Polymorphisms of the PRLR Gene and Their Association with Milk Production Traits in Egyptian Buffaloes
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Sampling
2.2. Polymerase Chain Reaction (PCR)
2.3. SNP Identification by Single-strand Conformation Polymorphism and Sequencing
2.4. Real-Time PCR
2.5. Western Blot
2.6. Statistical Analysis
3. Results and Discussion
3.1. Analysis of the Detected SNPs
3.2. Analysis of Genotype Frequencies, Genetic Indices and LD
3.3. Association of PRLR Haplotypes with Milk Yield and Composition
3.4. Association of SNP Haplotypes with mRNA and Protein Levels
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Krovvidi, S.; Panneerselvam, S.; Thiruvenkadan, A.K.; Abraham, J.; Vinodkumar, G. Factors effecting milk composition of crossbred dairy cattle in southern india. Int. J. Food Agric. Vet. Sci. 2013, 3, 229–232. [Google Scholar]
- Bole-Feysot, C.; Goffin, V.; Edery, M.; Binart, N.; Kelly, P.A. Prolactin (prl) and its receptor: Actions, signal transduction pathways and phenotypes observed in prl receptor knockout mice. Endocr. Rev. 1998, 19, 225–268. [Google Scholar] [CrossRef] [PubMed]
- Rudolph, M.C.; Russell, T.D.; Webb, P.; Neville, M.C.; Anderson, S.M. Prolactin-mediated regulation of lipid biosynthesis genes in vivo in the lactating mammary epithelial cell. Am. J. Physiol. Endocrinol. Metab. 2011, 300, E1059–E1068. [Google Scholar] [CrossRef]
- Lacasse, P.; Lollivier, V.; Dessauge, F.; Bruckmaier, R.M.; Ollier, S.; Boutinaud, M. New developments on the galactopoietic role of prolactin in dairy ruminants. Domest. Anim. Endocrinol. 2012, 43, 154–160. [Google Scholar] [CrossRef] [PubMed]
- Lu, A.; Hu, X.; Chen, H.; Dong, Y.; Zhang, Y.; Wang, X. Novel snps of the bovine prlr gene associated with milk production traits. Biochem. Genet. 2011, 49, 177–189. [Google Scholar] [CrossRef] [PubMed]
- Hu, X.; Lü, A.; Chen, H.; Gao, X.; Xu, H.; Zhang, C.; Xingtang, F.; Lei, C. Preliminary evidence for association of prolactin and prolactin receptor genes with milk production traits in chinese holsteins. J. Appl. Anim. Res. 2009, 36, 213–217. [Google Scholar] [CrossRef]
- Cosenza, G.; Iannaccone, M.; Auzino, B.; Macciotta, N.P.P.; Kovitvadhi, A.; Nicolae, I.; Pauciullo, A. Remarkable genetic diversity detected at river buffalo prolactin receptor (prlr) gene and association studies with milk fatty acid composition. Anim. Genet. 2018, 49, 159–168. [Google Scholar] [CrossRef]
- Trott, J.F.; Schennink, A.; Hovey, R.C. Cloning and expression of a unique short form of the porcine prolactin receptor. J. Mol. Endocrinol. 2011, 46, 51–62. [Google Scholar] [CrossRef]
- Abo-Al-Ela, H.G.; El-Magd, M.A.; El-Nahas, A.F.; Mansour, A.A. Association of a novel snp in exon 10 of the igf2 gene with growth traits in egyptian water buffalo (bubalus bubalis). Trop. Anim. Health Prod. 2014, 46, 947–952. [Google Scholar] [CrossRef]
- El-Bayomi, K.M.; Saleh, A.A.; Awad, A.; El-Tarabany, M.S.; El-Qaliouby, H.S.; Afifi, M.; El-Komy, S.; Essawi, W.M.; Almadaly, E.A.; El-Magd, M.A. Association of cyp19a1 gene polymorphisms with anoestrus in water buffaloes. Reprod. Fertil. Dev. 2018, 30, 487–497. [Google Scholar] [CrossRef]
- El-Magd, M.A.; Abbas, H.E.; El-kattawy, A.M.; Mokhbatly, A. Novel polymorphisms of the igf1r gene and their association with average daily gain in egyptian buffalo (bubalus bubalis). Domest. Anim. Endocrinol. 2013, 45, 105–110. [Google Scholar] [CrossRef]
- El-Magd, M.A.; Abo-Al-Ela, H.G.; El-Nahas, A.; Saleh, A.A.; Mansour, A.A. Effects of a novel snp of igf2r gene on growth traits and expression rate of igf2r and igf2 genes in gluteus medius muscle of egyptian buffalo. Gene 2014, 540, 133–139. [Google Scholar] [CrossRef]
- El-Magd, M.A.; Saleh, A.A.; Abdel-Hamid, T.M.; Saleh, R.M.; Afifi, M.A. Is really endogenous ghrelin a hunger signal in chickens?: Association of ghsr snps with increase appetite, growth traits, expression and serum level of ghrl, and gh. Gen. Comp. Endocrinol. 2016, 237, 131–139. [Google Scholar] [CrossRef]
- El-Komy, S.M.; Saleh, A.A.; Abdel-Hamid, T.M.; El-Magd, M.A. Association of ghr polymorphisms with milk production in buffaloes. Animals 2020, 10, 1203. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Zan, L.; Fang, P.; Zhang, F.; Shen, G.; Tian, W. Genetic variation of prlr gene and association with milk performance traits in dairy cattle. Can. J. Anim. Sci. 2008, 88, 33–39. [Google Scholar] [CrossRef]
- Viitala, S.; Szyda, J.; Blott, S.; Schulman, N.; Lidauer, M.; Maki-Tanila, A.; Georges, M.; Vilkki, J. The role of the bovine growth hormone receptor and prolactin receptor genes in milk, fat and protein production in finnish ayrshire dairy cattle. Genetics 2006, 173, 2151–2164. [Google Scholar] [CrossRef] [PubMed]
- Zidi, A.; Serradilla, J.M.; Jordana, J.; Carrizosa, J.; Urrutia, B.; Polvillo, O.; Gonzalez-Redondo, P.; Gallardo, D.; Amills, M.; Fernandez-Cabanas, V.M. Pleiotropic effects of the goat prolactin receptor genotype on milk fatty acid composition. Domest. Anim. Endocrinol. 2010, 39, 85–89. [Google Scholar] [CrossRef]
- Hou, J.X.; An, X.P.; Song, Y.X.; Wang, J.G.; Ma, T.; Han, P.; Fang, F.; Cao, B.Y. Combined effects of four snps within goat prlr gene on milk production traits. Gene 2013, 529, 276–281. [Google Scholar] [CrossRef]
- Shi, H.; Zhang, T.; Yi, Y.; Wang, H.; Luo, J. Long form prlr (lprlr) regulates genes involved in the triacylglycerol synthesis in goat mammary gland epithelial cells. Small Rumin. Res. 2016, 139, 7–14. [Google Scholar] [CrossRef]
- Marques, M.d.R.; Ribeiro, D.; Gomes, S.; Belo, A.T.; Ribeiro, J.; Martins, A.P.L.; Belo, C. Associations of snps in the ovine prolactin and prolactin receptor genes with milk traits in assaf dairy sheep. In Proceedings of the 37th International Society for Animal Genetics Conference, Lleida, Spain, 7–12 July 2019. [Google Scholar] [CrossRef]
- Shi, D.S.; Wang, J.; Yang, Y.; Lu, F.H.; Li, X.P.; Liu, Q.Y. Dgat1, gh, ghr, prl and prlr polymorphism in water buffalo (bubalus bubalis). Reprod. Domest. Anim. Zuchthyg. 2012, 47, 328–334. [Google Scholar] [CrossRef]
- Javed, R.; Gautam, S.; Vijh, R.; Tantia, M. Six novel pcr-rflp loci in milk quality candidate genes in Bubalus bubalis. Int. J. Livest. Prod. 2011, 2, 79–83. [Google Scholar]
- Javed, R.; Gautam, S.K.; Vijh, R.K.; Tantia, M.S. Characterization of prlr and ppargc1a genes in buffalo (bubalus bubalis). Genet. Mol. Biol 2011, 34, 592–594. [Google Scholar] [CrossRef] [PubMed]
- Iso-Touru, T.; Kantanen, J.; Li, M.H.; Gizejewski, Z.; Vilkki, J. Divergent evolution in the cytoplasmic domains of prlr and ghr genes in artiodactyla. BMC Evol. Biol. 2009, 9, 172. [Google Scholar] [CrossRef] [PubMed]
- Boutinaud, M.; Rulquin, H.; Keisler, D.H.; Djiane, J.; Jammes, H. Use of somatic cells from goat milk for dynamic studies of gene expression in the mammary gland1. J. Anim. Sci. 2002, 80, 1258–1269. [Google Scholar] [CrossRef] [PubMed]
- Yakan, A.; Ozkan, H.; Eraslan, A.; Ünal, N.; Özbeyaz, C. Gene expression levels in some candidate genes for mastitis resistance, milk yield, and milk quality of goats reared under different feeding systems. Turk. J. Vet. Anim. Sci. 2018, 42, 18–28. [Google Scholar] [CrossRef]
- Messeguer, X.; Escudero, R.; Farre, D.; Nunez, O.; Martinez, J.; Alba, M.M. Promo: Detection of known transcription regulatory elements using species-tailored searches. Bioinformatics (Oxf. UK) 2002, 18, 333–334. [Google Scholar] [CrossRef]
- El-Adawy, M.; El-Aziz, M.A.; El-Shazly, K.; Ali, N.G.; El-Magd, M.A. Dietary propionic acid enhances antibacterial and immunomodulatory effects of oxytetracycline on nile tilapia, oreochromis niloticus. Environ. Sci. Pollut. Res. 2018, 25, 34200–34211. [Google Scholar] [CrossRef]
- Sharawy, Z.Z.; Thiele, R.; Abbas, E.M.; El-Magd, M.A.; Hassaan, M.S.; Peter, C.; Schmidt, J.; Saborowski, R.; Goda, A.M.A.-S.; Slater, M.J. Antioxidant response, body composition of whiteleg shrimp litopenaeus vannamei co-cultured with nile tilapia oreochromis niloticus in recirculating aquaculture. Aquac. Environ. Interact. 2017, 9, 257–268. [Google Scholar] [CrossRef]
- EL-Magd, M.A.; Saleh, A.A.; Nafeaa, A.A.; EL-Komy, S.M.; Afifi, M.A. Polymorphisms of the igf1 gene and their association with growth traits, serum concentration and expression rate of igf1 and igf1r in buffalo. J. Zhejiang Univ. Sci. B 2017, 18, 1064–1074. [Google Scholar] [CrossRef]
- Fallin, D.; Cohen, A.; Essioux, L.; Chumakov, I.; Blumenfeld, M.; Cohen, D.; Schork, N.J. Genetic analysis of case/control data using estimated haplotype frequencies: Application to apoe locus variation and alzheimer’s disease. Genome Res. 2001, 11, 143–151. [Google Scholar] [CrossRef]
- Skrzypczak, E.; Babicz, M.; Pastwa, M. Effect of prolactin receptor (prlr) and beta-casein (csn2) gene polymorphism on the chemical composition of milk sows. Folia Biol. 2015, 63, 135–144. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Wyszynska-Koko, J.; Pierzchala, M.; Flisikowski, K.; Kamyczek, M.; Rozycki, M.; Kuryl, J. Polymorphisms in coding and regulatory regions of the porcine myf6 and myog genes and expression of the myf6 gene in m. Longissimus dorsi versus productive traits in pigs. J. Appl. Genet. 2006, 47, 131–138. [Google Scholar] [CrossRef] [PubMed]
- Sakai, S.; Kohmoto, K.; Shoda, Y. Correlation between mammary prolactin receptors of lactating mice and litter weight. J. Dairy Sci. 1985, 68, 2565–2570. [Google Scholar] [CrossRef]
- Lee, S.-M.; Kim, H.-M.; Moon, S.-J.; Kang, M.-J. Cloning and molecular characterization of porcine β-casein gene (cns2). Asian Australas. J. Anim. Sci. 2012, 25, 421–427. [Google Scholar] [CrossRef][Green Version]
- Shi, H.; Luo, J.; Zhu, J.; Li, J.; Sun, Y.; Lin, X.; Zhang, L.; Yao, D.; Shi, H. PparγRegulates genes involved in triacylglycerol synthesis and secretion in mammary gland epithelial cells of dairy goats. PPAR Res. 2013, 2013, 10. [Google Scholar] [CrossRef]
- Gu, M.; Cosenza, G.; Nicolae, I.; Bota, A.; Guo, Y.; Di Stasio, L.; Pauciullo, A. Transcript analysis at dgat1 reveals different mrna profiles in river buffaloes with extreme phenotypes for milk fat. J. Dairy Sci. 2017, 100, 8265–8276. [Google Scholar] [CrossRef]
- Nanbu-Wakao, R.; Fujitani, Y.; Masuho, Y.; Muramatu, M.; Wakao, H. Prolactin enhances ccaat enhancer-binding protein-beta (c/ebp beta) and peroxisome proliferator-activated receptor gamma (ppar gamma) messenger rna expression and stimulates adipogenic conversion of nih-3t3 cells. Mol. Endocrinol. (Baltim. MD USA) 2000, 14, 307–316. [Google Scholar]
- Viengchareun, S.; Servel, N.; Feve, B.; Freemark, M.; Lombes, M.; Binart, N. Prolactin receptor signaling is essential for perinatal brown adipocyte function: A role for insulin-like growth factor-2. PLoS ONE 2008, 3, e1535. [Google Scholar] [CrossRef]
- Flint, D.J.; Binart, N.; Boumard, S.; Kopchick, J.J.; Kelly, P. Developmental aspects of adipose tissue in gh receptor and prolactin receptor gene disrupted mice: Site-specific effects upon proliferation, differentiation and hormone sensitivity. J. Endocrinol. 2006, 191, 101–111. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer | Reverse Primer | Ta (°C) | Localization * | Size (bp) | Experiment |
---|---|---|---|---|---|---|
PRLR(L1) | ATGTGCCTCACCAGACTTT | CCAGGGAGTGAAAAAGAAC | 56 | E3, partial introns2, 3 | 212 | SNPs detection |
PRLR(L2) | TGGACCAAACAGACCAACAT | CAGGATGTTGCTATCTGTCAC | E10 (g.11566–g.11870) | 305 | ||
PRLR | AACCATTGAGACTGGCAGGG | AAGGGGGTTTTGTCTTGGGG | 60 | E10 | 114 | Relative expression by qRT-PCR |
PRL | GCATGCTTGGCTCTAATGGG | TGTCAGTTTCTGCTATTTGTGAC | Coding sequences | 186 | ||
β-actin | CGACAACGGCTCCGGCATGT | CTCCTCAGGGGCCACACGGA | 211 |
SNP | Genotype Frequency (Number) | Allele Frequency | χ2 (p-Value) | He | Ne | D’ | MAF | PIC | |||
---|---|---|---|---|---|---|---|---|---|---|---|
g.11685G>A | GG | GA | AA | G | A | 7.90 (0.019) | 0.49 | 1.99 | 1.0 | ||
0.32 (128) | 0.40 (160) | 0.28 (112) | 0.52 | 0.48 | 0.48 | 0.37 | |||||
g.11773T>C | TT | TC | CC | T | C | 1.42 (0.512) | 0.49 | 1.98 | |||
0.32 (128) | 0.455 (182) | 0.225 (90) | 0.55 | 0.45 | 0.45 | 0.37 |
Traits | AC (n = 90) | AT (n = 92) | GC (n = 90) | GT (n = 128) |
---|---|---|---|---|
Milk yield at 305 day (kg) | 1856.56 ± 43 cC | 2026.24 ± 41 b | 2058.33 ± 40 bB | 2310.48 ± 39 aA |
Fat percentage | 6.02 ± 0.10 cC | 6.54 ± 0.10 b | 6.468 ± 0.12 bB | 7.15 ± 0.14 aA |
Protein percentage | 4.00 ± 0.07 cC | 4.39 ± 0.06 bB | 4.35 ± 0.08 b | 4.85 ± 0.10 aA |
Lactose percentage | 5.17 ± 0.19 | 5.35 ± 0.21 | 5.21 ± 0.18 | 5.44 ± 0.16 |
Total solid percentage | 16.62 ± 0.30 | 17.24 ± 0.38 | 17.05 ± 0.34 | 17.19 ± 0.36 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
El-Magd, M.A.; Fathy, A.; Kahilo, K.A.; Saleh, A.A.; El Sheikh, A.I.; AL-Shami, S.; El-Komy, S.M. Polymorphisms of the PRLR Gene and Their Association with Milk Production Traits in Egyptian Buffaloes. Animals 2021, 11, 1237. https://doi.org/10.3390/ani11051237
El-Magd MA, Fathy A, Kahilo KA, Saleh AA, El Sheikh AI, AL-Shami S, El-Komy SM. Polymorphisms of the PRLR Gene and Their Association with Milk Production Traits in Egyptian Buffaloes. Animals. 2021; 11(5):1237. https://doi.org/10.3390/ani11051237
Chicago/Turabian StyleEl-Magd, Mohammed A., Aziza Fathy, Khaled A. Kahilo, Ayman A. Saleh, Ahmed I. El Sheikh, Salah AL-Shami, and Shymaa M. El-Komy. 2021. "Polymorphisms of the PRLR Gene and Their Association with Milk Production Traits in Egyptian Buffaloes" Animals 11, no. 5: 1237. https://doi.org/10.3390/ani11051237
APA StyleEl-Magd, M. A., Fathy, A., Kahilo, K. A., Saleh, A. A., El Sheikh, A. I., AL-Shami, S., & El-Komy, S. M. (2021). Polymorphisms of the PRLR Gene and Their Association with Milk Production Traits in Egyptian Buffaloes. Animals, 11(5), 1237. https://doi.org/10.3390/ani11051237