Analysis of lncRNAs Expression Profiles in Hair Follicle of Hu Sheep Lambskin
Abstract
Simple Summary
Abstract
1. Introduction
2. Material and Methods
2.1. Animals and Samples
2.2. Library Construction and Sequencing
2.3. Quality Control of Raw reads and Genome Alignment
2.4. Identification of lncRNAs
2.5. Quantification and Differential Expression Analysis
2.6. Prediction and Enrichment Analysis of lncRNA Target Genes
2.7. Interaction Relationship Analysis of Differentially Expressed lncRNAs and mRNAs
2.8. Data Validation
3. Results
3.1. Overview of Sequencing Results
3.2. Differentially Expressed Analysis
3.3. Functional Enrichment Analysis of Differentially Expressed lncRNAs
3.4. lncRNA-mRNA Relationship Analysis of Differentially Expressed lncRNAs and mRNAs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Data Availability
References
- Gao, W.; Sun, W.; Yin, J.; Lv, X.; Bao, J.; Yu, J.; Wang, L.; Jin, C.; Hu, L. Screening candidate microRNAs (miRNAs) in different lambskin hair follicles in Hu sheep. PLoS ONE 2017, 12, e176532. [Google Scholar] [CrossRef][Green Version]
- Lv, X.; Sun, W.; Yin, J.; Ni, R.; Su, R.; Wang, Q.; Gao, W.; Bao, J.; Yu, J.; Wang, L.; et al. An Integrated Analysis of MicroRNA and mRNA Expression Profiles to Identify RNA Expression Signatures in Lambskin Hair Follicles in Hu Sheep. PLoS ONE 2016, 11, e157463. [Google Scholar] [CrossRef][Green Version]
- Sun, W.; Ni, R.; Yin, J.F.; Musa, H.H.; Ding, T.; Chen, L. Genome array of hair follicle genes in lambskin with different patterns. PLoS ONE 2013, 8, e68840. [Google Scholar] [CrossRef] [PubMed]
- Nissimov, J.N.; Chaudhuri, A.B.D. Hair curvature: A natural dialectic and review. Boil. Rev. 2014, 89, 723–766. [Google Scholar] [CrossRef] [PubMed]
- Yucel, G.; Van Arnam, J.; Means, P.C.; Huntzicker, E.; Altindag, B.; Lara, M.F.; Yuan, J.; Kuo, C.; Oro, A.E. Partial proteasome inhibitors induce hair follicle growth by stabilizing beta-catenin. Stem Cells 2014, 32, 85. [Google Scholar] [CrossRef][Green Version]
- Rile, N.; Liu, Z.; Gao, L.; Qi, J.; Zhao, M.; Xie, Y.; Su, R.; Zhang, Y.; Wang, R.; Li, J. Expression of Vimentin in hair follicle growth cycle of inner Mongolian Cashmere goats. BMC Genom. 2018, 19, 38. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Wang, Y.; Pang, S.; Zhou, J.; Cai, J.; Shang, J. Alcohol extract from Vernonia anthelmintica willd (L.) seed counteracts stress-induced murine hair follicle growth inhibition. BMC Complement. Altern. Med. 2019, 19, 372. [Google Scholar] [CrossRef] [PubMed]
- Tripurani, S.K.; Wang, Y.; Fan, Y.X.; Rahimi, M.; Wong, L.; Lee, M.H.; Starost, M.F.; Rubin, J.S.; Johnson, G.R. Suppression of Wnt/beta-catenin signaling by EGF receptor is required for hair follicle development. Mol. Biol. Cell 2018, 29, 2784. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Zhu, Y.; Liu, H.; Liu, G.; Li, F. Wnt10b promotes hair follicles growth and dermal papilla cells proliferation via Wnt/beta-Catenin signaling pathway in Rex rabbits. Biosci. Rep. 2020, 40, BSR20191248. [Google Scholar] [CrossRef]
- Calvo-Sanchez, M.I.; Fernandez-Martos, S.; Carrasco, E.; Moreno-Bueno, G.; Bernabeu, C.; Quintanilla, M.; Espada, J. A role for the Tgf-beta/Bmp co-receptor Endoglin in the molecular oscillator that regulates the hair follicle cycle. J. Mol. Cell Biol. 2019, 11, 39. [Google Scholar] [CrossRef]
- Genander, M.; Cook, P.J.; Ramskold, D.; Keyes, B.E.; Mertz, A.F.; Sandberg, R.; Fuchs, E. BMP signaling and its pSMAD1/5 target genes differentially regulate hair follicle stem cell lineages. Cell Stem Cell 2014, 15, 619. [Google Scholar] [CrossRef] [PubMed]
- Pujades, C.; Kamaid, A.; Alsina, B.; Giraldez, F. BMP-signaling regulates the generation of hair-cells. Dev. Biol. 2006, 292, 55. [Google Scholar] [CrossRef] [PubMed]
- Kan, L.; Liu, Y.; McGuire, T.L.; Bonaguidi, M.A.; Kessler, J.A. Inhibition of BMP signaling in P-Cadherin positive hair progenitor cells leads to trichofolliculoma-like hair follicle neoplasias. J. Biomed. Sci. 2011, 18, 92. [Google Scholar] [CrossRef] [PubMed]
- Ohuchi, H.; Tao, H.; Ohata, K.; Itoh, N.; Ono, K. Fibroblast growth factor 10 is required for proper development of the mouse whiskers. Biochem. Biophys. Res. Commun. 2003, 302, 562–567. [Google Scholar] [CrossRef]
- Mimeault, M.; Batra, S.K. Hypoxia-inducing factors as master regulators of stemness properties and altered metabolism of cancer- and metastasis-initiating cells. J. Cell. Mol. Med. 2013, 17, 30–54. [Google Scholar] [CrossRef] [PubMed]
- Driskell, R.R.; Clavel, C.; Rendl, M.; Watt, F.M. Hair follicle dermal papilla cells at a glance. J. Cell Sci. 2011, 124, 1179–1182. [Google Scholar] [CrossRef]
- Christiano, A.M. Hair follicle epithelial stem cells get their sox on. Cell Stem Cell 2008, 3, 3. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Wang, J.; Zhu, S.; Meng, N.; He, Y.; Lu, R.; Yan, G.R. ncRNA-Encoded Peptides or Proteins and Cancer. Mol. Ther. 2019, 27, 1718. [Google Scholar] [CrossRef]
- Li, J.; Xue, Y.; Amin, M.T.; Yang, Y.; Yang, J.; Zhang, W.; Yang, W.; Niu, X.; Zhang, H.Y.; Gong, J. ncRNA-eQTL: A database to systematically evaluate the effects of SNPs on non-coding RNA expression across cancer types. Nucleic Acids Res. 2020, 48, 956. [Google Scholar] [CrossRef]
- Zhang, G.; Cai, J. Evaluation of prognostic value of lncRNA BANCR in tumor patients: A systematic review and meta-analysis. J. Buon 2019, 24, 2553. [Google Scholar]
- Yue, Y.; Guo, T.; Yuan, C.; Liu, J.; Guo, J.; Feng, R.; Niu, C.; Sun, X.; Yang, B. Integrated Analysis of the Roles of Long Noncoding RNA and Coding RNA Expression in Sheep (Ovis aries) Skin during Initiation of Secondary Hair Follicle. PLoS ONE 2016, 11, e156890. [Google Scholar] [CrossRef] [PubMed]
- Si, Y.; Bai, J.; Wu, J.; Li, Q.; Mo, Y.; Fang, R.; Lai, W. LncRNA PlncRNA1 regulates proliferation and differentiation of hair follicle stem cells through TGFbeta1mediated Wnt/betacatenin signal pathway. Mol. Med. Rep. 2018, 17, 1191. [Google Scholar] [PubMed]
- Kong, L.; Zhang, Y.; Ye, Z.Q.; Liu, X.Q.; Zhao, S.Q.; Wei, L.; Gao, G. CPC: Assess the protein-coding potential of transcripts using sequence features and support vector machine. Nucleic Acids Res. 2007, 35, 345–349. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Luo, H.; Bu, D.; Zhao, G.; Yu, K.; Zhang, C.; Liu, Y.; Chen, R.; Zhao, Y. Utilizing sequence intrinsic composition to classify protein-coding and long non-coding transcripts. Nucleic Acids Res. 2013, 41, e166. [Google Scholar] [CrossRef]
- Finn, R.D.; Bateman, A.; Clements, J.; Coggill, P.; Eberhardt, R.Y.; Eddy, S.R.; Heger, A.; Hetherington, K.; Holm, L.; Mistry, J.; et al. Pfam: The Protein Families Database. Nucleic Acids Res. 2014, 42, 222–230. [Google Scholar] [CrossRef]
- Li, A.; Zhang, J.; Zhou, Z.; Zhou, Z.Y. PLEK: A tool for predicting long non-coding RNAs and messenger RNAs based on an improved k- mer scheme. BMC Bioinform. 2014, 15, 311. [Google Scholar] [CrossRef]
- Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; van Baren, M.J.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef]
- Mak, D.R.; Davis, J.M.; Gordon, K.S. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar]
- Wang, L.K.; Feng, Z.X.; Wang, X.; Wang, X.W.; Zhang, X.G. DEGseq: An R package for identifying differentially expressed genes from RNA-seq data. Bioinformatics 2010, 26, 136–138. [Google Scholar] [CrossRef]
- Demchak, B.; Hull, T.; Reich, M.; Liefeld, T.; Smoot, M.; Ideker, T.; Mesirov, J.P. Cytoscape: The network visualization tool for GenomeSpace workflows. F1000Research 2014, 3, 151. [Google Scholar] [CrossRef]
- Nie, Y.F.; Li, S.M.; Zheng, X.T.; Chen, W.S.; Li, X.E.; Liu, Z.W.; Hu, Y.; Qiao, H.S.; Qi, Q.Q.; Pei, Q.B.; et al. Transcriptome reveals long non-coding rnas and mrnas involved in primary wool follicle induction in carpet sheep fetal skin. Front. Physiol. 2018, 9, 446. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta c(t)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Lush, M.E.; Diaz, D.C.; Koenecke, N.; Baek, S.; Boldt, H.; St, P.M.; Gaitan-Escudero, T.; Romero-Carvajal, A.; Busch-Nentwich, E.M.; Perera, A.G.; et al. scRNA-Seq reveals distinct stem cell populations that drive hair cell regeneration after loss of Fgf and Notch signaling. eLife 2019, 8, e44431. [Google Scholar] [CrossRef] [PubMed]
- Ahn, S.Y.; Pi, L.Q.; Hwang, S.T.; Lee, W.S. Effect of IGF-I on Hair Growth Is Related to the Anti-Apoptotic Effect of IGF-I and Up-Regulation of PDGF-A and PDGF-B. Ann. Dermatol. 2012, 24, 26. [Google Scholar] [CrossRef] [PubMed]
- Lv, X.Y.; Gao, W.; Jin, C.Y.; Wang, Y.; Chen, W.H.; Wang, L.H.; Zou, S.X.; Sheng, S.X.; Chen, L.; Sun, W. Divergently expressed rna identification and interaction prediction of long non-coding rna and mrna involved in hu sheep hair follicle. Sci. Rep. 2019, 9, 7283. [Google Scholar] [CrossRef]
- Akilli, O.O.; Pakula, H.; Chmielowiec, J.; Qi, J.; Stein, S.; Lan, L.; Sasaki, Y.; Rajewsky, K.; Birchmeier, W. Gab1 and Mapk Signaling Are Essential in the Hair Cycle and Hair Follicle Stem Cell Quiescence. Cell Rep. 2015, 13, 561. [Google Scholar]
- Sohn, K.M.; Jeong, K.H.; Kim, J.E.; Park, Y.M.; Kang, H. Hair growth-promotion effects of different alternating current parameter settings are mediated by the activation of Wnt/beta-catenin and MAPK pathway. Exp. Dermatol. 2015, 24, 958. [Google Scholar] [CrossRef]
- Liu, J.; Xu, Y.; Wu, Q.; Ding, Q.; Fan, W. Sirtuin1 protects hair follicle stem cells from TNFalpha-mediated inflammatory stress via activating the MAPK-ERK-Mfn2 pathway. Life Sci. 2018, 212, 213. [Google Scholar] [CrossRef]
- Xenakis, N.; Mok, K.W.; Rendl, M. An updated classification of hair follicle morphogenesis. Exp. Dermatol. 2019, 4, 332–344. [Google Scholar]
- Sawada, A.; Shinya, M.; Jiang, Y.J.; Kawakami, A.; Kuroiwa, A.; Takeda, H. Fgf/MAPK signaling is a crucial positional cue in somite boundary formation. Development 2001, 128, 4873. [Google Scholar]
- Jiang, L.; Xu, J.; Jin, R.; Bai, H.; Zhang, M.; Yang, S.; Zhang, X.; Zhang, X.; Han, Z.; Zeng, S. Transcriptomic analysis of chicken cochleae after gentamicin damage and the involvement of four signaling pathways (Notch; FGF.; Wnt and BMP) in hair cell regeneration. Hear. Res. 2018, 361, 66. [Google Scholar] [CrossRef] [PubMed]
- Xiao, S.N.; Wang, J.; Chen, Q.; Miao, Y.; Hu, Z.Q. The mechanism of activated platelet-rich plasma supernatant promotion of hair growth by cultured dermal papilla cells. J. Cosmet. Dermatol. 2019, 18, 1711–1716. [Google Scholar] [CrossRef] [PubMed]
- Qiu, W.M.; Lei, M.X.; Zhou, L.; Bai, X.F.; Lai, X.D.; Yu, Y.; Yang, T.; Lian, X.H. Hair follicle stem cell proliferation, akt and wnt signaling activation in tpa-induced hair regeneration. Histochem. Cell Boil. 2017, 147, 749–758. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.L.; Gao, Y.H.; Yang, J.Q.; Li, J.B.; Gao, J. Serenoa repens extracts promote hair regeneration and repair of hair loss mouse models by activating TGF-β and mitochondrial signaling pathway. Eur. Rev. Med. Pharmacol. Sci. 2018, 22, 4000–4008. [Google Scholar]
- Mukhopadhyay, A.; Krishnaswami, S.R.; Cowing-Zitron, C.; Hung, N.J.; Reilly-Rhoten, H.; Burns, J.; Yu, B.D. Negative regulation of Shh levels by Kras and Fgfr2 during hair follicle development. Dev. Biol. 2013, 373, 373–382. [Google Scholar] [CrossRef]
- Rishikaysh, P.; Dev, K.; Diaz, D.; Qureshi, W.M.S.; Filip, S.; Mokry, J. Signaling involved in hair follicle morphogenesis and development. Int. J. Mol. Sci. 2004, 15, 1647–1670. [Google Scholar] [CrossRef]
- Zhang, Y.M.; Zhou, X.C.; Cheng, L.; Wang, X.; Zhang, Q.L.; Zhang, Y.W.; Sun, S.Y. PRKAA1 promotes proliferation and inhibits apoptosis of gastric cancer cells through activating JNK1 and Akt pathways. Oncol. Res. 2020, 3, 213–223. [Google Scholar] [CrossRef]
- Gui, D.; Cui, Z.M.; Zhang, L.; Yu, C.; Yao, D.; Xu, M.; Chen, M.Y.; Wu, P.L.; Li, G.P.; Wang, L.X.; et al. Salidroside attenuates hypoxia-induced pulmonary arterial smooth muscle cell proliferation and apoptosis resistance by upregulating autophagy through the AMPK-mTOR-ULK1 pathway. BMC Pulm. Med. 2017, 17, 191. [Google Scholar] [CrossRef]
- Nakayama, F.; Yasuda, T.; Umeda, S.; Asada, M.; Imamura, T.; Meineke, V.; Akashi, M. Fibroblast growth factor-12 (FGF12) translocation into intestinal epithelial cells is dependent on a novel cell-penetrating peptide domain: Involvement of internalization in the in vivo role of exogenous FGF12. J. Biol. Chem. 2011, 286, 25823. [Google Scholar] [CrossRef]
- Al-Mehmadi, S.; Splitt, M.; Ramesh, V.; DeBrosse, S.; Dessoffy, K.; Xia, F.; Yang, Y.; Rosenfeld, J.A.; Cossette, P.; Michaud, J.L.; et al. FHF1 (FGF12) epileptic encephalopathy. Neurol. Genet. 2016, 2, e115. [Google Scholar] [CrossRef]
- Mossahebi-Mohammadi, M.; Quan, M.; Zhang, J.S.; Li, X. FGF Signaling Pathway: A Key Regulator of Stem Cell Pluripotency. Front. Cell Dev. Boil. 2020, 8, 79. [Google Scholar] [CrossRef]
- Hillege, M.; Galli, C.R.; Offringa, C.; de Wit, G.; Jaspers, R.T.; Hoogaars, W. TGF-beta Regulates Collagen Type I Expression in Myoblasts and Myotubes via Transient Ctgf and Fgf-2 Expression. Cells-Basel 2020, 9, 375. [Google Scholar] [CrossRef] [PubMed]
- Neves, L.; Goncalves, E.; Cavalli, J.; Vieira, G.; Laurindo, L.R.; Simoes, R.R.; Coelho, I.S.; Santos, A.; Marcolino, A.M.; Cola, M.; et al. Photobiomodulation Therapy Improves Acute Inflammatory Response in Mice: The Role of Cannabinoid Receptors/ATP-Sensitive K(+) Channel/p38-MAPK signaling Pathway. Mol. Neurobiol. 2018, 55, 5580. [Google Scholar] [CrossRef]
- Guo, W.; Ma, J.; Yang, Y.; Guo, S.; Zhang, W.; Zhao, T.; Yi, X.; Wang, H.; Wang, S.; Liu, Y.; et al. ATP-Citrate Lyase Epigenetically Potentiates Oxidative Phosphorylation to Promote Melanoma Growth and Adaptive Resistance to MAPK Inhibition. Clin. Cancer Res. 2020. [Google Scholar] [CrossRef] [PubMed]
- Korneenko, T.V.; Pestov, N.B.; Ahmad, N.; Okkelman, I.A.; Dmitriev, R.I.; Shakhparonov, M.I.; Modyanov, N.N. Evolutionary diversification of the BetaM interactome acquired through co-option of the ATP1B4 gene in placental mammals. Sci. Rep. 2016, 6, 22395. [Google Scholar] [CrossRef]
Type | Gene ID/Symbol | Primer Sequences (5′–3′) | Product Length (bp) | Accession Number | |
---|---|---|---|---|---|
lncRNAs | XLOC_051456 | F | CACTCAGCCTTCTTCACAGT | 158 | |
R | AGACGCTTACTCCTTGGAAGA | ||||
XLOC_079348 | F | TGCCATGATCTTTGTTTTCTGAA | 193 | ||
R | GCATCAAGATTGCCGGGAG | ||||
XLOC_153474 | F | TCCCTGAGTAGTGTGACAGC | 181 | ||
R | GCCTTGACTAGACGGACCTT | ||||
XLOC_178815 | F | TGGCAAAGTAATGTCTCTGCT | 190 | ||
R | TCCGGTCCCATCACTTCATG | ||||
TCONS_00279168 | F | ACTGAGTTCAGACCAGCAGC | 131 | ||
R | TGTAACCGGATCAACGCCTC | ||||
mRNAs | SORCS3 | F | ACCAGTGGAATCGTGTGACC | 186 | XM_004020175.4 |
R | AAGTTACTCGCCCCAGATGC | ||||
SOBP | F | AGAAATAAGGTATGTGACTGGTGT | 85 | XM_015097362.2 | |
R | ACTGAAGCCTTCTTTCCCCG | ||||
GABRA1 | F | CCCATGCCTGCCCTCTAAAA | 121 | XM_004009041.4 | |
R | TGGTTTAGGCGTGACCCATC | ||||
TMEFF2 | F | GGCTGGAACTGCTCTGGTTA | 169 | XM_027965049.1 | |
R | TCTCCCCATTGGAACCACAC | ||||
FGF12 | F | TGAAGGCCAGCCTCTATGTG | 160 | FJ958355.1 | |
R | AACCAAGCTCGGCCTGATTC | ||||
Reference gene | GAPDH | F | GTCGGAGTGAACGGATTTGG | 196 | HM043737.1 |
R | CATTGATGACGAGCTTCCCG |
Sample | Raw Bases (G) | Raw Reads | Clean Bases (G) | Clean Reads | Error Rate (%) | GC Content (%) | Total Mapped (%) | Uniquely Mapped (%) |
---|---|---|---|---|---|---|---|---|
SM1 | 15.90 | 106,025,390 | 15.67 | 104,490,060 | 0.03 | 49.78 | 85.46 | 79.26 |
SM2 | 15.25 | 101,680,458 | 15.02 | 100,165,540 | 0.03 | 53.10 | 81.29 | 74.09 |
SM3 | 18.48 | 123,207,764 | 18.12 | 120,790,388 | 0.03 | 52.13 | 85.02 | 78.64 |
ST1 | 14.96 | 99,732,676 | 14.70 | 97,967,308 | 0.03 | 53.83 | 82.05 | 73.95 |
ST2 | 12.58 | 83,884,650 | 12.38 | 82,542,358 | 0.03 | 52.33 | 82.54 | 75.64 |
ST3 | 16.93 | 112,891,936 | 16.43 | 109,522,416 | 0.03 | 53.84 | 87.34 | 74.56 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lv, X.; Chen, W.; Sun, W.; Hussain, Z.; Wang, S.; Wang, J. Analysis of lncRNAs Expression Profiles in Hair Follicle of Hu Sheep Lambskin. Animals 2020, 10, 1035. https://doi.org/10.3390/ani10061035
Lv X, Chen W, Sun W, Hussain Z, Wang S, Wang J. Analysis of lncRNAs Expression Profiles in Hair Follicle of Hu Sheep Lambskin. Animals. 2020; 10(6):1035. https://doi.org/10.3390/ani10061035
Chicago/Turabian StyleLv, Xiaoyang, Weihao Chen, Wei Sun, Zahid Hussain, Shanhe Wang, and Jinyu Wang. 2020. "Analysis of lncRNAs Expression Profiles in Hair Follicle of Hu Sheep Lambskin" Animals 10, no. 6: 1035. https://doi.org/10.3390/ani10061035
APA StyleLv, X., Chen, W., Sun, W., Hussain, Z., Wang, S., & Wang, J. (2020). Analysis of lncRNAs Expression Profiles in Hair Follicle of Hu Sheep Lambskin. Animals, 10(6), 1035. https://doi.org/10.3390/ani10061035