, SPT, STR, SXT, TET-blaTEM
33E. coliAMC, AMP, CTX, GEN, NAL, STR, SXT, TET-blaTEM
34Serratia spp.AMC, AMP, GEN, NAL, STR, SXT, TET-blaTEM
35K. oxytocaAMC, AMP, CIP, GEN, NAL, SXT, TETdfrA17-aadA5blaTEM
36K. pneumoniaeAMC, AMP, GEN, NAL, SPT, STR, SXT, TETdfrA12-orf-aadA2blaTEM
37K. pneumoniaeAMC, AMP, CHL, GEN, NAL, SPT, STR, SXT, TETdfrA1-aadA1blaTEM
AMP, ampicillin; AMC, amoxicillin; CHL, chloramphenicol; CIP, ciprofloxacin; CTX, cefotaxime; GEN, gentamicin; NAL, nalidixic acid; NOR, norfloxacin; SPT, spectinomycin; STR, streptomycin; SXT, sulfamethoxazole–trimethoprim; TET, tetracycline.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Meshref, A.-M.E.; Eldesoukey, I.E.; Alouffi, A.S.; Alrashedi, S.A.; Osman, S.A.; Ahmed, A.M. Molecular Analysis of Antimicrobial Resistance among Enterobacteriaceae Isolated from Diarrhoeic Calves in Egypt. Animals 2021, 11, 1712. https://doi.org/10.3390/ani11061712

AMA Style

Meshref A-ME, Eldesoukey IE, Alouffi AS, Alrashedi SA, Osman SA, Ahmed AM. Molecular Analysis of Antimicrobial Resistance among Enterobacteriaceae Isolated from Diarrhoeic Calves in Egypt. Animals. 2021; 11(6):1712. https://doi.org/10.3390/ani11061712

Chicago/Turabian Style

Meshref, Abdel-Moamen E., Ibrahim E. Eldesoukey, Abdulaziz S. Alouffi, Saleh A. Alrashedi, Salama A. Osman, and Ashraf M. Ahmed. 2021. "Molecular Analysis of Antimicrobial Resistance among Enterobacteriaceae Isolated from Diarrhoeic Calves in Egypt" Animals 11, no. 6: 1712. https://doi.org/10.3390/ani11061712

APA Style

Meshref, A.-M. E., Eldesoukey, I. E., Alouffi, A. S., Alrashedi, S. A., Osman, S. A., & Ahmed, A. M. (2021). Molecular Analysis of Antimicrobial Resistance among Enterobacteriaceae Isolated from Diarrhoeic Calves in Egypt. Animals, 11(6), 1712. https://doi.org/10.3390/ani11061712

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop