The Association of an SNP in the EXOC4 Gene and Reproductive Traits Suggests Its Use as a Breeding Marker in Pigs
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Approval and Consent to Participate
2.2. Animals
2.3. Polymorphism Identification and Genotype with PCR-Restriction PCR-RFLP
2.4. Culture of Porcine Granulosa Cells (GCs) in Vitro
2.5. Construction of EXOC4 5′-Deletion Fragment Vectors
2.6. Luciferase Assay
2.7. Identification of SNP and Transcription Binding Sites
2.8. Statistical Analysis
3. Results
3.1. Polymorphisms of SNP rs81471943
3.2. Association Between SNP rs81471943 and Reproduction Traits
3.3. Isolation of SNP rs81471943 on EXOC4
3.4. Transcription Activity Analysis of the EXOC4 Promoter
3.5. Transcription Activity Analysis of Different Haplotypes of the EXOC4 Gene
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Diamond, J. Evolution, consequences and future of plant and animal domestication. Nature 2002, 418, 700–707. [Google Scholar] [CrossRef]
- Yang, Y.; Liu, C.; Adeola, A.C.; Sulaiman, X.; Xie, H.B.; Zhang, Y.P. Artificial selection drives differential gene expression during pig domestication. J. Genet. Genom. 2019, 46, 97–100. [Google Scholar] [CrossRef]
- Andersson, L. Domestic animals as models for biomedical research. Upsala J. Med. Sci. 2016, 121, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Goddard, M.E.; Hayes, B.J. Mapping genes for complex traits in domestic animals and their use in breeding programmes. Nat. Rev. Genet. 2009, 10, 381–391. [Google Scholar] [CrossRef]
- Zhuang, Z.; Ding, R.; Peng, L.; Wu, J.; Ye, Y.; Zhou, S.; Wang, X.; Quan, J.; Zheng, E.; Cai, G.; et al. Genome-wide association analyses identify known and novel loci for teat number in Duroc pigs using single-locus and multi-locus models. BMC Genom. 2020, 21, 344. [Google Scholar] [CrossRef] [PubMed]
- Fischer, D.; Laiho, A.; Gyenesei, A.; Sironen, A. Identification of Reproduction-Related Gene Polymorphisms Using Whole Transcriptome Sequencing in the Large White Pig Population. G3 (Bethesda) 2015, 5, 1351–1360. [Google Scholar] [CrossRef]
- Bjerre, D.; Madsen, L.B.; Mark, T.; Cirera, S.; Larsen, K.; Jorgensen, C.B.; Fredholm, M. Potential Role of the Porcine Superoxide Dismutase 1 (SOD1) Gene in Pig Reproduction. Anim. Biotechnol. 2013, 24, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Pugliese, C.; Sirtori, F. Quality of meat and meat products produced from southern European pig breeds. Meat Sci. 2012, 90, 511–518. [Google Scholar] [CrossRef]
- Matika, O.; Robledo, D.; Pong-Wong, R.; Bishop, S.C.; Riggio, V.; Finlayson, H.; Lowe, N.R.; Hoste, A.E.; Walling, G.A.; Del-Pozo, J.; et al. Balancing selection at a premature stop mutation in the myostatin gene underlies a recessive leg weakness syndrome in pigs. PLoS Genet. 2019, 15, e1007759. [Google Scholar] [CrossRef]
- Stafuzza, N.B.; Silva, R.M.O.; Fragomeni, B.O.; Masuda, Y.; Huang, Y.; Gray, K.; Lourenco, D.A.L. A genome-wide single nucleotide polymorphism and copy number variation analysis for number of piglets born alive. BMC Genom. 2019, 20, 321. [Google Scholar] [CrossRef]
- Zheng, X.; Zhao, P.; Yang, K.; Ning, C.; Wang, H.; Zhou, L.; Liu, J. CNV analysis of Meishan pig by next-generation sequencing and effects of AHR gene CNV on pig reproductive traits. J. Anim. Sci. Biotechnol. 2020, 11, 42. [Google Scholar] [CrossRef] [PubMed]
- Sell-Kubiak, E.; Duijvesteijn, N.; Lopes, M.S.; Janss, L.L.; Knol, E.F.; Bijma, P.; Mulder, H.A. Genome-wide association study reveals novel loci for litter size and its variability in a Large White pig population. BMC Genom. 2015, 16, 1049. [Google Scholar] [CrossRef] [PubMed]
- Ernst, C.W.; Steibel, J.P. Molecular advances in QTL discovery and application in pig breeding. Trends Genet. 2013, 29, 215–224. [Google Scholar] [CrossRef]
- Hu, Z.L.; Park, C.A.; Reecy, J.M. Building a livestock genetic and genomic information knowledgebase through integrative developments of Animal QTLdb and CorrDB. Nucleic Acids Res. 2019, 47, D701–D710. [Google Scholar] [CrossRef]
- Goncharenko-Khaider, N.; Matte, I.; Lane, D.; Rancourt, C.; Piche, A. Ovarian cancer ascites increase Mcl-1 expression in tumor cells through ERK1/2-Elk-1 signaling to attenuate TRAIL-induced apoptosis. Mol. Cancer 2012, 11, 84. [Google Scholar] [CrossRef] [PubMed]
- Hernandez, S.C.; Finlayson, H.A.; Ashworth, C.J.; Haley, C.S.; Archibald, A.L. A genome-wide linkage analysis for reproductive traits in F2 Large White x Meishan cross gilts. Anim. Genet. 2014, 45, 191–197. [Google Scholar] [CrossRef] [PubMed]
- Tribout, T.; Iannuccelli, N.; Druet, T.; Gilbert, H.; Riquet, J.; Gueblez, R.; Mercat, M.J.; Bidanel, J.P.; Milan, D.; Le Roy, P. Detection of quantitative trait loci for reproduction and production traits in Large White and French Landrace pig populations. Genet. Sel. Evol. 2008, 40, 61–78. [Google Scholar] [CrossRef]
- Duijvesteijn, N.; Veltmaat, J.M.; Knol, E.F.; Harlizius, B. High-resolution association mapping of number of teats in pigs reveals regions controlling vertebral development. BMC Genom. 2014, 15, 542. [Google Scholar] [CrossRef]
- Schiller, J.T.; Day, P.M.; Kines, R.C. Current understanding of the mechanism of HPV infection. Gynecol. Oncol. 2010, 118, S12–S17. [Google Scholar] [CrossRef]
- Tanaka, T.; Goto, K.; Iino, M. Sec8 modulates TGF-beta induced EMT by controlling N-cadherin via regulation of Smad3/4. Cell. Signal. 2017, 29, 115–126. [Google Scholar] [CrossRef]
- Nagase, T.; Kikuno, R.; Hattori, A.; Kondo, Y.; Okumura, K.; Ohara, O. Prediction of the coding sequences of unidentified human genes. XIX. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res. 2000, 7, 347–355. [Google Scholar] [CrossRef] [PubMed]
- Jiao, H.; Zang, Y.; Zhang, M.; Zhang, Y.; Wang, Y.; Wang, K.; Price, R.A.; Li, W.D. Genome-Wide Interaction and Pathway Association Studies for Body Mass Index. Front. Genet. 2019, 10, 404. [Google Scholar] [CrossRef]
- Zhong, Y.; Li, L.; He, Y.; He, B.; Li, Z.; Zhang, Z.; Zhang, H.; Yuan, X.; Li, J. Activation of Steroidogenesis, Anti-Apoptotic Activity, and Proliferation in Porcine Granulosa Cells by RUNX1 Is Negatively Regulated by H3K27me3 Transcriptional Repression. Genes 2020, 11, 495. [Google Scholar] [CrossRef]
- Henderson, C.R. Best linear unbiased estimation and prediction under a selection model. Biometrics 1975, 31, 423–447. [Google Scholar] [CrossRef]
- Lipschutz, J.H.; Mostov, K.E. Exocytosis: The many masters of the exocyst. Curr. Biol. 2002, 12, R212–R214. [Google Scholar] [CrossRef]
- Barkefors, I.; Fuchs, P.F.; Heldin, J.; Bergstrom, T.; Forsberg-Nilsson, K.; Kreuger, J. Exocyst complex component 3-like 2 (EXOC3L2) associates with the exocyst complex and mediates directional migration of endothelial cells. J. Biol. Chem. 2011, 286, 24189–24199. [Google Scholar] [CrossRef]
- Gan, Q.; Li, Y.; Liu, Q.; Lund, M.; Su, G.; Liang, X. Genome-wide association studies for the concentrations of insulin, triiodothyronine, and thyroxine in Chinese Holstein cattle. Trop. Anim. Health Prod. 2020, 52, 1655–1660. [Google Scholar] [CrossRef]
- Gao, Y.; Hu, X.X.; Du, Z.Q.; Deng, X.M.; Huang, Y.H.; Fei, J.; Feng, J.D.; Liu, Z.L.; Da, Y.; Li, N. A genome scan for quantitative trait loci associated with body weight at different developmental stages in chickens. Anim. Genet. 2006, 37, 276–278. [Google Scholar] [CrossRef] [PubMed]
- Nadaf, J.; Pitel, F.; Gilbert, H.; Duclos, M.J.; Vignoles, F.; Beaumont, C.; Vignal, A.; Porter, T.E.; Cogburn, L.A.; Aggrey, S.E.; et al. QTL for several metabolic traits map to loci controlling growth and body composition in an F2 intercross between high- and low-growth chicken lines. Physiol. Genom. 2009, 38, 241–249. [Google Scholar] [CrossRef] [PubMed]
- Park, H.B.; Jacobsson, L.; Wahlberg, P.; Siegel, P.B.; Andersson, L. QTL analysis of body composition and metabolic traits in an intercross between chicken lines divergently selected for growth. Physiol. Genom. 2006, 25, 216–223. [Google Scholar] [CrossRef]
- Ogawa, S.; Konta, A.; Kimata, M.; Ishii, K.; Uemoto, Y.; Satoh, M. Estimation of genetic parameters for farrowing traits in purebred Landrace and Large White pigs. Anim. Sci. J. 2019, 90, 23–28. [Google Scholar] [CrossRef]
- Charlesworth, B. Fundamental concepts in genetics: Effective population size and patterns of molecular evolution and variation. Nat. Rev. Genet. 2009, 10, 195–205. [Google Scholar] [CrossRef] [PubMed]
- Yuan, X.; Li, Z.; Kong, Y.; Zhong, Y.; He, Y.; Zhang, A.; Zhou, X.; Jiang, Y.; Zhang, Z.; Zhang, H.; et al. P65 Targets FGFR1 to Regulate the Survival of Ovarian Granulosa Cells. Cells 2019, 8, 1334. [Google Scholar] [CrossRef] [PubMed]
- McKinley, K.L.; Cheeseman, I.M. Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev. Cell 2017, 40, 405–420.e402. [Google Scholar] [CrossRef] [PubMed]
- Zhu, R.X.; Cheng, A.S.L.; Chan, H.L.Y.; Yang, D.Y.; Seto, W.K. Growth arrest-specific gene 2 suppresses hepatocarcinogenesis by intervention of cell cycle and p53-dependent apoptosis. World J. Gastroenterol. 2019, 25, 4715–4726. [Google Scholar] [CrossRef] [PubMed]
- Akatsu, Y.; Takahashi, N.; Yoshimatsu, Y.; Kimuro, S.; Muramatsu, T.; Katsura, A.; Maishi, N.; Suzuki, H.I.; Inazawa, J.; Hida, K.; et al. Fibroblast growth factor signals regulate transforming growth factor-beta-induced endothelial-to-myofibroblast transition of tumor endothelial cells via Elk1. Mol. Oncol. 2019, 13, 1706–1724. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.; Wang, X.; Pan, Y.; Tian, R.; Lin, B.; Jiang, G.; Chen, K.; He, Y.; Zhang, L.; Zhai, W.; et al. Transcription Factor Myeloid Zinc-Finger 1 Suppresses Human Gastric Carcinogenesis by Interacting with Metallothionein 2A. Clin. Cancer Res. 2019, 25, 1050–1062. [Google Scholar] [CrossRef]
- Brix, D.M.; Bundgaard Clemmensen, K.K.; Kallunki, T. Zinc Finger Transcription Factor MZF1-A Specific Regulator of Cancer Invasion. Cells 2020, 9, 223. [Google Scholar] [CrossRef] [PubMed]







| Name | Primer Sequence | Fragment Length (bp) |
|---|---|---|
| EXOC4-SNP | F: ACAGCCTCGGCTCAACCTTA | 640 |
| R: TGCTTTTACGAAGGGGGACA | ||
| EXOC4-Promoter | F: GAGCGAGTCCTTGTCTACAGT | 2791 |
| R: TGCTTTTACGAAGGGGGACA | ||
| P0 (−2657/+134) | F: CGACGCGTGAGCGAGTCCTTGTCTACAGT | 2791 |
| R: CCCAAGCTTGCGCATTGGGGATTCTTACA | ||
| P1 (−2204/+134) | F: CGACGCGTGGGAACTCGTTCTTTCCCCC | 2338 |
| P2 (−1914/+134) | F: CGACGCGTCCACTCGGACTGTCATCAGC | 2048 |
| P3 (−1682/+134) | F: CGACGCGTAAGATGGGAGATGGTTCGGG | 1816 |
| P4 (−1323/+134) | F: CGACGCGTGGATGGCTGGATTCCACACT | 1457 |
| P5 (−886/+134) | F: CGACGCGTTTTTACAGGTTACTGGTCAGACT | 1020 |
| P6 (−518/+134) | F: CGACGCGTATTTAATGTGCAGGACCATGCG | 652 |
| P3A (−1826/+134) | F: CGACGCGTATGGCTATGTCTAGCCTCCC | 1950 |
| R: CCCAAGCTTGCGCATTGGGGATTCTTACA | ||
| P4A (−1551/+134) | F: CGACGCGTACCAGCCACCTCACTTTTGA | 1685 |
| P4B (−1225/+134) | F: CGACGCGTTCATTGGGATGCTACCAGGC | 1359 |
| Genotype | Sample Quantity | Genotype Frequency | Allele | Allele Frequency | χ2 |
|---|---|---|---|---|---|
| CC | 711 | 0.715 | C | 0.844 | 0.224 |
| CT | 256 | 0.258 | T | 0.156 | |
| TT | 27 | 0.027 |
| Genotype | Genotype Frequency (Number) | NBA EBV | LWB EBV | NW EBV | LWW EBV |
|---|---|---|---|---|---|
| CC | 0.715 (711) | 0.21 ± 0.19 a | 0.24 ± 0.31 ab | 0.61 ± 0.26 a | 6.06 ± 1.94 a |
| CT | 0.258 (256) | 0.17 ± 0.09 a | 0.12 ± 0.14 a | 0.36 ± 0.20 b | 3.66 ± 1.48 b |
| TT | 0.027 (27) | 0.12 ± 0.07 a | 0.38 ± 0.12 b | 0.53 ± 0.19 ab | 5.35 ± 1.43 ab |
| Haplotype | HA-1 | HA-2 | HA-3 | HA-4 |
|---|---|---|---|---|
| −1781 | G | A | G | A |
| rs81471943 | C | C | T | T |
| TF | Nucleotide Location | Chain | Scored | Position | Sequence Pattern |
|---|---|---|---|---|---|
| P53 | −1786–1777 | − | 0.796 | −1781A | AGGAAGGTCA |
| ELK1 | −1785–1773 | − | 0.783 | −1781A | ACGTGAGGAAGGTC |
| MZF1 | −1787–1775 | + | 0.856 | −1781G | TGAGGAGGGTCAT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, Y.; Zhou, X.; Zheng, R.; Jiang, Y.; Yao, Z.; Wang, X.; Zhang, Z.; Zhang, H.; Li, J.; Yuan, X. The Association of an SNP in the EXOC4 Gene and Reproductive Traits Suggests Its Use as a Breeding Marker in Pigs. Animals 2021, 11, 521. https://doi.org/10.3390/ani11020521
He Y, Zhou X, Zheng R, Jiang Y, Yao Z, Wang X, Zhang Z, Zhang H, Li J, Yuan X. The Association of an SNP in the EXOC4 Gene and Reproductive Traits Suggests Its Use as a Breeding Marker in Pigs. Animals. 2021; 11(2):521. https://doi.org/10.3390/ani11020521
Chicago/Turabian StyleHe, Yingting, Xiaofeng Zhou, Rongrong Zheng, Yao Jiang, Zhixiang Yao, Xilong Wang, Zhe Zhang, Hao Zhang, Jiaqi Li, and Xiaolong Yuan. 2021. "The Association of an SNP in the EXOC4 Gene and Reproductive Traits Suggests Its Use as a Breeding Marker in Pigs" Animals 11, no. 2: 521. https://doi.org/10.3390/ani11020521
APA StyleHe, Y., Zhou, X., Zheng, R., Jiang, Y., Yao, Z., Wang, X., Zhang, Z., Zhang, H., Li, J., & Yuan, X. (2021). The Association of an SNP in the EXOC4 Gene and Reproductive Traits Suggests Its Use as a Breeding Marker in Pigs. Animals, 11(2), 521. https://doi.org/10.3390/ani11020521

