Effect of the Source of Zinc on the Tissue Accumulation of Zinc and Jejunal Mucosal Zinc Transporter Expression in Holstein Dairy Calves
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals, Diets, and Experimental Design
2.2. Sampling and Analysis
2.3. Statistical Analysis
3. Results
3.1. Growth Performance and Incidence of Diarrhea
3.2. Serum and Hepatic Micronutrient Concentrations
3.3. Serum Zinc-Dependent Protein Concentrations
3.4. RNA Expression of Jejunal Mucosal Zinc Transporters
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Pempek, J.A.; Watkins, L.R.; Bruner, C.E.; Habing, G.G. A multisite, randomized field trial to evaluate the influence of lactoferrin on the morbidity and mortality of dairy calves with diarrhea. J. Dairy Sci. 2019, 102, 9259–9267. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, C.H.; Xiao, K.; Song, J.; Luan, Z.S. Effects of zinc oxide supported on zeolite on growth performance, intestinal microflora and permeability, and cytokines expression of weaned pigs. Anim. Feed Sci. Technol. 2013, 181, 65–71. [Google Scholar] [CrossRef]
- Vallee, B.L.; Falchuk, K.H. The biochemical basis of zinc physiology. Physiol. Rev. 1993, 73, 79–118. [Google Scholar] [CrossRef] [PubMed]
- Liberato, S.C.; Singh, G.; Mulholland, K. Zinc supplementation in young children: A review of the literature focusing on diarrhoea prevention and treatment. Clin. Nutr. 2015, 34, 181–188. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Valenzano, M.C.; Mercado, J.M.; Zurbach, E.P.; Mullin, J.M. Zinc supplementation modifies tight junctions and alters barrier function of Caco-2 human intestinal epithelial layers. Dig. Dis. Sci. 2013, 58, 77–87. [Google Scholar] [CrossRef] [PubMed]
- Wei, J.Y.; Ma, F.T.; Hao, L.Y.; Shan, Q.; Sun, P. Effect of differing amounts of zinc oxide supplementation on the antioxidant status and zinc metabolism in newborn dairy calves. Livest. Sci. 2019, 230, 103819. [Google Scholar] [CrossRef]
- Chang, M.N.; Wei, J.Y.; Hao, L.Y.; Ma, F.T.; Li, H.Y.; Zhao, S.G.; Sun, P. Effects of different types of zinc supplement on the growth, incidence of diarrhea, immune function, and rectal microbiota of newborn dairy calves. J. Dairy Sci. 2020, 103, 6100–6113. [Google Scholar] [CrossRef]
- Feldmann, H.R.; Williams, D.R.; Champagne, J.D.; Lehenbauer, T.W.; Aly, S.S. Effectiveness of zinc supplementation on diarrhea and average daily gain in pre-weaned dairy calves: A double-blind, block-randomized, placebo-controlled clinical trial. PLoS ONE 2019, 14, e0219321. [Google Scholar] [CrossRef] [Green Version]
- Glover, A.D.; Puschner, B.; Rossow, H.A.; Lehenbauer, T.W.; Champagne, J.D.; Blanchard, P.C.; Aly, S.S. A double-blind block randomized clinical trial on the effect of zinc as a treatment for diarrhea in neonatal Holstein calves under natural challenge conditions. Prev. Vet. Med. 2013, 112, 338–347. [Google Scholar] [CrossRef] [Green Version]
- Teixeira, A.G.V.; Stephens, L.; Divers, T.J.; Stokol, T.; Bicalho, R.C. Effect of crofelemer extract on severity and consistency of experimentally induced enterotoxigenic Escherichia coli diarrhea in newborn Holstein calves. J. Dairy Sci. 2015, 98, 8035–8043. [Google Scholar] [CrossRef] [Green Version]
- Garg, A.K.; Vishal, M.; Dass, R.S. Effect of organic zinc supplementasion on growth, nutrient utilization and mineral profile in lambs. Anim. Feed Sci. Technol. 2008, 144, 82–96. [Google Scholar] [CrossRef]
- El-Nour, H.H.M.; Rahman, H.M.A.A.; Elwakeel, S.A. Effect of zinc-methionine supplementation on reproductive performance, kid’s performance, minerals profile and milk quality in early lactating Baladi goats. World Appl. Sci. J. 2010, 9, 275–282. [Google Scholar]
- Hill, G.M.; Mahan, D.C.; Jolliff, J.S. Comparison of organic and inorganic zinc sources to maximize growth and meet the zinc needs of the nursery pig. J. Anim. Sci. 2014, 92, 1582–1594. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tucker, A.L.; Farzan, A.; Cassar, G.; Friendship, R.M. Effect of in-water iodine supplementation on weight gain, diarrhea and oral and dental health of nursery pigs. Can. J. Vet. Res. 2011, 75, 192–297. [Google Scholar]
- Wang, Y.; Gao, Y.; Liu, Q.; Zhan, X.; Li, Z.; Hu, H.; Li, T.; Chen, J. Effect of vitamin A and Zn supplementation on indices of vitamin A status, haemoglobin level and defecation of children with persistent diarrhea. J. Clin. Biochem. Nutr. 2016, 59, 58–64. [Google Scholar] [CrossRef] [Green Version]
- Deng, B.; Zhou, X.; Wu, J.; Long, C.; Yao, Y.; Peng, H.; Wan, D.; Wu, X. Effects of dietary supplementation with tribasic zinc sulfate or zinc sulfate on growth performance, zinc content and expression of zinc transporters in young pigs. Anim. Sci. J. 2017, 88, 1556–1560. [Google Scholar] [CrossRef]
- Yu, Y.; Lu, L.; Li, S.F.; Zhang, L.Y.; Luo, X.G. Organic zinc absorption by the intestine of broilers in vivo. Br. J. Nutr. 2017, 117, 1086–1094. [Google Scholar] [CrossRef] [Green Version]
- Abedini, M.; Shariatmadari, F.; Karimi Torshizi, M.A.; Ahmadi, H. Effects of a dietary supplementation with zinc oxide nanoparticles, compared to zinc oxide and zinc methionine, on performance, egg quality, and zinc status of laying hens. Livest. Sci. 2017, 203, 30–36. [Google Scholar] [CrossRef]
- Bao, Y.; Choct, M.; Iji, P.; Bruerton, K. Optimal dietary inclusion of organically complexed zinc for broiler chickens. Br. Poult. Sci. 2009, 50, 95–102. [Google Scholar] [CrossRef]
- Wright, C.L.; Spears, J.W. Effect of zinc source and dietary level on zinc metabolism in Holstein calves. J. Dairy Sci. 2004, 87, 1085–1091. [Google Scholar] [CrossRef] [Green Version]
- Shaeffer, G.L.; Lloyd, K.E.; Spears, J.W. Bioavailability of zinc hydroxychloride relative to zinc sulfate in growing cattle fed a corn-cottonseed hull-based diet. Anim. Feed Sci. Technol. 2017, 232, 1–5. [Google Scholar] [CrossRef]
- Kincaid, R.L.; Chew, B.P.; Cronrath, J.D. Zinc oxide and amino acids as sources of dietary zinc for calves: Effects on uptake and immunity. J. Dairy Sci. 1997, 80, 1381–1388. [Google Scholar] [CrossRef]
- National Research Council (NRC). Nutrient Requirements of Dairy Cattle: Seventh Revised Edition; National Research Council: Ottawa, ON, Canada, 2001; pp. 143–146. [Google Scholar]
- Jensen-Waern, M.; Melin, L.; Lindberg, R.; Johannisson, A.; Petersson, L.; Wallgren, P. Dietary zinc oxide in weaned pigs-effects on performance, tissue concentrations, morphology, neutrophil functions an faecal microflora. Res. Vet. Sci. 1998, 64, 225–231. [Google Scholar] [CrossRef]
- Jia, W.; Zhu, X.; Zhang, W.; Cheng, J.; Guo, C.; Jia, Z. Effects of source of supplemental zinc on performance, nutrient digestibility and plasma mineal profile in cashmere goats. Asian-Aust. J. Anim. Sci. 2009, 22, 1648–1653. [Google Scholar] [CrossRef]
- Haase, H.; Overbeck, S.; Rink, L. Zinc supplementation for the treatment or prevention of disease: Current status and future perspectives. Exp. Gerontol. 2008, 43, 394–408. [Google Scholar] [CrossRef] [PubMed]
- Kulkarni, H.; Mamtani, M.; Patel, A. Roles of zinc in the pathophysiology of acute diarrhea. Curr. Infect. Dis. Rep. 2012, 14, 24–32. [Google Scholar] [CrossRef]
- Samman, S.; Soto, C.; Cooke, L.; Ahmad, Z.; Farmakalidis, E. Is erythrocyte alkaline phosphatase activity a marker of zinc status in humans? Biol. Trace Elem. Res. 1996, 51, 285–291. [Google Scholar] [CrossRef]
- Yin, J.; Li, X.; Li, D.; Yue, T.; Fang, Q.; Ni, J.; Zhou, X.; Wu, G. Dietary supplementation with zinc oxide stimulates ghrelin secretion from the stomach of young pigs. J. Nutr. 2009, 20, 783–790. [Google Scholar] [CrossRef]
- Spears, J.W. Zinc methionine for ruminants: Relative bioavailability of zinc in lambs and effects of growth and performance of growing Heifers. J. Anim. Sci. 1989, 67, 835–843. [Google Scholar] [CrossRef]
- Chabosseau, P.; Rutter, G.A. Zinc and diabetes. Arch. Biochem. Biophys. 2016, 611, 79–85. [Google Scholar] [CrossRef] [Green Version]
- Davis, S.R.; Cousins, R.J. Metallothionein expression in animals: A physiological perspective on function. J. Nutr. 2000, 130, 1085–1088. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Swinkels, J.W.; Kornegay, E.T.; Verstegen, M.W. Biology of zinc and biological value of dietary organic zinc complexes and chelates. Nutr. Res. Rev. 1994, 7, 129–149. [Google Scholar] [CrossRef]
- Schweigel-Rontgen, M. The families of zinc (SLC30 and SLC39) and copper (SLC31) transporters. Curr. Top. Membr. 2014, 73, 321–355. [Google Scholar] [PubMed]
- Yue, M.; Fang, S.L.; Zhuo, Z.; Li, D.D.; Feng, J. Zinc glycine chelate absorption characteristics in Sprague Dawley rat. J. Anim. Physiol. Anim. Nutr. 2015, 99, 457–464. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.P.; Hu, Q.L.; Fang, S.L.; Fang, J. Dosage effect of zinc glycine chelate on zinc metabolism and gene expression of zinc transporter in intestinal segments on rat. Biol. Trace Elem. Res. 2016, 171, 363–370. [Google Scholar] [CrossRef]
- Myers, S.A. Zinc transporters and zinc signaling: New insights into their role in type 2 diabetes. Int. J. Endocrinol. 2015, 167503. [Google Scholar] [CrossRef] [Green Version]
- Andrews, G.K. Regulation and function of Zip4, the acrodermatitis enteropathica gene. Biochem. Soc. Trans. 2008, 36, 1242–1246. [Google Scholar] [CrossRef] [Green Version]
- Garza-Rodriguez, V.; de la Fuente-Garcia, A.; Liy-Wong, C.; Kury, S.; Schmitt, S.; Jamall, I.S. Acrodermatitis enteropathica: A novel SLC39A4 gene mutation in a patient with normal zinc levels. Pediatr. Dermatol. 2015, 32, E124–E125. [Google Scholar] [CrossRef]
Item | % |
---|---|
Milk composition | |
Density, kg/L | 1.02 |
Protein | 3.85 |
Fat | 4.21 |
Total solids | 12.9 |
Dry matter | 12.0 |
Lactose | 4.68 |
Nutrient composition of the starter diet (Dry matter basis) | |
Dry matter | 89.3 |
Crude protein | 19.8 |
Ether extract | 2.68 |
Ash | 6.52 |
Acid detergent fiber | 8.03 |
Neutral detergent fiber | 17.6 |
Ca | 0.89 |
P | 0.46 |
Cu, mg/kg | 50.7 |
Fe, mg/kg | 271 |
Zn, mg/kg | 175 |
Target | Accession Number | Primer Sequences | PCR Product Size(bp) |
---|---|---|---|
β-actin | NM_173979.3 | F: 5’ ATCCTGCGGCATTCACGAA 3’ | 154 |
R: 3’ TGCCAGGGCAGTGATCTCTT 5’ | |||
ZnT1 | NM_001205893.2 | F: 5’ GCAACTTGCTGGAAGCAGAA 3’ | 135 |
R: 3’ TCAGGCTGAATGGTGGTAGC 5’ | |||
ZnT2 | NM_001191496.1 | F: 5’ TCTCCCTGTGGGTGTCTTCC 3’ | 137 |
R: 3’ TTCTGCCGCCAAGTACACC 5’ | |||
ZnT5 | NM_001192174.2 | F: 5’ GGCTAAAATGGCTGAACACCC 3’ | 130 |
R:3’ ACACAAAGCCAGTACTAGCAACA 5’ | |||
ZIP4 1 | NM_001046067.1 | F: 5’ CTCTTGCTGCCCCTGGAC 3’ | 157 |
R: 3’ CCACCAGATCTGCGCGAG 5’ |
Item | Treatment 1 | SEM 2 | p Value | ||
---|---|---|---|---|---|
Control | Zn-Met | ZnO | |||
Days 1 to 7 after Birth | |||||
Average daily gain, g/d Mean height gain, cm | 398 | 485 | 443 | 32.9 | 0.208 |
1.92 | 2.58 | 2.42 | 0.51 | 0.641 | |
Mean body length gain, cm | 2.67 | 1.83 | 2.67 | 0.96 | 0.782 |
Mean heart girth gain, cm | 2.00 | 3.00 | 2.73 | 0.66 | 0.551 |
Average daily milk intake, g DM/d | 982 | 982 | 983 | 0.80 | 0.550 |
Average daily starter intake, g DM/d | 11.9 | 12.9 | 9.04 | 3.33 | 0.700 |
Average daily total feed intake, g DM/d | 994 | 995 | 992 | 2.83 | 0.774 |
Total zinc intake, mg/d | 6.09 b | 86.3 a | 85.6a | 0.58 | <0.001 |
Feed efficiency, g DMI 3/g gain | 2.56 | 2.13 | 2.30 | 0.18 | 0.255 |
Incidence of diarrhea, % | 19.0 | 14.3 | 11.9 | -- | 0.353 |
Days 8 to 14 after birth | |||||
Average daily gain, g/d | 407b | 513a | 433b | 18.5 | 0.003 |
Mean height gain, cm | 1.50 | 2.00 | 1.92 | 0.76 | 0.884 |
Mean body length gain, cm | 2.50 | 3.75 | 3.17 | 0.71 | 0.477 |
Mean heart girth gain, cm | 2.67 | 1.96 | 2.42 | 0.91 | 0.856 |
Average daily milk intake, g DM/d | 983 | 983 | 983 | 0.99 | 0.937 |
Average daily starter intake, g DM/d | 33.0 | 33.1 | 37.7 | 11.9 | 0.950 |
Average daily total feed intake, kg DM/d | 1.02 | 1.02 | 1.02 | 0.01 | 0.931 |
Total zinc intake, mg/d | 9.78 b | 89.8 a | 90.6 a | 2.07 | <0.001 |
Feed efficiency, g DMI/g gain | 2.54 a | 1.99 b | 2.37 a | 0.11 | 0.006 |
Incidence of diarrhea, % | 31.0 | 16.7 | 23.8 | -- | 0.036 |
Days 1 to 14 after birth | |||||
Initial body weight, kg | 40.5 | 42.0 | 39.8 | 1.08 | 0.349 |
Final body weight, kg | 46.1 | 49.0 | 45.9 | 1.09 | 0.115 |
Average daily gain, g/d | 402 b | 499 a | 438 ab | 20.4 | 0.014 |
Mean height gain, cm | 3.42 | 4.58 | 4.33 | 0.98 | 0.683 |
Mean body length gain, cm | 5.17 | 5.58 | 5.83 | 0.97 | 0.888 |
Mean heart girth gain, cm | 4.67 | 4.96 | 5.15 | 0.62 | 0.860 |
Average daily milk intake, g DM/d | 982 | 983 | 983 | 0.59 | 0.582 |
Average daily starter intake, g DM/d | 25.4 | 25.8 | 31.0 | 7.22 | 0.829 |
Average daily total feed intake, kg DM/d | 1.01 | 1.01 | 1.01 | 0.01 | 0.759 |
Total zinc intake, mg/d | 7.29 b | 87.4 a | 88.2 a | 0.93 | <0.001 |
Feed efficiency, g DMI/g gain | 2.54 a | 2.04 b | 2.33 ab | 0.11 | 0.016 |
Incidence of diarrhea, % | 50.0 | 31.0 | 35.7 | -- | 0.033 |
Item | Treatment 1 | SEM | p Value | ||
---|---|---|---|---|---|
Control | Zn-Met | ZnO | |||
Serum micronutrient concentration (mg/kg) | |||||
Zinc | 2.06 b | 3.34 a | 2.82 ab | 0.32 | 0.037 |
Iron | 4.26 | 4.92 | 4.48 | 0.62 | 0.744 |
Copper | 0.77 | 0.87 | 1.22 | 0.14 | 0.090 |
Hepatic micronutrient concentration (mg/kg) 2 | |||||
Zinc | 75.5 b | 122a | 117 ab | 11.7 | 0.025 |
Iron | 34.5 | 35.4 | 35.4 | 3.83 | 0.982 |
Copper | 83.5 | 84.9 | 83.5 | 10.2 | 0.994 |
Item | Treatment 1 | SEM | p Value | ||
---|---|---|---|---|---|
Control | Zn-Met | ZnO | |||
Alkaline phosphatase, ng/mL Metallothionein, pg/mL | 1.55 b 768 b | 1.74 a | 1.73 a | 0.05 | 0.034 |
906 a | 874 ab | 36.0 | 0.040 | ||
Superoxide dismutase, U/mL | 76.9 | 79.5 | 78.8 | 3.15 | 0.835 |
Growth hormone, pg/mL | 3.91 | 4.21 | 3.94 | 0.19 | 0.480 |
Insulin-like growth factor-Ι, ng/mL | 11.7 | 11.1 | 10.9 | 0.85 | 0.810 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, F.; Wo, Y.; Li, H.; Chang, M.; Wei, J.; Zhao, S.; Sun, P. Effect of the Source of Zinc on the Tissue Accumulation of Zinc and Jejunal Mucosal Zinc Transporter Expression in Holstein Dairy Calves. Animals 2020, 10, 1246. https://doi.org/10.3390/ani10081246
Ma F, Wo Y, Li H, Chang M, Wei J, Zhao S, Sun P. Effect of the Source of Zinc on the Tissue Accumulation of Zinc and Jejunal Mucosal Zinc Transporter Expression in Holstein Dairy Calves. Animals. 2020; 10(8):1246. https://doi.org/10.3390/ani10081246
Chicago/Turabian StyleMa, Fengtao, Yeqianli Wo, Hongyang Li, Meinan Chang, Jingya Wei, Shengguo Zhao, and Peng Sun. 2020. "Effect of the Source of Zinc on the Tissue Accumulation of Zinc and Jejunal Mucosal Zinc Transporter Expression in Holstein Dairy Calves" Animals 10, no. 8: 1246. https://doi.org/10.3390/ani10081246