Next Article in Journal
Impaired Mitochondrial Function Results from Oxidative Stress in the Full-Term Placenta of Sows with Excessive Back-Fat
Next Article in Special Issue
Effects of Single Nucleotide Polymorphisms in the SLC27A3 Gene on the Nutritional Value of Sheep Milk
Previous Article in Journal
Rumen-Protected Glucose Stimulates the Insulin-Like Growth Factor System and mTOR/AKT Pathway in the Endometrium of Early Postpartum Dairy Cows
Previous Article in Special Issue
Frequencies Evaluation of β-Casein Gene Polymorphisms in Dairy Cows Reared in Central Italy
 
 
Due to scheduled maintenance work on our servers, there may be short service disruptions on this website between 11:00 and 12:00 CEST on March 28th.
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Detection of rs665862918 (15-bp Indel) of the HIAT1 Gene and its Strong Genetic Effects on Growth Traits in Goats

1
College of Medicine & Forensic, Health Science Center, Xi’an Jiaotong University, Xi’an 710061, Shaanxi, China
2
Shaanxi Key Laboratory of Molecular Biology for Agriculture, College of Animal Science, Northwest A&F University, Yangling 712100, Shaanxi, China
3
Shaanxi Provincial Engineering and Technology Research Center of Cashmere Goats, Yulin University, Yulin 719000, Shaanxi, China
4
Life Science Research Center, Yulin University, Yulin 719000, Shaanxi, China
*
Authors to whom correspondence should be addressed.
These authors equally contributed to this work.
Animals 2020, 10(2), 358; https://doi.org/10.3390/ani10020358
Submission received: 12 January 2020 / Revised: 15 February 2020 / Accepted: 17 February 2020 / Published: 23 February 2020

Simple Summary

Growth traits are important in goats and can affect their body size and meat production. In this study, the hippocampus abundant transcript 1 (HIAT1) gene, which has been reported as a meat-associated trait in elite goat breeds and a dairy-associated trait in water buffalo, was chosen to detect its correlation with growth traits in goats. The results show that the rs665862918 polymorphism (a 15 bp insertion) in HIAT1 is associated with body length, chest width, chest depth, height at hip cross and heart girth in Shaanbei white cashmere goats (SBWC, n = 1013). Our results reveal that rs665862918 in HIAT1 is relevant to the growth traits of goats and could be used for marker-assisted selection (MAS) as a molecular marker in goat populations.

Abstract

The hippocampus abundant transcript 1 (HIAT1) gene, which was detected by the genome-wide identification of selective sweeps among elite goat breeds and water buffalo, is proposed to play an important role in meat characteristics. Four indels of the HIAT1 gene selected from the NCBI and Ensembl databases were detected via a pooling and sequencing strategy. A 15 bp insertion (rs665862918) in the first intron of HIAT1 was selected and classified on an electrophoresis platform in the Shaanbei white cashmere goat (SBWC) population. The correlation analysis revealed that rs665862918 is significantly highly associated with chest width (p = 1.57 × 10−5), chest depth (p = 8.85 × 10−5), heart girth (p = 1.05 × 10−7), body length (p = 0.022), and height at hip cross (p = 0.023) in the SBWC population (n = 1013). Further analysis revealed that individuals with a genotype insertion/insertion (II) of the rs665862918 locus exhibited better growth trait performance than individuals with an insertion/deletion (ID) or deletion/deletion (DD). These findings verify that HIAT1 affects the body size of goats and that rs665862918 could be a potential molecular marker for growth traits in goat breeding.

1. Introduction

The goat was the first animal domesticated for consumer production and plays an important role in the food chain. The present goat breeding programs aim to improve the growth rate and prolificacy of goats through pure breeding and the selection of indigenous breeds for skin, meat, and milk traits [1,2]. Growth traits of goats, such as their body length, body height, and heart girth, are critical factors that determine goat production [3,4,5]. Molecular breeding, which exploits functional single nucleotide polymorphisms (SNPs), insertions/deletions (indels), and copy number variations (CNVs) of candidate genes, is a reproductive approach for improving the growth traits of goats [3,6]. In contrast to other types of variations, indels are a type of natural variation in genes that refer to one DNA chain with a certain number of nucleotide insertions or deletions in the genome [7]. Indel variants present the advantages of convenient detection and causing notable effects compared with other types of variations (such as SNPs, CNVs, and structural variations in the genome) [8,9]. Currently, indels are detected on an electrophoresis platform, which is an economical and fast method that does not require complicated experimental equipment [10,11,12].
Shaanbei white cashmere goats (SBWC), resulting from a cross between Shaanbei black goat (female parent) and Liaoning cashmere goat (male parent), are a rustic breed that exhibits increased resistance to rough feed, wind, cold weather, and disease (Figure 1) [5]. These goats are widely raised in the northern Shaanxi province of China, exhibiting excellent cashmere performance and well-established meat quality [13,14]. However, due to its short stature, SBWC shows lower meat production compared with other well-known breeds. Thus, the improvement of SBWC products by detecting important candidate gene polymorphisms and their effect on growth-related traits represents a potentially rewarding approach.
The HIAT1 gene was first identified as an abundant hippocampus transcript and classified as a member of the major facilitator superfamily of solute carrier proteins (SLCs) [15,16]. The SLCs include a large group of proteins that transport diverse substances, including amino acids, sugars, nucleosides and fatty acids [16,17,18]. The HIAT1 gene, which is also known as MFSD14A (major facilitator superfamily domain containing 14A), plays a role in transmembrane transport and the molecular function of transporter activity [18]. Our previous genome resequencing study of goats revealed that a set of genes play critical roles in meat goats compared with wool and dairy breeds, including the HIAT1 gene [19]. In addition, HIAT1 was identified as a novel candidate gene for milk production in buffaloes and was localized to a bovine QTL (quantitative trait locus) affecting the milk fat yield and protein yield [20,21]. HIAT1 may transport a bloodstream solute that is required for the final stages of spermatogenesis in mice [22]. Overall, HIAT1 has been proposed to play important roles at specific loci through transporter activity and in the modulation of mammalian growth progress, especially in skeletal development [6]. Therefore, we evaluated whether the HIAT1 gene is associated with growth traits in goats. These findings provide potential molecular markers for marker-assisted selection (MAS) programs to improve the production of indigenous breeds in the goat industry.

2. Materials and Methods

The experimental procedures were approved by the Review Committee of the Health Science Center of Xi’an Jiaotong University (XJTU, project identification code 2013–054). Animal experiments and sample collection were performed following the ethics commission’s guidelines.

2.1. Samples and Collection of Data

In this study, 1013 uncorrelated female SBWC goats (2–3 years old) were used to obtain samples from ear tissue, which were collected from different farms maintained under similar management plans, environmental conditions, and feeding programs in central Yulin, Shaanxi, China. Body height (BH), body length (BL), chest width (CW), chest depth (CD), heart girth (HG), cannon circumference (CC), and height at hip cross (HHC) were recorded as growth traits according to the protocol of Gilbert, et al. [23].

2.2. Isolation of DNA and Primer Design

Genomic DNA samples isolated via a high-salt extraction method from the ear tissues of 1013 SBWC goats [24] were quantified with a NanoDrop 1000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). The DNA samples were diluted to 50 ng/µL as working solutions [3].
Data on the indels present in HIAT1 in goats were downloaded from Ensembl (http://asia.ensembl.org/index.html). The HIAT1 gene of goat is in chromosome 3 with 46,942 bp, including 12 exons and 11 introns. All the sequences of the HIAT1 gene were analyzed for indels, 112 indels were blasted, and 4 indels with appropriate lengths and locations were selected: rs658176778 (in the 5′ UTR, a 14 bp deletion), rs665862918 (in the intron 1, a 15 bp insertion), rs672419140 (in the intron 1, an 8 bp insertion), and rs668363704 (in the intron 2, an 8 bp insertion). Then, Primer Premier software (Version 5.0, Premier Biosoft, San Francisco, CA, USA) was used to design four primer pairs according to the reference sequence (GenBank NC_030810, Table 1).

2.3. DNA Pool Establishment and PCR Amplification

A genomic DNA pool was constructed from 30 randomly selected DNA samples from SBWC goats, consisting of a mixture of 1 µL of each sample, and then amplification was performed with 4 pairs of primers. The polymerase chain reaction (PCR) products were sequenced and analyzed according to Wang’s method for detecting polymorphisms [4].
PCR was performed in a total volume of 13 µL, containing 0.6 µL (50 ng/µL) of genomic DNA, 5.1 µL of ddH2O, 0.4 µL of each primer, and 6.5 µL of 2× Taq Master Mix. Touch-down PCR (TD-PCR) was applied in the thermal cycling program as described in Yang’s study [25]. Indel polymorphisms were assayed by subjecting 5.0 µL of the PCR products to electrophoresis on 3.0% agarose gels [5].

2.4. Statistical Analysis

The genotypic and allelic frequencies of indel variants were calculated directly by hand. The Hardy–Weinberg equilibrium (HWE) was calculated with the SHEsis program (http://analysis.bio-x.cn/myAnalysis.php). Population genetic parameters including homozygosity (Ho), heterozygosity (He), polymorphism information content (PIC), and the effective allele number (Ne) were computed using Popgene software (version 1.3.1, University of Alberta, Edmonton, AB, Canada) [26]. The associations between the indel polymorphisms and growth traits were evaluated by one-way analysis of variance (ANOVA) with SPSS software (version 21.0, IBM, Armonk, NY, USA) [27]. The results are presented in format of means ± standard errors.

3. Results

3.1. Electrophoresis Detection of Four Indels

According to the results of the DNA pool amplification, electrophoresis, and sequencing, two indels of HIAT1 were found to be polymorphic: the 15 bp insertion (NC_030810.1:g.7695 insACTAGTGGACTTCTT, rs665862918) in intron 1 and the 8 bp insertion (NC_030810.1:g.20531 ins ATCGGGTT, rs668363704) in intron 2. The rs665862918 locus was chosen because the 15 bp insertion was located in intron 1, closer to the H3K27ac mark which was found to distinguish active enhancers from inactive/poised enhancers based on the UCSC genome database (http://genome.ucsc.edu/) and therefore more likely to be functional. DNA sequencing and alignment based on the reference sequence (NC_030810.1) were used to identify the indel (Figure 2a,b).
As shown in Figure 2c, rs665862918 presented three genotypes according to agarose gel electrophoresis: homozygote deletion type (deletion/deletion: DD, 183 bp), insertion type (insertion/insertion: II, 198 bp), and heterozygote type (insertion/deletion: ID, 198 bp and 183 bp). The band accompanying the heterozygote type is referred to as a heteroduplex, which is a double-stranded DNA molecule formed by the base pairing of complementary single strands of different double-stranded parent molecules and can be produced via intracellular genetic recombination or form under in vitro renaturation conditions [28]. Heteroduplexes were reported in a previous study in which indel polymorphisms were detected by agarose gel electrophoresis [29].

3.2. Polymorphism of rs665862918

The II, ID, and DD genotypes of rs665862918 were detected in SBWC, and the frequency of DD was higher than those of ID and II in 1013 female individuals. The frequencies of the I and D alleles were 0.203 and 0.797, respectively. No significant deviations from Hardy–Weinberg equilibrium were found in the cases or controls (p = 0.520, p > 0.05). Intermediate genetic diversity was calculated according to the PIC value (PIC = 0.271, 0.25 <PIC< 0.5) at this locus (Table 2).

3.3. Effect of the rs665862918 Polymorphism on Prowth Traits

rs665862918 was found to be significantly related to chest width, chest depth, heart girth, body length, and the height at hip cross (p = 0.022, p = 1.57 × 10−5, p = 8.85 × 10−5, p = 1.05 × 10−7, and p = 0.023, respectively) in SBWC goats. The body length of genotype II goats was greater than that of genotype DD goats (p < 0.05). The chest width associated with genotype II was greater than that associated with genotypes ID (p < 0.05) and DD (p < 0.01). The chest depth associated with genotype II was greater than those of genotypes ID (p < 0.05) and DD (p < 0.01). The heart girth of genotype II goats was greater than those of genotype ID (p < 0.05) and DD (p < 0.01) goats. The height at hip cross associated with genotype II was greater than that associated with genotype DD (p < 0.05) (Table 3).

4. Discussion

In previous studies, SNPs in genes were shown to be associated with growth traits and litter size in goats [30,31,32,33]. Indels similarly present relationships with growth traits [34,35], as observed for a 12 bp indel in GDF9 that is related to first-born litter size in goats [4], and a 14 bp indel in CMTM2 that shows a relationship with litter size in goats [24]. In this study, rs665862918 of the HIAT1 gene was found to be associated with the growth traits of SBWC goats. HIAT1 is located on chromosome 3 including 12 exons and 11 introns, and the indel position ranges from 77,286,424 to 77,286,439 bp. Here, the rs665862918 (15 bp indel) of HIAT1 in SBWC goats was significantly correlated with body length (p = 0.022), chest width (p = 1.57 × 10−5), chest depth (p = 8.85 × 10−5), heart girth (p = 1.05 × 10−7), and height at hip cross (p = 0.023).
There are several reasons for addressing these associations. First, a region on chromosome 3 was reported to show the highest intensity signal effect on meat traits in goats, which includes the HIAT1, SLC35A3, and SASS6 genes [19,21]. The same region spanning 43.3 to 43.8 Mb on chromosome 3 of water buffalo was shown to affect milk fat and protein percentages, and this region harbors the HIAT1, SLC35A3, and PALMD genes [21]. A region on chromosome 3 at 43.29 Mb was also identified as a bovine QTL affecting milk fat yield, fat percentage, protein yield, and protein percentage [20]. Whitworth, et al. [36] found that HIAT1 downregulates transcripts related to nuclear transfer in the pig blastocyst stage and reported that the gene might participate in mouse spermatogenesis [22]. However, functional studies of HIAT1 are limited. We showed that rs665862918 of HIAT1 within SBWC goats is highly significantly correlated with growth traits, which implied that HIAT1 may be a novel candidate gene that has genetic effects on meat production in goats. Second, the neighboring gene SLC35A3 was reported to be associated with vertebral malformation [37] and was also reported to affect milk production and milk performance in dairy cattle [38,39,40]. In addition, the HIAT1 and SLC35A3 genes in goats, cattle, and water buffalo are all highly selected, which suggests that HIAT1 and SLC35A3 may work together to affect certain characteristics. Third, the alternative splicing of eukaryotic transcripts causes cells to generate highly diverse proteins from a limited number of genes by generating different mRNAs [41]. According to the Ensembl database, eight transcripts have been detected in HIAT1 of humans, whereas only one transcript has been reported in goats. Since transcripts show high consistency in different species, the question arises as to whether rs665862918 in intron 1 of the HIAT1 gene may affect gene expression through different transcripts.
There are several limitations to interpreting our results. As a dual-purpose variety, SBWC is used to produce both cashmere and meat. Due to the lack of data from cashmere goats, only the relationship between growth traits and the indels of HIAT1 was studied. In addition, 1013 samples from SBWC were tested in the study; if the results are to be persuasive, more samples from male goats and other breeds will be indispensable.

5. Conclusions

In this study, the rs665862918 polymorphism in HIAT1 was significantly associated with body length, the height at hip cross, chest depth, chest width, and heart girth in a large SBWC population. The results presented in this paper suggested that rs665862918 could be a potential marker for MAS, and further studies and replication with different goat breeds will be required to improve the growth traits of goats.

Author Contributions

Data curation, Z.W.; Investigation, H.W.; Methodology, X.W. and B.Z.; Project administration, Q.T.; Resources, X.S., X.L. and B.Z.; Software, J.G.; Supervision, X.L.; Validation, B.Z.; Writing–original draft, J.G.; Writing–review & editing, J.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (grant No. 31172184) and the Provincial Key Projects of Shaanxi (grants 2014KTDZ02-01 and 2017JQ8010).

Acknowledgments

We are grateful to all members of Qu Lei’ group and the staff at the Shaanbei White Cashmere goat breeding farm for the collection of samples, and we are thankful for the support from the Agricultural Technical Station of Veterinary and Animal Husbandry of Yulin City, Shaanxi Province, P.R. China and for the support from the Life Science Research Core Service (LSRCS) of Northwest A&F University, Yangling, Shaanxi, People’s Republic of China.

Conflicts of Interest

The authors declare that they have no conflict of interests.

References

  1. Wang, K.; Yan, H.; Xu, H.; Yang, Q.; Zhang, S.; Pan, C.; Chen, H.; Zhu, H.; Liu, J.; Qu, L.; et al. A novel indel within goat casein alpha S1 gene is significantly associated with litter size. Gene 2018, 671, 161–169. [Google Scholar] [CrossRef]
  2. Dai, B.; Liang, H.; Guo, D.-d.; Bi, Z.-w.; Yuan, J.-l.; Jin, Y.; Huan, L.; Guo, X.-d.; Cang, M.; Liu, D.-j. The overexpression of tβ4 in the hair follicle tissue of Alpas cashmere goats increases cashmere yield and promotes hair follicle development. Animals 2019, 10, 75. [Google Scholar] [CrossRef]
  3. Jin, Y.; Yang, Q.; Gao, J.; Tang, Q.; Duan, B.; Yu, T.; Qi, X.; Liu, J.; Wang, R.; Dang, R.; et al. Detection of Insertions/Deletions Within SIRT1, SIRT2 and SIRT3 Genes and Their Associations with Body Measurement Traits in Cattle. Biochem. Genet. 2018, 56, 663–676. [Google Scholar] [CrossRef]
  4. Wang, X.; Yang, Q.; Wang, K.; Zhang, S.; Pan, C.; Chen, H.; Qu, L.; Yan, H.; Lan, X. A novel 12-bp indel polymorphism within the GDF9 gene is significantly associated with litter size and growth traits in goats. Anim. Genet. 2017, 48, 735–736. [Google Scholar] [CrossRef]
  5. Yan, H.L.; Jiang, E.H.; Zhu, H.J.; Hu, L.Y.; Liu, J.W.; Qu, L. The novel 22 bp insertion mutation in a promoter region of the PITX2 gene is associated with litter size and growth traits in goats. Arch. Anim. Breed 2018, 61, 329–336. [Google Scholar] [CrossRef]
  6. Wang, K.; Cui, Y.; Wang, Z.; Yan, H.; Meng, Z.; Zhu, H.; Qu, L.; Lan, X.; Pan, C. One 16bp insertion/deletion (indel) within the KDM6A gene revealing strong associations with growth traits in goat. Gene 2019, 686, 16–20. [Google Scholar] [CrossRef] [PubMed]
  7. Marques, D.; Ferreira-Costa, L.R.; Ferreira-Costa, L.L.; Correa, R.d.S.; Borges, A.M.P.; Ito, F.R.; Ramos, C.C.d.O.; Bortolin, R.H.; Luchessi, A.D.; Ribeiro-Dos-Santos, Â.; et al. Association of insertion-deletions polymorphisms with colorectal cancer risk and clinical features. World J. Gastroenterol. 2017, 23, 6854–6867. [Google Scholar] [CrossRef] [PubMed]
  8. Li, W.; Liu, D.; Tang, S.; Li, D.; Han, R.; Tian, Y.; Li, H.; Li, G.; Li, W.; Liu, X.; et al. A multiallelic indel in the promoter region of the Cyclin-dependent kinase inhibitor 3 gene is significantly associated with body weight and carcass traits in chickens. Poult. Sci. 2019, 98, 556–565. [Google Scholar] [CrossRef]
  9. Ren, T.; Li, W.; Liu, D.; Liang, K.; Wang, X.; Li, H.; Jiang, R.; Tian, Y.; Kang, X.; Li, Z. Two insertion/deletion variants in the promoter region of the QPCTL gene are significantly associated with body weight and carcass traits in chickens. Anim. Genet. 2019, 50, 279–282. [Google Scholar] [CrossRef]
  10. Yang, Q.; Zhang, S.; Liu, L.; Cao, X.; Lei, C.; Qi, X.; Lin, F.; Qu, W.; Qi, X.; Liu, J.; et al. Application of mathematical expectation (ME) strategy for detecting low frequency mutations: An example for evaluating 14-bp insertion/deletion (indel) within the bovine PRNP gene. Prion 2016, 10, 409–419. [Google Scholar] [CrossRef]
  11. Wang, Z.; Zhang, X.; Jiang, E.; Yan, H.; Zhu, H.; Chen, H.; Liu, J.; Qu, L.; Pan, C.; Lan, X. InDels within caprine IGF2BP1 intron 2 and the 3′-untranslated regions are associated with goat growth traits. Anim. Genet. 2019. [Google Scholar] [CrossRef]
  12. Xu, W.; He, H.; Zheng, L.; Xu, J.W.; Lei, C.Z.; Zhang, G.M.; Dang, R.H.; Niu, H.; Qi, X.L.; Chen, H.; et al. Detection of 19-bp deletion within PLAG1 gene and its effect on growth traits in cattle. Gene 2018, 675, 144–149. [Google Scholar] [CrossRef] [PubMed]
  13. He, X.; Chao, Y.; Zhou, G.; Chen, Y. Fibroblast growth factor 5-short (FGF5s) inhibits the activity of FGF5 in primary and secondary hair follicle dermal papilla cells of cashmere goats. Gene 2016, 575, 393–398. [Google Scholar] [CrossRef] [PubMed]
  14. Wu, J.; Li, A.; Cai, H.; Zhang, C.; Lei, C.; Lan, X.; Chen, H. Intron retention as an alternative splice variant of the cattle ANGPTL6 gene. Gene 2019, 709, 17–24. [Google Scholar] [CrossRef] [PubMed]
  15. Matsuo, N.; Kawamoto, S.; Matsubara, K.; Okubo, K. Cloning of a cDNA encoding a novel sugar transporter expressed in the neonatal mouse hippocampus. Biochem. Biophys. Res. Commun. 1997, 238, 126–129. [Google Scholar] [CrossRef] [PubMed]
  16. Sreedharan, S.; Stephansson, O.; Schioth, H.B.; Fredriksson, R. Long evolutionary conservation and considerable tissue specificity of several atypical solute carrier transporters. Gene 2011, 478, 11–18. [Google Scholar] [CrossRef]
  17. El-Gebali, S.; Bentz, S.; Hediger, M.A.; Anderle, P. Solute carriers (SLCs) in cancer. Mol. Aspects Med. 2013, 34, 719–734. [Google Scholar] [CrossRef]
  18. Lekholm, E.; Perland, E.; Eriksson, M.M.; Hellsten, S.V.; Lindberg, F.A.; Rostami, J.; Fredriksson, R. Putative Membrane-Bound Transporters MFSD14A and MFSD14B Are Neuronal and Affected by Nutrient Availability. Front. Mol. Neurosci. 2017, 10, 11. [Google Scholar] [CrossRef]
  19. Zhang, B.; Chang, L.; Lan, X.; Asif, N.; Guan, F.; Fu, D.; Li, B.; Yan, C.; Zhang, H.; Zhang, X.; et al. Genome-wide definition of selective sweeps reveals molecular evidence of trait-driven domestication among elite goat (Capra species) breeds for the production of dairy, cashmere, and meat. Gigascience 2018, 7. [Google Scholar] [CrossRef]
  20. Hu, Z.L.; Park, C.A.; Reecy, J.M. Developmental progress and current status of the Animal QTLdb. Nucleic Acids Res. 2016, 44, D827–D833. [Google Scholar] [CrossRef]
  21. Liu, J.J.; Liang, A.X.; Campanile, G.; Plastow, G.; Zhang, C.; Wang, Z.; Salzano, A.; Gasparrini, B.; Cassandro, M.; Yang, L.G. Genome-wide association studies to identify quantitative trait loci affecting milk production traits in water buffalo. J. Dairy Sci. 2018, 101, 433–444. [Google Scholar] [CrossRef]
  22. Doran, J.; Walters, C.; Kyle, V.; Wooding, P.; Hammett-Burke, R.; Colledge, W.H. Mfsd14a (Hiat1) gene disruption causes globozoospermia and infertility in male mice. Reproduction 2016, 152, 91–99. [Google Scholar] [CrossRef] [PubMed]
  23. Gilbert, R.P.; Bailey, D.R.; Shannon, N.H. Linear body measurements of cattle before and after 20 years of selection for postweaning gain when fed two different diets. J. Anim. Sci. 1993, 71, 1712–1720. [Google Scholar] [CrossRef] [PubMed]
  24. Kang, Z.; Zhang, S.; He, L.; Zhu, H.; Wang, Z.; Yan, H.; Huang, Y.; Dang, R.; Lei, C.; Chen, H.; et al. A 14-bp functional deletion within the CMTM2 gene is significantly associated with litter size in goat. Theriogenology 2019, 139, 49–57. [Google Scholar] [CrossRef] [PubMed]
  25. Yang, Q.; Zhang, S.; Li, J.; Wang, X.; Peng, K.; Lan, X.; Pan, C. Development of a touch-down multiplex PCR method for simultaneously rapidly detecting three novel insertion/deletions (indels) within one gene: An example for goat GHR gene. Anim. Biotechnol. 2019, 30, 366–371. [Google Scholar] [CrossRef] [PubMed]
  26. Jiang, E.; Kang, Z.; Wang, X.; Liu, Y.; Liu, X.; Wang, Z.; Li, X.; Lan, X. Detection of insertions/deletions (InDels) within the goat Runx2 gene and their association with litter size and growth traits. Anim. Biotechnol. 2019, 1–9. [Google Scholar] [CrossRef]
  27. Wang, K.; Kang, Z.; Jiang, E.; Yan, H.; Zhu, H.; Liu, J.; Qu, L.; Lan, X.; Pan, C. Genetic effects of DSCAML1 identified in genome-wide association study revealing strong associations with litter size and semen quality in goat (Capra hircus). Theriogenology 2020, 146, 20–25. [Google Scholar] [CrossRef]
  28. Wang, X.; Lian, L.; Zhao, C.; Deng, X.; Wu, C. Nature Identification of Nontargeted Bands Accompanied with Heterozygote in Nondenatured Polyacrylamide Gel Electrophoresis. J. Agric. Biotechnol. 2010, 18, 616–622. [Google Scholar]
  29. Ren, F.; Yu, S.; Chen, R.; Lv, X.; Pan, C. Identification of a novel 12-bp insertion/deletion (indel) of iPS-related Oct4 gene and its association with reproductive traits in male piglets. Anim. Reprod. Sci. 2017, 178, 55–60. [Google Scholar] [CrossRef]
  30. Zhang, Y.; Cui, W.; Yang, H.; Wang, M.; Yan, H.; Zhu, H.; Liu, J.; Qu, L.; Lan, X.; Pan, C. A novel missense mutation (L280V) within POU1F1 gene strongly affects litter size and growth traits in goat. Theriogenology 2019, 135, 198–203. [Google Scholar] [CrossRef]
  31. Song, X.; Li, J.; Fei, P.; Zhang, X.; Pan, C.; Chen, H.; Qu, L.; Lan, X. Polymorphisms within the boule gene detected by tetra-primer amplification refractory mutation system PCR (t-arms-pcr) are significantly associated with goat litter size. Animals 2019, 9, 910. [Google Scholar] [CrossRef] [PubMed]
  32. Zhu, H.; Zhang, Y.; Bai, Y.; Yang, H.; Yan, H.; Liu, J.; Shi, L.; Song, X.; Li, L.; Dong, S.; et al. Relationship between SNPs of POU1F1 gene and litter size and growth traits in Shaanbei white cashmere goats. Animals 2019, 9, 114. [Google Scholar] [CrossRef] [PubMed]
  33. Wang, X.; Yang, Q.; Zhang, S.; Zhang, X.; Pan, C.; Chen, H.; Zhu, H.; Lan, X. Genetic effects of single nucleotide polymorphisms in the goat GDF9 gene on prolificacy: True or false positive? Animals 2019, 9, 886. [Google Scholar] [CrossRef] [PubMed]
  34. Bi, Y.; Feng, B.; Wang, Z.; Zhu, H.; Qu, L.; Lan, X.; Pan, C.; Song, X. Myostatin (MSTN) gene indel variation and its associations with body traits in Shaanbei white cashmere goat. Animals 2020, 10, 168. [Google Scholar] [CrossRef]
  35. Zhang, Y.; Wang, K.; Liu, J.; Zhu, H.; Qu, L.; Chen, H.; Lan, X.; Pan, C.; Song, X. An 11-bp indel polymorphism within the CSN1S1 gene is associated with milk performance and body measurement traits in chinese goats. Animals 2019, 9, 1114. [Google Scholar] [CrossRef]
  36. Whitworth, K.M.; Zhao, J.; Spate, L.D.; Li, R.; Prather, R.S. Scriptaid corrects gene expression of a few aberrantly reprogrammed transcripts in nuclear transfer pig blastocyst stage embryos. Cell Reprogram 2011, 13, 191–204. [Google Scholar] [CrossRef]
  37. Thomsen, B.; Horn, P.; Panitz, F.; Bendixen, E.; Petersen, A.H.; Holm, L.E.; Nielsen, V.H.; Agerholm, J.S.; Arnbjerg, J.; Bendixen, C. A missense mutation in the bovine SLC35A3 gene, encoding a UDP-N-acetylglucosamine transporter, causes complex vertebral malformation. Genome Res. 2006, 16, 97–105. [Google Scholar] [CrossRef]
  38. Kadri, N.K.; Sahana, G.; Charlier, C.; Iso-Touru, T.; Guldbrandtsen, B.; Karim, L.; Nielsen, U.S.; Panitz, F.; Aamand, G.P.; Schulman, N.; et al. A 660-Kb deletion with antagonistic effects on fertility and milk production segregates at high frequency in Nordic Red cattle: Additional evidence for the common occurrence of balancing selection in livestock. PLoS Genet. 2014, 10, e1004049. [Google Scholar] [CrossRef]
  39. Marini, C.; Hardies, K.; Pisano, T.; May, P.; Weckhuysen, S.; Cellini, E.; Suls, A.; Mei, D.; Balling, R.; Jonghe, P.D.; et al. Recessive mutations in SLC35A3 cause early onset epileptic encephalopathy with skeletal defects. Am. J. Med. Genet. A 2017, 173, 1119–1123. [Google Scholar] [CrossRef]
  40. Maszczak-Seneczko, D.; Sosicka, P.; Kaczmarek, B.; Majkowski, M.; Luzarowski, M.; Olczak, T.; Olczak, M. UDP-galactose (SLC35A2) and UDP-N-acetylglucosamine (SLC35A3) Transporters Form Glycosylation-related Complexes with Mannoside Acetylglucosaminyltransferases (Mgats). J. Biol. Chem. 2015, 290, 15475–15486. [Google Scholar] [CrossRef]
  41. Baralle, F.E.; Giudice, J. Alternative splicing as a regulator of development and tissue identity. Nat. Rev. Mol. Cell Biol. 2017, 18, 437–451. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Shaanbei white cashmere goats.
Figure 1. Shaanbei white cashmere goats.
Animals 10 00358 g001
Figure 2. (a) Sequence diagram of the rs665862918 mutations of the goat HIAT1 gene. (b) Analysis of the 15 bp indel sequence of the goat HIAT1 gene in reference to NC_030810.1. (c) Electrophoresis assay of the rs665862918 locus of the HIAT1 gene of goat (3% agarose gel electrophoresis). HD, heteroduplex.
Figure 2. (a) Sequence diagram of the rs665862918 mutations of the goat HIAT1 gene. (b) Analysis of the 15 bp indel sequence of the goat HIAT1 gene in reference to NC_030810.1. (c) Electrophoresis assay of the rs665862918 locus of the HIAT1 gene of goat (3% agarose gel electrophoresis). HD, heteroduplex.
Animals 10 00358 g002
Table 1. PCR primers used for detecting indels in the goat HIAT1 gene.
Table 1. PCR primers used for detecting indels in the goat HIAT1 gene.
PrimersLocationPrimer Sequences (5′ to 3′)Length (bp)Tm
rs658176778 5′ UTRF:ATAGCATGGACAGAGGAGCCT192/178TD-PCR
R:TCCCTGGTAAAGAACAGCAAG
rs665862918 IntronF:AGAGCCTCAGTTTCGCTTATT183/198TD-PCR
R:GAGTTTATGAATCCAGCAGTTGT
rs672419140IntronF:GGATGACAGAGGATGAGATGG137/145TD-PCR
R:CAGTCGTGTCTGACTCTTTGTG
rs668363704IntronF:GTTAGGCAGCAATAGCTCAAGG166/158TD-PCR
R:AAAACCCAACAAATGGAAGATG
TD-PCR: Touch-down PCR; Tm: melting temperature.
Table 2. PCR primers used for detecting indels in the goat HIAT1 gene.
Table 2. PCR primers used for detecting indels in the goat HIAT1 gene.
Genotype FrequenciesAllele FrequenciesHWEPopulation Parameters
p-ValueHoHeNePIC
DD0.639 (n = 647)I0.2030.5200.6770.3231.4780.271
ID0.317 (n = 321)
D0.797
II0.044 (n = 45)
Hardy–Weinberg equilibrium (HWE), homozygosity (Ho), heterozygosity (He), effective allele number (Ne), and polymorphism information content (PIC).
Table 3. The relationship between the HIAT1 gene and growth traits in Shaanbei white cashmere goats (p < 0.05/p < 0.01).
Table 3. The relationship between the HIAT1 gene and growth traits in Shaanbei white cashmere goats (p < 0.05/p < 0.01).
TraitsObserved Genotypes (Least Squares Means)p-Values
DD (647)ID (321)II (45)
BH (cm)56.22 ± 0.1856.48 ± 0.2857.76 ± 0.780.092
BL (cm)63.76 b ± 0.2064.29 a,b ± 0.3266.73 a ± 1.040.022
CW (cm)18.87 B ± 0.1419.85 A ± 0.2420.92 A ± 0.371.57 × 10−5
CD (cm)26.80 B ± 0.1427.48 A ± 0.2128.94 A ± 0.638.85 × 10−5
HG (cm)79.79 B ± 0.4483.53 A ± 0.6686.56 A ± 1.811.05 × 10−7
HHC (cm)58.58 b ± 0.2159.18 a,b ± 0.3560.81 a ± 0.870.023
CC (cm)7.85 ± 0.117.96 ± 0.058.10 ± 0.110.660
BH, body height; BL, body length; CW, chest width; CD, chest depth; HG, heart girth; HHC, height at hip cross; CC, cannon circumference [4]. (a, b, p < 0.05; A, B, p < 0.01). The rows in bold represent parameters with significant difference between different genotypes.

Share and Cite

MDPI and ACS Style

Gao, J.; Song, X.; Wu, H.; Tang, Q.; Wei, Z.; Wang, X.; Lan, X.; Zhang, B. Detection of rs665862918 (15-bp Indel) of the HIAT1 Gene and its Strong Genetic Effects on Growth Traits in Goats. Animals 2020, 10, 358. https://doi.org/10.3390/ani10020358

AMA Style

Gao J, Song X, Wu H, Tang Q, Wei Z, Wang X, Lan X, Zhang B. Detection of rs665862918 (15-bp Indel) of the HIAT1 Gene and its Strong Genetic Effects on Growth Traits in Goats. Animals. 2020; 10(2):358. https://doi.org/10.3390/ani10020358

Chicago/Turabian Style

Gao, Jiayang, Xiaoyue Song, Hui Wu, Qi Tang, Zhenyu Wei, Xinyu Wang, Xianyong Lan, and Bao Zhang. 2020. "Detection of rs665862918 (15-bp Indel) of the HIAT1 Gene and its Strong Genetic Effects on Growth Traits in Goats" Animals 10, no. 2: 358. https://doi.org/10.3390/ani10020358

APA Style

Gao, J., Song, X., Wu, H., Tang, Q., Wei, Z., Wang, X., Lan, X., & Zhang, B. (2020). Detection of rs665862918 (15-bp Indel) of the HIAT1 Gene and its Strong Genetic Effects on Growth Traits in Goats. Animals, 10(2), 358. https://doi.org/10.3390/ani10020358

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop