Next Article in Journal
Effect of Different Farming Practices on Lactic Acid Bacteria Content in Cow Milk
Next Article in Special Issue
Evaluation of Triclosan Effects on Cultured Swine Luteal Cells
Previous Article in Journal
Effect of Fasting on the Spexin System in Broiler Chickens
Previous Article in Special Issue
Longitudinal Expression of Testicular TAS1R3 from Prepuberty to Sexual Maturity in Congjiang Xiang Pigs
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Association of an SNP in the EXOC4 Gene and Reproductive Traits Suggests Its Use as a Breeding Marker in Pigs

1
Guangdong Provincial Key Lab of Agro-Animal Genomics and Molecular Breeding, National Engineering Research Center for Breeding Swine Industry, College of Animal Science, South China Agricultural University, Guangzhou 510642, China
2
Guangdong Dexing Food Co., Ltd., Shantou 515100, China
3
Guangdong Provincial Key Laboratory of Laboratory Animals, Guangdong Laboratory Animals Monitoring Institute, Guangzhou 510260, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Animals 2021, 11(2), 521; https://doi.org/10.3390/ani11020521
Submission received: 29 January 2021 / Revised: 7 February 2021 / Accepted: 10 February 2021 / Published: 17 February 2021
(This article belongs to the Special Issue Advances in Pig Reproduction)

Simple Summary

The exocyst complex component 4 (EXOC4) gene is essential for the growth and development of humans and animals. However, the molecular mechanisms between EXOC4 and the reproductive performance of pigs is yet to be elucidated. The findings of our study revealed that single-nucleotide polymorphism (SNP) rs81471943 (C/T) was located in the EXOC4 gene by Sanger sequencing and PCR-restriction fragment length polymorphism (PCR-RFLP). We then analyzed the relationship between this SNP in EXOC4 and reproductive traits. We found that CC was the most frequent genotype on number of piglets born alive (NBA), litter weight at birth (LWB), number of piglets weaned (NW), and litter weight at weaning (LWW). Finally, 5′-deletion and luciferase assays showed a positive transcription regulatory element in the EXOC4 promoter. Therefore, we predicted that −1781G/A might regulate the expression of EXOC4 by affecting the potential binding of transcription factors P53, E26 transformation specific sequence -like 1 transcription factor (ELK1), or myeloid zinc finger 1 (MZF1).

Abstract

In mammals, the exocyst complex component 4 (EXOC4) gene has often been reported to be involved in vesicle transport. The SNP rs81471943 (C/T) is located in the intron of porcine EXOC4, while six quantitative trait loci (QTL) within 5–10 Mb around EXOC4 are associated with ovary weight, teat number, total offspring born alive, and corpus luteum number. However, the molecular mechanisms between EXOC4 and the reproductive performance of pigs remains to be elucidated. In this study, rs81471943 was genotyped from a total of 994 Duroc sows, and the genotype and allele frequency of SNP rs81471943 (C/T) were statistically analyzed. Then, the associations between SNP rs81471943 and four reproductive traits, including number of piglets born alive (NBA), litter weight at birth (LWB), number of piglets weaned (NW), and litter weight at weaning (LWW), were determined. Sanger sequencing and PCR restriction fragment length polymorphism (PCR-RFLP) were utilized to identify the rs81471943 genotype. We found that the genotype frequency of CC was significantly higher than that of CT and TT, and CC was the most frequent genotype for NBA, LWB, NW, and LWW. Moreover, 5′-deletion and luciferase assays identified a positive transcription regulatory element in the EXOC4 promoter. After exploring the EXOC4 promoter, SNP −1781G/A linked with SNP rs81471943 (C/T) were identified by analysis of the transcription activity of the haplotypes, and SNP −1781 G/A may influence the potential binding of P53, E26 transformation specific sequence -like 1 transcription factor (ELK1), and myeloid zinc finger 1 (MZF1). These findings provide useful information for identifying a molecular marker of EXOC4-assisted selection in pig breeding.

1. Introduction

Pigs were the earliest livestock species to be domesticated. Pig breeding has a particularly long history involving artificial selection from domestication to modern breeding [1]. The abundant phenotypic variations established during pig breeding have been a valuable resource to study the economic trait mechanisms underlying domestication [2]. Causal gene identification provides useful information about the mutation types underlying the phenotypic evolution of domestic animals [3]. In porcine production, improvements in the reproductive performance of sows are slow due to the low heritability of reproductive traits [4]. The recent development of sequencing and genotyping technologies for pigs have enabled the exploration of genomic evidence of selection and the detection of candidate genes associated with target traits. Studies have found that the positive selection of pigs is associated with specific genes related to lactation [5], reproduction [6,7], meat quality [8], and growth traits [9]. Reproductive traits, such as the number of piglets born alive (NBA) [10], lactation capacity, number of piglets weaned (NW) [11], and litter weight at weaning (LWW) [12], have all been genetically improved through artificial selection.
Porcine reproduction performance is mostly evaluated by quantitative traits, which in turn are mainly affected by minor genes. These minor genes can be identified by quantitative trait loci (QTL) mapping [13]. According to PigQTLdb [14], there are 29,865 QTL associated with 688 different traits. On chromosome 18, there are three, three, two and five QTL significantly associated with porcine ovary weight [15], teat number, total offspring born alive, and corpus luteum number traits [16,17,18], respectively. In a commercial single nucleotide polymorphism (SNP) array, one SNP, rs81471943, located in the exon of the exocyst complex component 4 (EXOC4) gene, and six QTLs associated with reproductive traits were identified within 5–10 Mb around EXOC4. This suggested that EXOC4 might be associated with reproductive traits. EXOC4 is one of the subunits of the exocyst, which is an evolutionarily conserved complex of eight proteins, comprising EXOC1, EXOC2, EXOC3, EXOC4, and other subunits. The exocyst complex is posited to be involved in protein transfer between cells [19,20]. EXOC4 connects vesicles to the cell membrane and participates in vesicular-mediated transport. EXOC4 has been reported to be expressed in many human tissues, with slightly higher expression in the ovary, skeletal muscle, spleen, and hypothalamus [21]. A study investigating the gene interactions for body mass index (BMI) in a European–American adult female cohort used genome-wide interaction analyses and pathway association analyses to show that the EXOC4-1q23.1 interaction was associated with BMI. In the pathway-based association analysis, the Tob1 pathway, which contributes to obesity through the mitogen-activated protein kinase (MAPK) pathway, showed the most significant association with BMI. These findings were also replicated in different human populations [22]. In addition, we analyzed the general linkage disequilibrium (LD) within +/−100 Kb around the EXOC4 gene via Haploview. However, the underlying relationship between SNP rs81471943 and reproductive traits, as well as the transcription mechanism of EXOC4, are still unclear in pigs.
To explore the relationship between SNP rs81471943 and reproduction traits in pigs, we acquired the genotype frequencies of SNP rs81471943 in Duroc pigs. The associations between SNP rs81471943 and reproductive traits such as NW, LWW, NBA, and litter weight at birth (LWB) were determined. Then, 5′-deletion and a luciferase assay were utilized to identify whether SNP rs81471943 was associated with the transcription of EXOC4. This study contributes to the understanding of the regulatory mechanisms of the EXOC4 gene and molecular marker-assisted selection in pig breeding.

2. Materials and Methods

2.1. Ethics Approval and Consent to Participate

Experiments and animal care in this study were conducted according to the Regulations for the Administration of Affairs Concerning Experimental Animals (Ministry of Science and Technology, Beijing, China, revised June 2004) and approved by the Animal Care and Use Committee of the South China Agricultural University, Guangzhou, China (approval number: SYXK 2019-0136).

2.2. Animals

Ear samples from 994 Duroc sows prepared for SNP genotyping were obtained from a breeding herd and were collected from 2009 to 2017 in Fujian, China. The ear samples were collected into 75% alcohol and stored at −20 °C. TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Version 4.0 (TaKaRa, Dalian, China) was utilized to extract the genomic DNA from porcine ear tissues. The A260/280 ratios of all DNA samples were determined with a NanoDrop One (Thermo Fisher Scientific, Waltham, MA, USA). All DNA samples passed A260/280 ratio (1.7–2.0) detection and were genotyped on an Illumina PorcineSNP60 BeadChip (Illumina, San Diego, CA, USA). Four reproductive traits, including NBA, LWB, NW and LWW, were recorded. NBA and LWB were measured 24 h after delivery, and LWW and NW were recorded after weaning.

2.3. Polymorphism Identification and Genotype with PCR-Restriction PCR-RFLP

To determine the polymorphic locus rs81471943 (C/T) of the porcine EXOC4 gene, 8 Duroc pigs were sequenced by Sanger sequencing, and 10 Duroc pigs were genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP) as confirmation. DNA extracted from the ear samples of 10 pigs was set as the template. The fragment containing SNP rs81471943 (position: 16,079,412 of chromosome 18) of EXOC4, a gene with a length of 640 bp (position: 16,078,898–16,079,537 of chromosome 18), was amplified using PrimerSTAR® high fidelity enzyme (TaKaRa, Dalian, China). The primers are listed in Table 1 and named EXOC4-SNP. The PCR reaction system (10 μL) included: 5 μL Primer STAR mix, 0.3 μL forward primer, 0.3 μL reverse primer, 1 μL DNA and 3.4 μL double distilled H2O (ddH2O). The PCR procedure involved: pre-denaturation at 98 °C for 2 min, 35 cycles (denaturation at 98 °C for 10 s, annealing at 53 °C for 15 s, extension at 72 °C for 1 kb * min−1), and extension at 72 °C for 10 min.
Consequently, PCR products were separated by agarose gel electrophoresis and isolated using a Gel extraction kit (Meiji, Guangzhou, China). The isolated products were digested by BsrB I (identification sequence: CCGCTC) restriction endonuclease (NEB, Ipswich, UK) and separated using agarose gel electrophoresis. PCR products with two digested fragments were CC genotype (565 bp + 75 bp), those with three digested fragments were CT genotype (640 bp + 565 bp + 75bp), and those with a single digested fragment were TT genotype (640 bp).

2.4. Culture of Porcine Granulosa Cells (GCs) in Vitro

GCs were cultured according to previous studies [23]. Porcine ovaries were collected from a local slaughterhouse in Guangzhou, China. The ovaries were stored in phosphate-buffered saline (PBS) containing penicillin (100 IU/mL) and streptomycin (100 μg/mL; Invitrogen, Shanghai, China) at 37 °C and transported to the laboratory quickly. Then, 5–7 mm follicles were punctured, and GCs in follicular fluid were collected using a 1 mL syringe. After washing the isolated GCs twice with PBS, the GCs were seeded into 75 cm2 flasks and cultured at 37 °C under 5% CO2 in Dulbecco’s modified Eagle medium (Hyclone, Logan, UT, USA) containing 10% fetal bovine serum (100 IU/mL penicillin and 100 μg/mL streptomycin; Hyclone, Logan, UT, USA).

2.5. Construction of EXOC4 5′-Deletion Fragment Vectors

According to the promoter sequences of porcine EXOC4 from release 89 of the Ensembl genome browser (accession number: ENSSSCG00000016543, position: 16,057,927–16,346,564 of chromosome 18), we inferred that there was no leader exon present in EXOC4. Then, we designed 10 pairs of primers to amplify the deletion fragments of the EXOC4 promoter (Table 1). The transcription start site of the EXOC4 gene (position: 16,346,564 of chromosome 18) was defined as +1. Thus, the longest 5′ deletion fragment, which covered a 2657 bp sequence upstream of the transcription start site and a 134 bp sequence of the first exon, was named P0 (−2657/+134), and the other fragments were named P1 (−2204/+134), P2 (−1914/+134), P3 (−1682/+134), P4 (−1323/+134), P5 (−886/+134) and P6 (−518/+134). The shorter 5′ deletion fragments were named P3A (−1826/+134), P4A (−1551/+134), and P4B (−1225/+134). The PCR product was obtained by Taq DNA polymerase (Vazyme, Piscataway, NJ, USA). The primers are listed in Table 1. The PCR reaction system (10 μL) included: 5 μ L PCR Taq mix, 0.3 μL forward primer, 0.3 μL reverse primer, 1 μL DNA, and 3.4 μL ddH2O. The PCR procedure involved: pre-denaturation at 94 °C for 3 min, 35 cycles (denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 1 kb * min−1), and extension at 72 °C for 10 min. PCR products were purified by gelatinization and were added “AAA” tails to ligate with PMD-18T were performed prior to Sanger sequencing (RuiBiotech, Beijing, China). The DNA sequences of PCR products were determined by DNASTAR software. Each deletion fragment digested with Hind III and MIu I was cloned into the eukaryotic expression vector pGL3-vector, which was also digested with Hind III and MIu I restriction endonucleases.

2.6. Luciferase Assay

According to the manufacturer’s instructions for the dual-luciferase reporter assay kit (Promega, Madison, WI, USA), we used the BioTek Synergy 2 multifunctional microplate reader for fluorescence detection (BioTek, Winooski, VT, USA). In the luciferase assay, firefly luciferase was set as the experimental reporter and renilla luciferase was set as the control. Relative luciferase activity is calculated by the ratio of the expression of firefly luciferase (560 nm) to renilla luciferase (465 nm). The ratio of expression can normalize the activity of an experimental reporter to the activity of an internal control, which minimizes or sometimes even eliminates the experimental variability.

2.7. Identification of SNP and Transcription Binding Sites

For sequencing and SNP identification, 35 pigs were randomly selected from the 994 pigs used in this study. PCR was performed using PrimerSTAR® high fidelity enzyme (TaKaRa, Dalian, China) to obtain the fragment containing the EXOC4 promotor, and the primers used are listed in Table 1 (named EXOC4-Promoter). The reaction system and PCR procedure were the same as in Section 2.3. Then, the PCR product was linked to the T-vector and sequenced by Sanger sequencing (RuiBiotech, Beijing, China). After comparing with the sequences published on the Ensembl genome browser (release 89), one SNP was identified and located on −1781G/A of EXOC4, and this SNP also located on the potential transcription factor-binding fragment P3A-P4A (−1826/−1551) of EXOC4.
To detect the linkage between SNP −1781G/A and SNP rs81471943 of EXOC4, four haplotypes were identified and defined as HA-1 (GC), HA-2 (AC), HA-3 (GT) and HA-4 (AT). The 5′ deletion fragments EXOC4-P2 (−1914/+134) of four haplotypes were amplified and cloned into the eukaryotic expression vector pGL3-vector. Luciferase assays were used to detect the effect of different haplotypes on the transcription activity of EXOC4. We analyzed the general linkage disequilibrium (LD) within +/−100 Kb of the EXOC4 gene via Haploview, and the location diagram of the SNP, exons, deletion, binding sites, and promoter is shown in Figure 1. Then, the potential transcription factor binding region was also predicted by TFBIND [21] and Jaspar [22]. The results of the potential transcription factor binding site were scored by TFBIND.

2.8. Statistical Analysis

Estimated breeding values (EBVs) of all pigs were computed using animal model best linear unbiased prediction [24] and obtained from the in-farm genetic evaluation software platform Herdsman swine management (S & S Programming, Lafayette, IN, USA). The models used were as follows:
Y = Xb + Za + Wpe + e
where Y is a vector of phenotypic records, b is the vector of fixed effects (including parity and year-season), a is the vector of additive genes, pe is the vector of permanent environmental effects, e is a vector of residuals, and X , Z and W are incidence matrices for b , a, and pe.
The EBVs of reproductive traits (NBA, LWB, LWW and NW) were used for the multiple comparisons of SNP genotype rs81471943 by the Tukey–Kramer multiple comparison via the 9.2 version of SAS software (North Carolina State University, Raleigh, NC, USA). p < 0.05 indicates significant differences.
The luciferase assay was repeated at least three times independently, and the data are shown as the mean ± standard deviation (SD) of repeated experiments. The significance of differences in the means between two groups was analyzed using Student’s t-test (two-tailed). ** indicates significant difference at p < 0.01, and * indicates significant difference at p < 0.05.

3. Results

3.1. Polymorphisms of SNP rs81471943

The genotype frequency of the rs81471943 on the EXOC4 gene in the 994 Duroc pigs was calculated (Table 2). Three genotypes for SNP rs81471943 were found. CC was the most frequent genotype, with a genotype frequency of 0.715, which was higher than that of CT (0.258) and TT (0.027). The most frequent allele was C, with an allele frequency of 0.844, which was higher than that of T (0.156). The χ2 valued 0.224 < 5.99 and confirmed that the frequency distribution of SNP rs81471943 was in accordance with the Hardy–Weinberg equilibrium law in the selected Duroc pig population.

3.2. Association Between SNP rs81471943 and Reproduction Traits

Descriptive statistics for the phenotype of 994 Duroc sows with CC, CT and TT genotypes are shown in Figure 2. The NBA (Figure 2A), NW (Figure 2A) and LWW (Figure 2B) of individuals with CC was higher than CT and TT. The LWB (Figure 2B) of individuals with CC was higher than those with CT and lower than those with TT (Figure 2).
Moreover, descriptive statistics for EBVs of phenotypes are shown in Table 3. The EBVs of NBA of individuals with CC was higher than CT and TT, but there was no significant difference among the three genotypes. The EBVs of LWB of individuals with CC was higher than CT and lower than TT. The EBVs of NW and LWW of individuals with CC was significantly higher than CT and non-significantly higher than TT (Table 3). These observations suggested that CC was the most frequent genotype for NW and LWW.

3.3. Isolation of SNP rs81471943 on EXOC4

Target fragments of EXOC4 containing SNP rs81471943 were amplified from extracted DNA from eight Duroc pigs and identified by Sanger sequencing (Figure 3A–C). Compared with the sequence of EXOC4 in the Ensembl genome browser (release 89), a polymorphic mutation base C/T was found on EXOC4 (position: 16,079,412 of chromosome 18), which is in line with SNP rs81471943 in the commercial SNP array. To determine the polymorphic loci SNP rs81471943 of EXOC4, 10 pigs were used in the PCR-RFLP detection. As shown in Figure 4, the three genotypes CC, CT and TT were identified by restriction endonuclease BsrB I.

3.4. Transcription Activity Analysis of the EXOC4 Promoter

To identify regulatory elements on the EXOC4 promoter, 5′-deletion and luciferase assays were used. Six fragments with a 5′-deletion of the EXOC4 promoter were amplified (Figure 5A) and cloned into pGL3-vector (Figure 5B). Compared with EXOC4-P2 (−1914/+134), the relative luciferase activity of EXOC4-P1 (−2204/+134), EXOC4-P3 (−1682/+134), and EXOC4-P4 (−1323/+134) were all significantly decreased (Figure 5C). This indicated that the P1–P2 (−2204/−1914) region might harbor the negative control elements, and the P2–P4 (−1914/−1323) region might harbor the positive transcription regulatory elements.
Then, the shorter 5′ deletion fragments of P3A (−1826/+134), P4A (−1551/+134), and P4B (−1225/+134) were amplified (Figure 6A) and cloned into the eukaryotic expression vector pGL3-vector (Figure 6B). Compared with EXOC4-P3A, the relative luciferase activity of EXOC4-P3 and EXOC4-P4A were significantly decreased. Similarly, compared with EXOC4-P3, the relative luciferase activity of EXOC4-P4A was significantly decreased (Figure 6C). These results indicated that positive transcription regulatory elements might exist in the P3A–P4A (−1826/−1551) region of EXOC4.

3.5. Transcription Activity Analysis of Different Haplotypes of the EXOC4 Gene

The −1826/−1551 fragment of EXOC4 was amplified and sequenced. Interestingly, one SNP was identified as being located on −1781 of EXOC4. As shown in Table 4, there was an SNP located on −1781G/A of EXOC4, and four haplotypes were defined as HA-1 (GC), HA-2 (AC), HA-3 (GT), and HA-4 (AT).
As shown in Figure 7, we found that the luciferase activity of HA-1 was significantly (p < 0.05) higher than HA-2, whilst HA-3 was significantly (p < 0.05) higher than HA-4. These observations suggested that the SNP rs81471943 might link with −1781G/A and −1781G to potentially affect the expression of EXOC4. Moreover, many potential binding sites of transcription factors were predicted on −1781G/A of EXOC4 (Table 5). P53 and ETS transcription factor (ELK1) might bind at −1781A, while myeloid zinc finger 1 (MZF1) might bind at −1781G.

4. Discussion

The exocyst is a protein complex composed of EXOC1 to EXOC8. The exocyst mediates the docking of vesicles carrying membrane proteins [25]. EXOC4 is a component of the exocyst complex, which is associated with various phenomena such as cell migration, endophoria formation, cytokinesis, glucose uptake, and neural development in mammals. Previous studies indicate that the mutation of specific SNP loci in EXOC4 leads to an increase in the malformation rate of human newborns [26]. EXOC4 is also involved in insulin, triiodothyronine, and thyroxine secretion in Chinese Holstein cattle [27]. Jiao et al. investigated the interactions between EXOC4-1q23.1 and BMI in a European–American adult female cohort via genome-wide interaction analyses, and results suggest that EXOC4-related pathways may contribute to the development of obesity [22]. Similarly, after EXOC4 knockout in embryos, mice can form gastrointestinal embryos normally, but are unable to progress beyond the primitive streak stage and die shortly after [20]. In addition, genome-wide association studies in chickens also report that three QTL are located on EXOC4 and are associated with growth traits of 49–56 day old chickens [28], bodyweight of 63 day old chickens [29], and pectoralis weight of 70 day old chickens [30], respectively. These observations suggest that ECOX4 might be important for economic traits in livestock.
In this study, we found the SNP rs81471943 (C/T) located on the EXOC4 gene. After analyzing the relationship between genotype of the EXOC4 and reproductive traits, three genotypes (CC, CT and TT) were found in the Duroc pig population, while C was the most frequent allele. Moreover, multiple comparisons between SNP and phenotypes confirmed that CC was the most frequent genotype on NW and LWW in Duroc pigs (Figure 2 and Table 3). Previous studies have shown that there are three QTL which are significantly associated with teat number [16,17,18] on chromosome 18, which indicated that EXOC4 could affect the lactation performance of commercial pigs. In this study, we also found that CC was significantly associated with NW and LWW, but not NBA or LWB. In addition, previous studies demonstrated that reproductive traits were highly correlated with each other, such as NBA and LWB [31]. In this study, we found that CC was the most frequent genotype for NBA, but not LWB. This observation might be caused by the limited sample size used in this study, and it is likely that CC would be significantly associated with NBA in a larger population size [32]. Collectively, although the results were based on a relatively small population, to some extent, the association of SNP rs81471943 and lactation capacity, NW, and LWW could provide useful information for EXOC4-mediated reproduction in pigs.
It is well known that transcription factors modulate gene expression by interacting with the promoter regions of related genes. For example, p65 may target the −348/−338 region of fibroblast growth factor receptor 1 (FGFR1) to promote the transcription of FGFR1 and enhance the pro-proliferation and anti-apoptotic effect of FGFR1 to facilitate the growth of follicles [33]. Thus, to explore effects of rs81471943 on the expression of EXOC4, the SNP markers which link with rs81471943 at the promoter of EXOC4 were further investigated by constructing 5′-deletions for EXOC4. Interestingly, we found that positive regulatory elements might localize in the P3A–P4A (−1826/−1551) region (Figure 6), and the negative control element might localize in the P1–P2 (−2204/−1914) region (Figure 5). After exploring the SNPs in the P3A–P4A (−1826−1551) region (containing positive transcription regulatory elements), one SNP was found to be located on −1781. Then, we further analyzed the transcription activity of the four haplotypes. The results showed that SNP rs81471943 might link with SNP −1781G/A, and SNP −1781G showed the potential to affect the expression of EXOC4 (Figure 7). These results indicate that SNP rs81471943 might link with SNP −1781G to affect the expression of EXOC4.
The literature indicates that −1781G/A might regulate the expression of EXOC4 by affecting the binding of transcription factors. In this study, we also predicted that the transcription factors P53, ELK1, and MZF1 would be located on the −1826/−1551 region of the porcine EXOC4 promoter. P53 participates in maintaining cell growth [34]. P53 can enhance stability through phosphorylation and the activation or inhibition of the transcription of downstream genes, thus inducing cell cycle arrest and apoptosis [35]. ELK1 is a transcription factor belonging to the ETS oncogene family and induces endothelial-to-myofibroblast transition of tumor endothelial cells [36], which plays an important role in breast and ovarian cancers [15]. As a bifunctional transcription factor, MZF1 belongs to the zinc finger protein Kruppel transcription factor family, which regulate downstream gene expression by binding to the cis-acting element TGGGGA on gene promoters [37,38]. Results in Table 4 and Figure 7 indicate that the mutation of −1781G might be the cause of the differences in EXOC4 transcription. Taken together, SNP rs81471943, which was significantly associated with NW and LWW, might link with SNP −1781G/A, localizing at the positive regulatory elements of the EXOC4 promoter, to affect the expression of EXOC4 in Duroc pigs.

5. Conclusions

In Duroc pigs, we found that the CC genotype frequency was significantly higher than CT and TT in SNP rs81471943, and CC was the most frequent genotype for NW (p = 0.01) and LWW (p < 0.01). The −1826/−1551 region of EXOC4 contains a positive regulatory element, and the haplotypes of SNP −1781G/A and SNP rs81471943 might significantly affect the transcription activity of EXOC4. Moreover, SNP −1781G/A might influence the binding of the potential cis-acting elements P53, ELK1 and/or MZF1. These findings reveal that SNP rs81471943 is significantly associated with the reproductive traits NW and LWW in Duroc sows.

Author Contributions

Y.H. performed the research and wrote the original manuscript, X.Z., X.W. and X.Y. reviewed and edited the manuscript, R.Z., Y.J. and Z.Y. supervised the research, Z.Z. and H.Z. administrated the project, and J.L. managed the funding. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the National Natural Science Foundation of China (31902131), the Science and Technology Pro-gram of Guangzhou (202002030071), the Natural Science Foundation of Guangdong Province (2019A1515010676), earmarked funds for the China Agriculture Research System (CARS-35) and the Key R&D Program of Guangdong Province (2018B020203003).

Institutional Review Board Statement

Experiments and animal care in this study were conducted according to the Regulations for the Administration of Affairs Concerning Experimental Animals (Ministry of Science and Technology, Beijing, China, revised June 2004) and approved by the Animal Care and Use Committee of the South China Agricultural University, Guangzhou, China (approval number: SYXK 2019-0136).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

The authors would like to thank Fujian Yongcheng Farming and Animal Husbandry Co., Ltd. for providing the data and the opportunity to conduct this study. We gratefully thank Baoquan Shao, Shaopan Ye, Xiangchun pan, Haoqiang Ye, and Jun Zhou for their help in this work. Also, we are grateful to the editors and the three anonymous reviewers for their insightful comments and constructive suggestions that greatly improved our manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Diamond, J. Evolution, consequences and future of plant and animal domestication. Nature 2002, 418, 700–707. [Google Scholar] [CrossRef]
  2. Yang, Y.; Liu, C.; Adeola, A.C.; Sulaiman, X.; Xie, H.B.; Zhang, Y.P. Artificial selection drives differential gene expression during pig domestication. J. Genet. Genom. 2019, 46, 97–100. [Google Scholar] [CrossRef]
  3. Andersson, L. Domestic animals as models for biomedical research. Upsala J. Med. Sci. 2016, 121, 1–11. [Google Scholar] [CrossRef] [PubMed]
  4. Goddard, M.E.; Hayes, B.J. Mapping genes for complex traits in domestic animals and their use in breeding programmes. Nat. Rev. Genet. 2009, 10, 381–391. [Google Scholar] [CrossRef]
  5. Zhuang, Z.; Ding, R.; Peng, L.; Wu, J.; Ye, Y.; Zhou, S.; Wang, X.; Quan, J.; Zheng, E.; Cai, G.; et al. Genome-wide association analyses identify known and novel loci for teat number in Duroc pigs using single-locus and multi-locus models. BMC Genom. 2020, 21, 344. [Google Scholar] [CrossRef] [PubMed]
  6. Fischer, D.; Laiho, A.; Gyenesei, A.; Sironen, A. Identification of Reproduction-Related Gene Polymorphisms Using Whole Transcriptome Sequencing in the Large White Pig Population. G3 (Bethesda) 2015, 5, 1351–1360. [Google Scholar] [CrossRef]
  7. Bjerre, D.; Madsen, L.B.; Mark, T.; Cirera, S.; Larsen, K.; Jorgensen, C.B.; Fredholm, M. Potential Role of the Porcine Superoxide Dismutase 1 (SOD1) Gene in Pig Reproduction. Anim. Biotechnol. 2013, 24, 1–9. [Google Scholar] [CrossRef] [PubMed]
  8. Pugliese, C.; Sirtori, F. Quality of meat and meat products produced from southern European pig breeds. Meat Sci. 2012, 90, 511–518. [Google Scholar] [CrossRef]
  9. Matika, O.; Robledo, D.; Pong-Wong, R.; Bishop, S.C.; Riggio, V.; Finlayson, H.; Lowe, N.R.; Hoste, A.E.; Walling, G.A.; Del-Pozo, J.; et al. Balancing selection at a premature stop mutation in the myostatin gene underlies a recessive leg weakness syndrome in pigs. PLoS Genet. 2019, 15, e1007759. [Google Scholar] [CrossRef]
  10. Stafuzza, N.B.; Silva, R.M.O.; Fragomeni, B.O.; Masuda, Y.; Huang, Y.; Gray, K.; Lourenco, D.A.L. A genome-wide single nucleotide polymorphism and copy number variation analysis for number of piglets born alive. BMC Genom. 2019, 20, 321. [Google Scholar] [CrossRef]
  11. Zheng, X.; Zhao, P.; Yang, K.; Ning, C.; Wang, H.; Zhou, L.; Liu, J. CNV analysis of Meishan pig by next-generation sequencing and effects of AHR gene CNV on pig reproductive traits. J. Anim. Sci. Biotechnol. 2020, 11, 42. [Google Scholar] [CrossRef] [PubMed]
  12. Sell-Kubiak, E.; Duijvesteijn, N.; Lopes, M.S.; Janss, L.L.; Knol, E.F.; Bijma, P.; Mulder, H.A. Genome-wide association study reveals novel loci for litter size and its variability in a Large White pig population. BMC Genom. 2015, 16, 1049. [Google Scholar] [CrossRef] [PubMed]
  13. Ernst, C.W.; Steibel, J.P. Molecular advances in QTL discovery and application in pig breeding. Trends Genet. 2013, 29, 215–224. [Google Scholar] [CrossRef]
  14. Hu, Z.L.; Park, C.A.; Reecy, J.M. Building a livestock genetic and genomic information knowledgebase through integrative developments of Animal QTLdb and CorrDB. Nucleic Acids Res. 2019, 47, D701–D710. [Google Scholar] [CrossRef]
  15. Goncharenko-Khaider, N.; Matte, I.; Lane, D.; Rancourt, C.; Piche, A. Ovarian cancer ascites increase Mcl-1 expression in tumor cells through ERK1/2-Elk-1 signaling to attenuate TRAIL-induced apoptosis. Mol. Cancer 2012, 11, 84. [Google Scholar] [CrossRef] [PubMed]
  16. Hernandez, S.C.; Finlayson, H.A.; Ashworth, C.J.; Haley, C.S.; Archibald, A.L. A genome-wide linkage analysis for reproductive traits in F2 Large White x Meishan cross gilts. Anim. Genet. 2014, 45, 191–197. [Google Scholar] [CrossRef] [PubMed]
  17. Tribout, T.; Iannuccelli, N.; Druet, T.; Gilbert, H.; Riquet, J.; Gueblez, R.; Mercat, M.J.; Bidanel, J.P.; Milan, D.; Le Roy, P. Detection of quantitative trait loci for reproduction and production traits in Large White and French Landrace pig populations. Genet. Sel. Evol. 2008, 40, 61–78. [Google Scholar] [CrossRef]
  18. Duijvesteijn, N.; Veltmaat, J.M.; Knol, E.F.; Harlizius, B. High-resolution association mapping of number of teats in pigs reveals regions controlling vertebral development. BMC Genom. 2014, 15, 542. [Google Scholar] [CrossRef]
  19. Schiller, J.T.; Day, P.M.; Kines, R.C. Current understanding of the mechanism of HPV infection. Gynecol. Oncol. 2010, 118, S12–S17. [Google Scholar] [CrossRef]
  20. Tanaka, T.; Goto, K.; Iino, M. Sec8 modulates TGF-beta induced EMT by controlling N-cadherin via regulation of Smad3/4. Cell. Signal. 2017, 29, 115–126. [Google Scholar] [CrossRef]
  21. Nagase, T.; Kikuno, R.; Hattori, A.; Kondo, Y.; Okumura, K.; Ohara, O. Prediction of the coding sequences of unidentified human genes. XIX. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res. 2000, 7, 347–355. [Google Scholar] [CrossRef] [PubMed]
  22. Jiao, H.; Zang, Y.; Zhang, M.; Zhang, Y.; Wang, Y.; Wang, K.; Price, R.A.; Li, W.D. Genome-Wide Interaction and Pathway Association Studies for Body Mass Index. Front. Genet. 2019, 10, 404. [Google Scholar] [CrossRef]
  23. Zhong, Y.; Li, L.; He, Y.; He, B.; Li, Z.; Zhang, Z.; Zhang, H.; Yuan, X.; Li, J. Activation of Steroidogenesis, Anti-Apoptotic Activity, and Proliferation in Porcine Granulosa Cells by RUNX1 Is Negatively Regulated by H3K27me3 Transcriptional Repression. Genes 2020, 11, 495. [Google Scholar] [CrossRef]
  24. Henderson, C.R. Best linear unbiased estimation and prediction under a selection model. Biometrics 1975, 31, 423–447. [Google Scholar] [CrossRef]
  25. Lipschutz, J.H.; Mostov, K.E. Exocytosis: The many masters of the exocyst. Curr. Biol. 2002, 12, R212–R214. [Google Scholar] [CrossRef]
  26. Barkefors, I.; Fuchs, P.F.; Heldin, J.; Bergstrom, T.; Forsberg-Nilsson, K.; Kreuger, J. Exocyst complex component 3-like 2 (EXOC3L2) associates with the exocyst complex and mediates directional migration of endothelial cells. J. Biol. Chem. 2011, 286, 24189–24199. [Google Scholar] [CrossRef]
  27. Gan, Q.; Li, Y.; Liu, Q.; Lund, M.; Su, G.; Liang, X. Genome-wide association studies for the concentrations of insulin, triiodothyronine, and thyroxine in Chinese Holstein cattle. Trop. Anim. Health Prod. 2020, 52, 1655–1660. [Google Scholar] [CrossRef]
  28. Gao, Y.; Hu, X.X.; Du, Z.Q.; Deng, X.M.; Huang, Y.H.; Fei, J.; Feng, J.D.; Liu, Z.L.; Da, Y.; Li, N. A genome scan for quantitative trait loci associated with body weight at different developmental stages in chickens. Anim. Genet. 2006, 37, 276–278. [Google Scholar] [CrossRef] [PubMed]
  29. Nadaf, J.; Pitel, F.; Gilbert, H.; Duclos, M.J.; Vignoles, F.; Beaumont, C.; Vignal, A.; Porter, T.E.; Cogburn, L.A.; Aggrey, S.E.; et al. QTL for several metabolic traits map to loci controlling growth and body composition in an F2 intercross between high- and low-growth chicken lines. Physiol. Genom. 2009, 38, 241–249. [Google Scholar] [CrossRef] [PubMed]
  30. Park, H.B.; Jacobsson, L.; Wahlberg, P.; Siegel, P.B.; Andersson, L. QTL analysis of body composition and metabolic traits in an intercross between chicken lines divergently selected for growth. Physiol. Genom. 2006, 25, 216–223. [Google Scholar] [CrossRef]
  31. Ogawa, S.; Konta, A.; Kimata, M.; Ishii, K.; Uemoto, Y.; Satoh, M. Estimation of genetic parameters for farrowing traits in purebred Landrace and Large White pigs. Anim. Sci. J. 2019, 90, 23–28. [Google Scholar] [CrossRef]
  32. Charlesworth, B. Fundamental concepts in genetics: Effective population size and patterns of molecular evolution and variation. Nat. Rev. Genet. 2009, 10, 195–205. [Google Scholar] [CrossRef] [PubMed]
  33. Yuan, X.; Li, Z.; Kong, Y.; Zhong, Y.; He, Y.; Zhang, A.; Zhou, X.; Jiang, Y.; Zhang, Z.; Zhang, H.; et al. P65 Targets FGFR1 to Regulate the Survival of Ovarian Granulosa Cells. Cells 2019, 8, 1334. [Google Scholar] [CrossRef] [PubMed]
  34. McKinley, K.L.; Cheeseman, I.M. Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev. Cell 2017, 40, 405–420.e402. [Google Scholar] [CrossRef] [PubMed]
  35. Zhu, R.X.; Cheng, A.S.L.; Chan, H.L.Y.; Yang, D.Y.; Seto, W.K. Growth arrest-specific gene 2 suppresses hepatocarcinogenesis by intervention of cell cycle and p53-dependent apoptosis. World J. Gastroenterol. 2019, 25, 4715–4726. [Google Scholar] [CrossRef] [PubMed]
  36. Akatsu, Y.; Takahashi, N.; Yoshimatsu, Y.; Kimuro, S.; Muramatsu, T.; Katsura, A.; Maishi, N.; Suzuki, H.I.; Inazawa, J.; Hida, K.; et al. Fibroblast growth factor signals regulate transforming growth factor-beta-induced endothelial-to-myofibroblast transition of tumor endothelial cells via Elk1. Mol. Oncol. 2019, 13, 1706–1724. [Google Scholar] [CrossRef] [PubMed]
  37. Lin, S.; Wang, X.; Pan, Y.; Tian, R.; Lin, B.; Jiang, G.; Chen, K.; He, Y.; Zhang, L.; Zhai, W.; et al. Transcription Factor Myeloid Zinc-Finger 1 Suppresses Human Gastric Carcinogenesis by Interacting with Metallothionein 2A. Clin. Cancer Res. 2019, 25, 1050–1062. [Google Scholar] [CrossRef]
  38. Brix, D.M.; Bundgaard Clemmensen, K.K.; Kallunki, T. Zinc Finger Transcription Factor MZF1-A Specific Regulator of Cancer Invasion. Cells 2020, 9, 223. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Schematic diagram of the EXOC4 structure. Notes: The linkage disequilibrium (LD) plot within +/−100 Kb of the EXOC4 gene was computed by Haploview. The color of each square from light to dark (white to red) indicates the degree of LD from low to high.
Figure 1. Schematic diagram of the EXOC4 structure. Notes: The linkage disequilibrium (LD) plot within +/−100 Kb of the EXOC4 gene was computed by Haploview. The color of each square from light to dark (white to red) indicates the degree of LD from low to high.
Animals 11 00521 g001
Figure 2. Descriptive statistics for phenotypes of Duroc pigs with three genotypes. (A) The descriptive statistics for genotypes of NBA and NW of the three phenotypes of Duroc pigs; (B) The descriptive statistics for genotypes of LWB and LWW of the three phenotypes of Duroc pigs. Notes: NBA—number of piglets born alive, LWB—litter weight at birth, LWW—litter weight at weaning, NW—number of piglets weaned.
Figure 2. Descriptive statistics for phenotypes of Duroc pigs with three genotypes. (A) The descriptive statistics for genotypes of NBA and NW of the three phenotypes of Duroc pigs; (B) The descriptive statistics for genotypes of LWB and LWW of the three phenotypes of Duroc pigs. Notes: NBA—number of piglets born alive, LWB—litter weight at birth, LWW—litter weight at weaning, NW—number of piglets weaned.
Animals 11 00521 g002
Figure 3. Sanger sequencing of SNP rs81471943 (C/T) on EXOC4. SNP rs81471943 (C/T) polymorphism locus is located at position 16,079,412 of chromosome 18, and the three genotypes were CC (A), CT (B), and TT (C), respectively. M1000: DNA marker of 1000 bp.
Figure 3. Sanger sequencing of SNP rs81471943 (C/T) on EXOC4. SNP rs81471943 (C/T) polymorphism locus is located at position 16,079,412 of chromosome 18, and the three genotypes were CC (A), CT (B), and TT (C), respectively. M1000: DNA marker of 1000 bp.
Animals 11 00521 g003
Figure 4. PCR-restriction fragment length polymorphism (RFLP) detection of rs81471943 in Duroc pigs. M1000: DNA marker of 1000 bp. Three genotypes were identified by BsrB I. PCR products with two digested fragments were CC genotype (565 bp + 75 bp); PCR products with three digested fragments were CT genotype (640 bp + 565 bp + 75 bp); and PCR products with one digested fragment were TT genotype (640 bp).
Figure 4. PCR-restriction fragment length polymorphism (RFLP) detection of rs81471943 in Duroc pigs. M1000: DNA marker of 1000 bp. Three genotypes were identified by BsrB I. PCR products with two digested fragments were CC genotype (565 bp + 75 bp); PCR products with three digested fragments were CT genotype (640 bp + 565 bp + 75 bp); and PCR products with one digested fragment were TT genotype (640 bp).
Animals 11 00521 g004
Figure 5. Transcription activity of the 5′ deletion fragment of the EXOC4 promoter. (A) PCR products of 5′ deletion fragments from EXOC4 promoter; (B) enzyme digestion identification of pGL3-vector with a deletion fragment of the EXOC4 promoter by restriction enzyme digestion; (C) the relative luciferase activity of the 5’ deletion fragment on the EXOC4 promoter. M5000: DNA marker of 5000 bp. ** indicates p < 0.01. Data are presented as means ± SD.
Figure 5. Transcription activity of the 5′ deletion fragment of the EXOC4 promoter. (A) PCR products of 5′ deletion fragments from EXOC4 promoter; (B) enzyme digestion identification of pGL3-vector with a deletion fragment of the EXOC4 promoter by restriction enzyme digestion; (C) the relative luciferase activity of the 5’ deletion fragment on the EXOC4 promoter. M5000: DNA marker of 5000 bp. ** indicates p < 0.01. Data are presented as means ± SD.
Animals 11 00521 g005
Figure 6. Transcription activity of the P2–P4 region of EXOC4. (A) PCR products of smaller 5′ deletion fragments from the promoter of EXOC4; (B) enzyme digestion identification of pGL3-vector with a further deletion fragment of the EXOC4 promoter; (C) the relative luciferase activity of a smaller 5’ deletion fragment on the EXOC4 promoter. M5000: DNA marker of 5000 bp. ** indicates p < 0.01. Data are presented as means ± SD.
Figure 6. Transcription activity of the P2–P4 region of EXOC4. (A) PCR products of smaller 5′ deletion fragments from the promoter of EXOC4; (B) enzyme digestion identification of pGL3-vector with a further deletion fragment of the EXOC4 promoter; (C) the relative luciferase activity of a smaller 5’ deletion fragment on the EXOC4 promoter. M5000: DNA marker of 5000 bp. ** indicates p < 0.01. Data are presented as means ± SD.
Animals 11 00521 g006
Figure 7. Transcriptional activity of different haplotypes at the binding region of EXOC4. The relative luciferase activity of EXOC4 with different haplotypes (HA-1 (GC), HA-2 (AC), HA-3 (GT), and HA-4 (GT)). ** indicates p < 0.01. Data are presented as means ± SD.
Figure 7. Transcriptional activity of different haplotypes at the binding region of EXOC4. The relative luciferase activity of EXOC4 with different haplotypes (HA-1 (GC), HA-2 (AC), HA-3 (GT), and HA-4 (GT)). ** indicates p < 0.01. Data are presented as means ± SD.
Animals 11 00521 g007
Table 1. Primers used in this study. SNP: single nucleotide polymorphism.
Table 1. Primers used in this study. SNP: single nucleotide polymorphism.
NamePrimer SequenceFragment
Length (bp)
EXOC4-SNPF: ACAGCCTCGGCTCAACCTTA640
R: TGCTTTTACGAAGGGGGACA
EXOC4-PromoterF: GAGCGAGTCCTTGTCTACAGT2791
R: TGCTTTTACGAAGGGGGACA
P0 (−2657/+134)F: CGACGCGTGAGCGAGTCCTTGTCTACAGT2791
R: CCCAAGCTTGCGCATTGGGGATTCTTACA
P1 (−2204/+134)F: CGACGCGTGGGAACTCGTTCTTTCCCCC2338
P2 (−1914/+134)F: CGACGCGTCCACTCGGACTGTCATCAGC2048
P3 (−1682/+134)F: CGACGCGTAAGATGGGAGATGGTTCGGG1816
P4 (−1323/+134)F: CGACGCGTGGATGGCTGGATTCCACACT1457
P5 (−886/+134)F: CGACGCGTTTTTACAGGTTACTGGTCAGACT1020
P6 (−518/+134)F: CGACGCGTATTTAATGTGCAGGACCATGCG652
P3A (−1826/+134)F: CGACGCGTATGGCTATGTCTAGCCTCCC1950
R: CCCAAGCTTGCGCATTGGGGATTCTTACA
P4A (−1551/+134)F: CGACGCGTACCAGCCACCTCACTTTTGA1685
P4B (−1225/+134)F: CGACGCGTTCATTGGGATGCTACCAGGC1359
Table 2. Genotype and allele frequency of SNP rs81471943 in the EXOC4 gene in Duroc pigs.
Table 2. Genotype and allele frequency of SNP rs81471943 in the EXOC4 gene in Duroc pigs.
GenotypeSample QuantityGenotype FrequencyAlleleAllele Frequencyχ2
CC7110.715C0.8440.224
CT2560.258T0.156
TT270.027
χ2 0.05 (2) = 5.99.
Table 3. Multiple comparisons between genotypes of SNP rs81471943 and estimated breeding values (EBVs) of reproductive traits in Duroc pigs.
Table 3. Multiple comparisons between genotypes of SNP rs81471943 and estimated breeding values (EBVs) of reproductive traits in Duroc pigs.
GenotypeGenotype Frequency (Number)NBA EBVLWB EBVNW EBVLWW EBV
CC0.715 (711)0.21 ± 0.19 a0.24 ± 0.31 ab0.61 ± 0.26 a6.06 ± 1.94 a
CT0.258 (256)0.17 ± 0.09 a0.12 ± 0.14 a0.36 ± 0.20 b3.66 ± 1.48 b
TT0.027 (27)0.12 ± 0.07 a0.38 ± 0.12 b0.53 ± 0.19 ab5.35 ± 1.43 ab
Notes: NBA—number of piglets born alive, LWB—litter weight at birth, LWW—litter weight at weaning, NW—number of piglets weaned. The multiple comparisons between the SNP genotype and EBVs of NBA, LWB, NW and LWW were calculated using the Tukey–Kramer method. The data used were the EBVs of least square means (LSM) ± standard errors (SE). The a, b, ab were multiple comparisons result of Tukey test. In same column, LSM ± SE of EBVs followed by different lowercase letters indicated significant difference (p < 0.05) and followed by same lowercase letters indicated no significant difference (p > 0.05).
Table 4. Relationship between Duroc pigs of different EXOC4 genotype with the SNP promoter.
Table 4. Relationship between Duroc pigs of different EXOC4 genotype with the SNP promoter.
HaplotypeHA-1HA-2HA-3HA-4
−1781GAGA
rs81471943CCTT
Table 5. Prediction of potential binding sites on −1781G/A.
Table 5. Prediction of potential binding sites on −1781G/A.
TFNucleotide LocationChainScoredPositionSequence Pattern
P53−1786–17770.796−1781AAGGAAGGTCA
ELK1−1785–17730.783−1781AACGTGAGGAAGGTC
MZF1−1787–1775+0.856−1781GTGAGGAGGGTCAT
Note: The mutation site is in bold.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

He, Y.; Zhou, X.; Zheng, R.; Jiang, Y.; Yao, Z.; Wang, X.; Zhang, Z.; Zhang, H.; Li, J.; Yuan, X. The Association of an SNP in the EXOC4 Gene and Reproductive Traits Suggests Its Use as a Breeding Marker in Pigs. Animals 2021, 11, 521. https://doi.org/10.3390/ani11020521

AMA Style

He Y, Zhou X, Zheng R, Jiang Y, Yao Z, Wang X, Zhang Z, Zhang H, Li J, Yuan X. The Association of an SNP in the EXOC4 Gene and Reproductive Traits Suggests Its Use as a Breeding Marker in Pigs. Animals. 2021; 11(2):521. https://doi.org/10.3390/ani11020521

Chicago/Turabian Style

He, Yingting, Xiaofeng Zhou, Rongrong Zheng, Yao Jiang, Zhixiang Yao, Xilong Wang, Zhe Zhang, Hao Zhang, Jiaqi Li, and Xiaolong Yuan. 2021. "The Association of an SNP in the EXOC4 Gene and Reproductive Traits Suggests Its Use as a Breeding Marker in Pigs" Animals 11, no. 2: 521. https://doi.org/10.3390/ani11020521

APA Style

He, Y., Zhou, X., Zheng, R., Jiang, Y., Yao, Z., Wang, X., Zhang, Z., Zhang, H., Li, J., & Yuan, X. (2021). The Association of an SNP in the EXOC4 Gene and Reproductive Traits Suggests Its Use as a Breeding Marker in Pigs. Animals, 11(2), 521. https://doi.org/10.3390/ani11020521

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop