In Vitro Maturation of Cumulus–Oocyte Complexes and In Vitro Sperm Capacitation Significantly Increase the Expression and Enhance the Location of the CXCL12 and CXCR4 Anchoring Attractant Complex in Pigs
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Experimental Design
2.3. Oocyte Collection and In Vitro Maturation
2.4. Cumulus Cells Handling
2.5. Sperm Handling and In Vitro Capacitation
2.6. RNA Isolation and Reverse Transcription
2.7. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
2.8. Immunofluorescence and Confocal Microscopy
2.9. Statistical Analyses
3. Results
3.1. The CXCL12 Gene Is Overexpressed in Mature Cumulus Cells and the CXCR4 Gene Is Overexpressed in Capacitated Spermatozoa
3.2. CXCL12 Is Localized in the Cytoplasm of Cumulus Cells Surrounding Mature Oocytes
3.3. CXR4 Is Localized in the Sperm Midpiece and Principal Piece in Uncapacitated Spermatozoa and Also in the Sperm Head of Capacitated Spermatozoa
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Martinez, C.A.; Alvarez-Rodriguez, M.; Wright, D.; Rodriguez-Martinez, H. Does the Pre-Ovulatory Pig Oviduct Rule Sperm Capacitation In Vivo Mediating Transcriptomics of Catsper Channels? Int. J. Mol. Sci. 2020, 21, 1840. [Google Scholar] [CrossRef] [Green Version]
- Rodríguez-Martínez, H.; Saravia, F.; Wallgren, M.; Tienthai, P.; Johannisson, A.; Vázquez, J.M.; Martínez, E.; Roca, J.; Sanz, L.; Calvete, J.J. Boar spermatozoa in the oviduct. In Theriogenology; Elsevier Inc.: Amsterdam, The Netherlands, 2005; Volume 63, pp. 514–535. [Google Scholar]
- De Lisa, E.; Salzano, A.M.; Moccia, F.; Scaloni, A.; Di Cosmo, A. Sperm-attractant peptide influences the spermatozoa swimming behavior in internal fertilization in Octopus vulgaris. J. Exp. Biol. 2013, 216, 2229–2237. [Google Scholar] [CrossRef] [Green Version]
- Guidobaldi, H.A.; Teves, M.E.; Uñates, D.R.; Anastasía, A.; Giojalas, L.C. Progesterone from the cumulus cells is the sperm chemoattractant secreted by the rabbit oocyte cumulus complex. PLoS ONE 2008, 3, e3040. [Google Scholar] [CrossRef]
- Giojalas, L.C.; Guidobaldi, H.A. Getting to and away from the egg, an interplay between several sperm transport mechanisms and a complex oviduct physiology. Mol. Cell. Endocrinol. 2020, 518, 110954. [Google Scholar] [CrossRef]
- Blengini, C.S.; Teves, M.E.; Uñates, D.R.; Guidobaldi, H.A.; Gatica, L.V.; Giojalas, L.C. Human sperm pattern of movement during chemotactic re-orientation towards a progesterone source. Asian J. Androl. 2011, 13, 769–773. [Google Scholar] [CrossRef] [Green Version]
- Lymbery, R.A.; Kennington, W.J.; Evans, J.P. Egg chemoattractants moderate intraspecific sperm competition. Evol. Lett. 2017, 1, 317–327. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yokoo, M.; Sato, E. Cumulus-oocyte complex interactions during oocyte maturation. Int. Rev. Cytol. 2004, 235, 251–291. [Google Scholar] [PubMed]
- Suzuki, H.; Saito, Y. Cumulus cells affect distribution and function of the cytoskeleton and organelles in porcine oocytes. Reprod. Med. Biol. 2006, 5, 183–194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yurewicz, E.C.; Sacco, A.G.; Gupta, S.K.; Xu, N.; Gage, D.A. Hetero-oligomerization-dependent binding of pig oocyte zona pellucida glycoproteins ZPB and ZPC to boar sperm membrane vesicles. J. Biol. Chem. 1998, 273, 7488–7494. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blobel, C.P. Functional processing of fertilin: Evidence for a critical role of proteolysis in sperm maturation and activation. Rev. Reprod. 2000, 5, 75–83. [Google Scholar] [CrossRef] [PubMed]
- Kudo, K.; Yonezawa, N.; Katsumata, T.; Aoki, H.; Nakano, M. Localization of carbohydrate chains of pig sperm ligand in the glycoprotein ZPB of egg zona pellucida. Eur. J. Biochem. 1998, 252, 492–499. [Google Scholar] [CrossRef] [PubMed]
- Linfor, J.; Berger, T. Potential role of alphav and beta1 integrins as oocyte adhesion molecules during fertilization in pigs. J. Reprod. Fertil. 2000, 120, 65–72. [Google Scholar] [CrossRef] [PubMed]
- Esencay, M.; Sarfraz, Y.; Zagzag, D. CXCR7 is induced by hypoxia and mediates glioma cell migration towards SDF-1α. BMC Cancer 2013, 13, 347. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, L.; Li, X.; Zhao, Y.; Fang, C.; Lian, Y.; Gou, W.; Han, T.; Zhu, X. Insights into the mechanism of CXCL12-mediated signaling in trophoblast functions and placental angiogenesis. Acta Biochim. Biophys. Sin. 2015, 47, 663–672. [Google Scholar] [CrossRef]
- Piao, H.-L.; Wang, S.-C.; Tao, Y.; Fu, Q.; Du, M.-R.; Li, D.-J. CXCL12/CXCR4 signal involved in the regulation of trophoblasts on peripheral NK cells leading to Th2 bias at the maternal-fetal interface. Eur. Rev. Med. Pharmacol. Sci. 2015, 19, 2153–2161. [Google Scholar] [CrossRef]
- Zhou, W.-H.; Wu, X.; Hu, W.-D.; Du, M.-R. Co-expression of CXCR4 and CXCR7 in human endometrial stromal cells is modulated by steroid hormones. Int. J. Clin. Exp. Pathol. 2015, 8, 2449–2460. [Google Scholar]
- Złotkowska, A.; Andronowska, A. Chemokines as the modulators of endometrial epithelial cells remodelling. Sci. Rep. 2019, 9, 12968. [Google Scholar] [CrossRef]
- Zhou, W.-H.; Du, M.-R.; Dong, L.; Yu, J.; Li, D.-J. Chemokine CXCL12 promotes the cross-talk between trophoblasts and decidual stromal cells in human first-trimester pregnancy. Hum. Reprod. 2008, 23, 2669–2679. [Google Scholar] [CrossRef] [Green Version]
- Runyan, C.L.; McIntosh, S.Z.; Maestas, M.M.; Quinn, K.E.; Boren, B.P.; Ashley, R.L. CXCR4 signaling at the ovine fetal-maternal interface regulates vascularization, CD34+ cell presence, and autophagy in the endometrium. Biol. Reprod. 2019, 101, 102–111. [Google Scholar] [CrossRef]
- Sugiyama, H.; Chandler, D.E. Sperm guidance to the egg finds calcium at the helm. Protoplasma 2014, 251, 461–475. [Google Scholar] [CrossRef]
- Umezu, K.; Hara, K.; Hiradate, Y.; Numabe, T.; Tanemura, K. Stromal cell-derived factor 1 regulates in vitro sperm migration towards the cumulus-oocyte complex in cattle. PLoS ONE 2020, 15, e0232536. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.-N.; Pang, B.; Xu, S.-R.; Wan, P.-C.; Guo, S.-C.; Ji, H.-Z.; Jia, G.-X.; Hu, L.-Y.; Zhao, X.-Q.; Yang, Q.-E. The CXCL12-CXCR4 signaling promotes oocyte maturation by regulating cumulus expansion in sheep. Theriogenology 2018, 107, 85–94. [Google Scholar] [CrossRef] [PubMed]
- Zuccarello, D.; Ferlin, A.; Garolla, A.; Menegazzo, M.; Perilli, L.; Ambrosini, G.; Foresta, C. How the human spermatozoa sense the oocyte: A new role of SDF1-CXCR4 signalling. Int. J. Androl. 2011, 34, e554–e565. [Google Scholar] [CrossRef] [PubMed]
- Martinez, C.A.; Rubér, M.; Rodriguez-Martinez, H.; Alvarez-Rodriguez, M. Pig Pregnancies after Transfer of Allogeneic Embryos Show a Dysregulated Endometrial/Placental Cytokine Balance: A Novel Clue for Embryo Death? Biomolecules 2020, 10, 554. [Google Scholar] [CrossRef] [Green Version]
- Tejerina, F.; Buranaamnuay, K.; Saravia, F.; Wallgren, M.; Rodriguez-Martinez, H. Assessment of motility of ejaculated, liquid-stored boar spermatozoa using computerized instruments. Theriogenology 2008, 69, 1129–1138. [Google Scholar] [CrossRef]
- Álvarez-Rodriguez, M.; Vicente-Carrillo, A.; Rodriguez-Martinez, H. Hyaluronan improves neither the long-term storage nor the cryosurvival of liquid-stored CD44-bearing AI boar spermatozoa. J. Reprod. Dev. 2018, 64, 351–360. [Google Scholar] [CrossRef] [Green Version]
- Hossain, M.S.; Johannisson, A.; Siqueira, A.P.; Wallgren, M.; Rodriguez-Martinez, H. Spermatozoa in the sperm-peak-fraction of the boar ejaculate show a lower flow of Ca(2+) under capacitation conditions post-thaw which might account for their higher membrane stability after cryopreservation. Anim. Reprod. Sci. 2011, 128, 37–44. [Google Scholar] [CrossRef] [Green Version]
- Untergasser, A.; Nijveen, H.; Rao, X.; Bisseling, T.; Geurts, R.; Leunissen, J.A.M. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 2007, 35, W71–W74. [Google Scholar] [CrossRef] [Green Version]
- Rodriguez-Martinez, H. Role of the oviduct in sperm capacitation. Theriogenology 2007, 68 (Suppl. 1), S138–S146. [Google Scholar] [CrossRef]
- Vaughan, D.A.; Sakkas, D. Sperm selection methods in the 21st century. Biol. Reprod. 2019, 101, 1076–1082. [Google Scholar] [CrossRef]
- Satake, N.; Elliott, R.M.A.; Watson, P.F.; Holt, W. V Sperm selection and competition in pigs may be mediated by the differential motility activation and suppression of sperm subpopulations within the oviduct. J. Exp. Biol. 2006, 209, 1560–1572. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Riffell, J.A.; Krug, P.J.; Zimmer, R.K. The ecological and evolutionary consequences of sperm chemoattraction. Proc. Natl. Acad. Sci. USA 2004, 101, 4501–4506. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fitzpatrick, J.L.; Lüpold, S. Sexual selection and the evolution of sperm quality. Mol. Hum. Reprod. 2014, 20, 1180–1189. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Villanueva-Diaz, C.; Vadillo-Ortega, F.; Kably-Ambe, A.; Diaz-Pérez, M.A.; Krivitzky, S.K. Evidence that human follicular fluid contains a chemoattractant for spermatozoa. Fertil. Steril. 1990, 54, 1180–1182. [Google Scholar] [CrossRef]
- Tacconis, P.; Revelli, A.; Massobrio, M.; Battista La Sala, G.; Tesarik, J. Chemotactic responsiveness of human spermatozoa to follicular fluid is enhanced by capacitation but is impaired in dyspermic semen. J. Assist. Reprod. Genet. 2001, 18, 36–44. [Google Scholar] [CrossRef]
- Budna, J.; Chachuła, A.; Kaźmierczak, D.; Rybska, M.; Ciesiółka, S.; Bryja, A.; Kranc, W.; Borys, S.; Żok, A.; Bukowska, D.; et al. Morphogenesis-related gene-expression profile in porcine oocytes before and after in vitro maturation. Zygote 2017, 25, 331–340. [Google Scholar] [CrossRef]
- Budna, J.; Bryja, A.; Celichowski, P.; Kahan, R.; Kranc, W.; Ciesiółka, S.; Rybska, M.; Borys, S.; Jeseta, M.; Bukowska, D.; et al. Genes of cellular components of morphogenesis in porcine oocytes before and after IVM. Reproduction 2017, 154, 535–545. [Google Scholar] [CrossRef]
- Holt, J.E.; Jackson, A.; Roman, S.D.; Aitken, R.J.; Koopman, P.; McLaughlin, E.A. CXCR4/SDF1 interaction inhibits the primordial to primary follicle transition in the neonatal mouse ovary. Dev. Biol. 2006, 293, 449–460. [Google Scholar] [CrossRef] [Green Version]
- Skinner, M.K.; Schmidt, M.; Savenkova, M.I.; Sadler-Riggleman, I.; Nilsson, E.E. Regulation of granulosa and theca cell transcriptomes during ovarian antral follicle development. Mol. Reprod. Dev. 2008, 75, 1457–1472. [Google Scholar] [CrossRef] [Green Version]
- Sayasith, K.; Sirois, J. Expression and regulation of stromal cell-derived factor-1 (SDF1) and chemokine CXC motif receptor 4 (CXCR4) in equine and bovine preovulatory follicles. Mol. Cell. Endocrinol. 2014, 391, 10–21. [Google Scholar] [CrossRef]
- Martinez, C.A.; Nohalez, A.; Ceron, J.J.; Rubio, C.P.; Roca, J.; Cuello, C.; Rodriguez-Martinez, H.; Martinez, E.A.; Gil, M.A. Peroxidized mineral oil increases the oxidant status of culture media and inhibits in vitro porcine embryo development. Theriogenology 2017, 103, 17–23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hunter, R.H.F.; Rodriguez-Martinez, H. Analysing mammalian fertilisation: Reservations and potential pitfalls with an in vitro approach. Zygote 2002, 10, 11–15. [Google Scholar] [CrossRef] [PubMed]
- Nagasawa, T. A chemokine, SDF-1/PBSF, and its receptor, CXC chemokine receptor 4, as mediators of hematopoiesis. Int. J. Hematol. 2000, 72, 408–411. [Google Scholar] [PubMed]
- Walenkamp, A.M.E.; Lapa, C.; Herrmann, K.; Wester, H.-J. CXCR4 Ligands: The Next Big Hit? J. Nucl. Med. 2017, 58, 77S–82S. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leahy, T.; Gadella, B.M. New insights into the regulation of cholesterol efflux from the sperm membrane. Asian J. Androl. 2015, 17, 561–567. [Google Scholar] [PubMed]
- Zigo, M.; Manaskova-Postlerova, P.; Jonakova, V.; Kerns, K.; Sutovsky, P. Compartmentalization of the proteasome-interacting proteins during sperm capacitation. Sci. Rep. 2019, 9, 12583. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.; Sha, W.; Zhou, W. Expressions of chemokine CXCL12 and its receptor CXCR4 in human sperm. Zhonghua Nan Ke Xue= Natl. J. Androl. 2015, 21, 225–228. [Google Scholar]
GENE | Forward (5′→3′) | Reverse (5′→3′) | Size | Efficiency (%) | Reference |
---|---|---|---|---|---|
CXCL12 | TAAACAAACCCAGTCCCACTCTC | AGGAAATAAACATCCCGCCGT | 115 | 94.1 | NC_027311.1 |
CXCR4 | TGGACGGGTTCCGTATATTCAC | GAAATGGGCATTTTCCTCCCG | 110 | 93.4 | NC_010457.5 |
GAPDH | ATCACTGCCACCCAGAAGAC | AGATCCACAACCGACACGTT | 194 | 96 | NM_001206359 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martinez, C.A.; Alvarez-Rodriguez, M.; Casado-Bedmar, M.; Rodriguez-Martinez, H. In Vitro Maturation of Cumulus–Oocyte Complexes and In Vitro Sperm Capacitation Significantly Increase the Expression and Enhance the Location of the CXCL12 and CXCR4 Anchoring Attractant Complex in Pigs. Animals 2021, 11, 153. https://doi.org/10.3390/ani11010153
Martinez CA, Alvarez-Rodriguez M, Casado-Bedmar M, Rodriguez-Martinez H. In Vitro Maturation of Cumulus–Oocyte Complexes and In Vitro Sperm Capacitation Significantly Increase the Expression and Enhance the Location of the CXCL12 and CXCR4 Anchoring Attractant Complex in Pigs. Animals. 2021; 11(1):153. https://doi.org/10.3390/ani11010153
Chicago/Turabian StyleMartinez, Cristina A., Manuel Alvarez-Rodriguez, Maite Casado-Bedmar, and Heriberto Rodriguez-Martinez. 2021. "In Vitro Maturation of Cumulus–Oocyte Complexes and In Vitro Sperm Capacitation Significantly Increase the Expression and Enhance the Location of the CXCL12 and CXCR4 Anchoring Attractant Complex in Pigs" Animals 11, no. 1: 153. https://doi.org/10.3390/ani11010153