Effects of Single Nucleotide Polymorphisms in the SLC27A3 Gene on the Nutritional Value of Sheep Milk
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. SNP Detection and Genotyping
2.3. Assessment of Technological Suitability of Milk
2.4. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Balthazar, C.F.; Pimentel, T.C.; Ferrão, L.L.; Almada, C.N.; Santillo, A.; Albenzio, M.; Mollakhalili, N.; Mortazavian, A.M.; Nascimento, J.S.; Silva, M.C.; et al. Sheep milk: Physicochemical characteristics and relevance for functional food development. Compr. Rev. Food Sci. Food Saf. 2017, 16, 247–262. [Google Scholar] [CrossRef]
- Park, Y.W.; Juárez, M.; Ramosc, M.; Haenlein, G.F.W. Physico-chemical characteristics of goat and sheep milk. Small Rumin. Res. 2007, 68, 88–113. [Google Scholar] [CrossRef] [Green Version]
- Wendorff, W.L. Freezing qualities of raw ovine milk for further processing. J. Dairy Sci. 2001, 84, E74–E78. [Google Scholar] [CrossRef]
- Raynal-Ljutovac, K.; Park, Y.W.; Gaucheron, F.; Bouhallab, S. Heat stability and enzymatic modifications of goat and sheep milk. Small Rumin. Res. 2007, 68, 207–220. [Google Scholar] [CrossRef]
- Stegeman, G.A.; Baer, R.J.; Schingoethe, D.J.; Casper, D.P. Composition and flavour of milk and butter from cows fed unsaturated dietary fat and receiving bovine somatotropin. J. Dairy Sci. 1992, 75, 962–970. [Google Scholar] [CrossRef]
- Clarck, S.; Mora García, M.B. A 100-Year Review: Advances in goat milk research. J. Dairy Sci. 2017, 100, 10026–10044. [Google Scholar] [CrossRef]
- Cividini, A.; Simčič, M.; Stibilj, V.; Vidrih, M.; Potočnik, K. Changes in fatty acid profile of Bovec sheep milk due to different pasture altitude. Animal 2019, 13, 1111–1118. [Google Scholar] [CrossRef]
- Anderson, C.M.; Stahl, A. SLC27 fatty acid transport proteins. Mol. Aspects Med. 2013, 34, 516–528. [Google Scholar] [CrossRef] [Green Version]
- Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacterio¬phage T4. Nature 1970, 227, 680–685. [Google Scholar] [CrossRef]
- Pecka, E.; Dobrzański, Z.; Zachwieja, A.; Szulc, T.; Czyż, K. Studies of composition and major protein level in milk and colostrum of mares. Anim. Sci. J. 2012, 83, 162–168. [Google Scholar] [CrossRef]
- Christie, W.; William, S. Lipid Analysis. Isolation, Separation, Identification and Structural Analysis of Lipids. The Isolation of Lipids from Tissues; Pergamon Press: Oxford, UK, 1973; pp. 39–40. [Google Scholar]
- Christopherson, S.W.; Glass, R.L. Preparation of milk fat methyl esters by alcoholysis in an essentially nonalcoholic solution. J. Dairy Sci. 1969, 52, 1289–1290. [Google Scholar] [CrossRef]
- Yeh, F.C.; Yang, R.T.J.; Xiyan, J.M. PopGene32. Microsoft Window-based Freeware for Population Genetic Analysis, Version 1.32 (Software); University of Alberta: Edmonton, AB, Canada, 2000. [Google Scholar]
- Nei, M.; Roychoudhury, A.K. Sampling variances of heterozygosity and genetic distance. Genetics 1974, 76, 379–390. [Google Scholar] [PubMed]
- Botstein, D.; White, R.L.; Skolnik, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphism. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar] [PubMed]
- Oravcová, M.; Margetín, M.; Peškovičová, D.; Daňo, J.; Milerski, M.; Hetényi, L.; Polák, P. Factors affecting ewe’s milk fat and protein content and relationships between milk yield and milk components. Czech. J. Anim. Sci. 2007, 52, 189–198. [Google Scholar] [CrossRef] [Green Version]
- Viturro, E.; Schlattl, M.; Kienberger, H.; Rychlik, M.; Pfaffl, M.W.; Frölich, K. Differences in milk fat composition from four old sheep breeds. Arch. Anim. Breed. 2015, 58, 351–353. [Google Scholar] [CrossRef] [Green Version]
- Gantner, V.; Mijić, P.; Baban, M.; Škrtić, Z.; Turalija, A. The overall and fat composition of milk of various species. Mljekarstvo 2015, 65, 223–231. [Google Scholar] [CrossRef] [Green Version]
- Pecka-Kiełb, E.; Czerniawska-Piątkowska, E.; Kowalewska-Łuczak, I.; Vasil, M. Polymorphism in ovine ANXA9 gene and physic-chemical properties and the fraction of protein in milk. J. Sci. Food Agric. 2018, 98, 5396–5400. [Google Scholar] [CrossRef]
- Lopez, A.; Vasconi, M.; Moretti, V.M.; Bellagamba, F. Fatty acid profile in goat milk from high- and low input conventional and organic systems. Animals 2019, 9, 452. [Google Scholar] [CrossRef] [Green Version]
- Cannas, A.; Pes, A.; Mancuso, R.; Vodret, B.; Nudda, A. Effect of dietary energy and protein concentration on the concentration of milk urea nitrogen in dairy ewes. J. Dairy Sci. 1998, 81, 499–508. [Google Scholar] [CrossRef]
- Pelmus, R.S.; Pistol, G.C.; Lazarc, C.; Marin, D.E.; Gras, M.; Radu, M.; Ghita, E. Preliminary study on milk composition and milk protein polymorphism in the Romanian local sheep breed Teleorman Black Head Tsigai Romanian. Biotechnol. Lett. 2012, 17, 7582–7591. [Google Scholar]
- Mroczkowski, S.; Korman, K.; Erhardt, G.; Piwczyński, D.; Borys, B. Sheep milk protein polymorphism and its effect on milk performance of Polish Merino. Arch. Tierz. 2004, 47, 114–121. [Google Scholar]
- Othman, O.T.; Samia, A. El-Fiki; Nagwa, A.H.; Mahfouza, E.R.; Balabel, E.A. Genetic polymorphism detection of two α-Casein genes in three Egyptian sheep breeds. J. Genet. Eng. Biotechnol. 2013, 11, 129–134. [Google Scholar] [CrossRef] [Green Version]
- Selvaggi, M.; Laudadio, V.; Dario, C.; Tufarelli, V. Investigating the genetic polymorphism of sheep milk proteins: A useful tool for dairy production. J. Sci. Food Agric. 2014, 94, 3090–3099. [Google Scholar] [CrossRef] [PubMed]
- Nanekarani, S.; Kolivand, M.; Goodarzi, M. Polymorphism of a mutation of DGAT1 gene in Lori sheep breed. J. Adv. Agri. Tech. 2016, 3, 38–41. [Google Scholar] [CrossRef]
- Pascual, A.; Pineda-Quiroga, C.; Goiri, I.; Atxaerandio, R.; Ruiz, R.; García-Rodríguez, A. Effects of feeding UFA-rich cold-pressed oilseed cakes and sainfoin on dairy ewes’ milk fatty acid profile and curd sensory properties. Small Rum. Res. 2019, 175, 96–103. [Google Scholar] [CrossRef]
- Mele, M.; Conte, G.; Serra, A.; Buccioni, A.; Secchiari, P. Relationship between beta-lactoglobulin polymorphism and milk fatty acid composition in milk of Massese dairy ewes. Small Rum. Res. 2007, 73, 37–44. [Google Scholar] [CrossRef]
- Tăbăran, A.; Balteanu, V.A.; Gal, E.; Pusta, D.; Mihaiu, R.; Dan, S.D.; Tăbăran, A.F.; Mihaiu, M. Influence of DGAT1 K232A polymorphism on milk fat percentage and fatty acid profiles in Romanian Holstein cattle. Anim. Biotechnol. 2015, 26, 105–111. [Google Scholar] [CrossRef]
- Houaga, I.; Muigai, A.W.T.; Ng’ang’a, F.M.; Ibeagha-Awemu, E.M.; Kyallo, M.; Youssao, I.A.K.; Stomeo, F. Milk fatty acid variability and association with polymorphisms in SCD1 and DGAT1 genes in White Fulani and Borgou cattle breeds. Mol. Biol. Rep. 2018, 45, 1849–1862. [Google Scholar] [CrossRef] [Green Version]
- Mensink, R. Effects of Saturated Fatty Acids on Serum Lipids and Lipoproteins: A Systematic Review and Regression Analysis; World Health Organization: Geneva, Switzerland, 2016. [Google Scholar]
- DiNicolantonio, J.J.; O’Keefe, J.H. Effects of dietary fats on blood lipids: A review of direct comparison trials. Open Heart 2018, 25, e000871. [Google Scholar] [CrossRef] [Green Version]
- Mensink, R.P.; Zock, P.L.; Kester, A.D.; Katan, M.B. Effects of dietary fatty acids and carbohydrates on the ratio of serum total to HDL cholesterol and on serum lipids and apolipoproteins: A meta-analysis of 60 controlled trials. Am. J. Clin. Nutr. 2003, 77, 1146–1155. [Google Scholar] [CrossRef]
- Siri-Tarino, P.F.; Chiu, S.; Bergeron, N.; Krauss, R.M. Saturated fats versus polyunsaturated fats versus carbohydrates for cardiovascular disease prevention and treatment. Annu. Rev. Nutr. 2015, 35, 517–543. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Correddu, F.; Gaspa, G.; Pulina, G.; Nudda, A. Grape seed and linseed, alone and in combination, enhance unsaturated fatty acids in the milk of Sarda dairy sheep. J. Dairy Sci. 2016, 99, 1725–1735. [Google Scholar] [CrossRef] [PubMed]
- Patterson, E.; Wall, R.; Fitzgerald, G.F.; Ross, R.P.; Stanton, C. Health implications of high dietary omega-6 polyunsaturated Fatty acids. J. Nutr. Metab. 2012, 5, 539426. [Google Scholar] [CrossRef]
- DiRusso, C.C.; Darwis, D.; Obermeyer, T.; Black, P.N. Functional domains of the fatty acid transport proteins: Studies using protein chimeras. Biochim. Biophys. Acta 2008, 1781, 135–143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rost, B.; Yachdav, G.; Liu, J. The PredictProtein Server. Nucleic Acids Res. 2004, 32, W321–W326. [Google Scholar] [CrossRef]
- Calvo, J.H.; Martinez-Royo, A.; Beattie, A.E.; Dodds, K.G.; Marcos-Carcavilla, A.; Serrano, M. Fine mapping of genes on sheep chromosome 1 and their association with milk traits. Animal Genet. 2006, 37, 205–210. [Google Scholar] [CrossRef]
- Kowalewska-Łuczak, I.; Czerniawska-Piątkowska, E.; Pecka-Kiełb, E. Investigation on relationships of the FABP3 AND SLC27A3 genes with milk production traits in sheep. J. Elementol. 2017, 22, 1485–1493. [Google Scholar] [CrossRef]
SNP | Loci | Location/AA Change | Primer Sequence (5′–3′) | AT | AS | RE | PCR-RFLP Pattern (bp) |
---|---|---|---|---|---|---|---|
SNP1 | rs1090402056 c.754G > T | exon 2 Ala252Ser | F: GTAGAACTGCGGGGCTGTG R: AGGAGGTCATAGTTCCTGTTCC | 53 °C | 319 | Hpy188 III | 319/194, 125 |
SNP2 | rs600742549 c.958G > C | exon 3 Glu320Gln | F: GAGACAAGGCTTGGGTTCAG R: AGCCTCCTTCCTCTCCATTC | 53 °C | 354 | ScrFI | 222, 132/354 |
SNP3 | rs412479503 c.1096A > C | exon 4 Lys366Gln | F: TCTGGGAAGAAGGGAGTCAG R: TCTCCCCCTTCCATTTTCTT | 50 °C | 337 | Fnu4HI | 337/190, 147 |
SNP4 | rs593410192 c.1517T > A | exon 7 Val506Glu | F: CTCCAGGTTTGTGTCCAGGT R: TTTGGGTCCCAGAGATTCAG | 51 °C | 341 | AluI | 179,162/ 164,162,15 |
Polymorphism | n | Genotype Frequencies | Allele Frequencies | χ2 (HWE) | PIC | ||
---|---|---|---|---|---|---|---|
SNP1 | 19 15 16 | GG GT TT | 0.38 0.30 0.32 | G T | 0.53 0.47 | 7.91 * | 0.374 |
SNP2 | 15 23 12 | GG GC CC | 0.30 0.46 0.24 | G C | 0.53 0.47 | 0.294 ns | 0.374 |
SNP3 | 17 21 12 | AA AC CC | 0.34 0.42 0.24 | A C | 0.55 0.45 | 1.148 ns | 0.372 |
SNP4 | 15 22 13 | TT TA AA | 0.30 0.44 0.26 | T A | 0.52 0.48 | 0.703 ns | 0.375 |
Parameter | SNP1 | SNP2 | SNP3 | SNP4 | SEM | p-Value | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
GG | GT | TT | CC | GC | GG | AA | AC | CC | AA | TA | TT | |||
Fat 1 | 3.21 | 3.39 | 3.18 | 3.69 | 2.88 | 3.49 | 3.37 | 3.24 | 3.12 | 2.03 B | 3.05 B | 4.61 A | 1.107 | <0.001 |
Protein 1 | 5.55 | 5.78 | 5.46 | 5.69 | 5.38 b | 5.83 | 5.73 | 5.54 | 5.47 | 5.35 | 5.34 b | 6.16 a | 0.738 | 0.053 |
Lactose 1 | 5.49 | 5.62 | 5.56 | 5.37 | 5.61 | 5.60 | 5.56 | 5.56 | 5.54 | 6.00 Aa | 5.51 b | 5.22 B | 0.407 | 0.001 |
DM 1 | 14.95 | 15.53 | 14.90 | 15.49 | 14.55 | 15.65 | 15.38 | 15.05 | 14.83 | 14.04 B | 14.59 B | 16.79 A | 1.525 | <0.001 |
Urea 2 | 97.67 | 87.90 | 106.28 | 97.25 | 100.19 | 93.55 | 98.46 | 98.06 | 95.15 | 110.40 | 97.51 | 86.30 | 27.513 | 0.589 |
Protein Fractions | SNP1 | SNP2 | SNP3 | SNP4 | SEM | p-Value | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
GG | GT | TT | CC | GC | GG | AA | AC | CC | AA | TA | TT | |||
Serum albumin (%) | 14.26 | 14.08 | 13.16 | 13.06 | 14.48 | 13.52 | 13.86 | 14.32 | 13.03 | 13.70 | 14.69 | 12.76 | 3.426 | 0.846 |
α + β-casein (%) | 43.65 | 43.90 | 43.25 | 45.17 | 42.13 | 44.59 | 44.11 | 44.24 | 45.25 | 44.11 | 43.03 | 43.98 | 6.252 | 0.947 |
κ-casein (%) | 11.52 | 12.23 | 12.23 | 11.11 | 13.06 | 10.95 | 13.71 | 11.63 | 11.48 | 12.94 | 11.71 | 11.47 | 3.886 | 0.883 |
α-lactalbumin (%) | 10.92 | 11.55 | 12.61 | 10.46 | 12.06 | 11.96 | 10.64 | 12.82 | 11.02 | 13.21 | 11.60 | 10.37 | 3.989 | 0.565 |
Parameter | SNP1 | SNP2 | SNP3 | SNP4 | SEM | p-Value | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
GG | GT | TT | CC | GC | GG | AA | AC | CC | AA | TA | TT | |||
C4:0 1 | 0.58 | 0.63 | 0.59 | 0.67 | 0.55 | 0.60 | 0.72 | 0.55 | 0.48 | 0.54 | 0.56 | 0.70 | 0.226 | 0.124 |
C6:0 1 | 0.73 | 0.77 | 0.82 | 0.81 | 0.73 | 0.80 | 0.93 Aa | 0.73 b | 0.61 B | 0.74 | 0.72 | 0.87 | 0.184 | <0.001 |
C8:0 1 | 0.88 | 0.97 | 0.98 | 0.94 | 0.91 | 0.98 | 1.09 A | 0.93 | 0.74 B | 0.92 | 0.86 b | 1.08 a | 0.195 | <0.001 |
C10:0 1 | 3.04 | 3.40 | 3.47 | 3.14 | 3.19 | 3.56 | 3.82 A | 3.28 | 2.54 B | 3.25 | 2.99 b | 3.75 a | 0.696 | <0.001 |
C12:0 1 | 2.07 | 2.25 | 2.27 | 2.08 | 2.15 | 2.33 | 2.46 A | 2.19 a | 1.79 Bb | 2.19 | 2.06 | 2.38 | 0.361 | <0.001 |
C13:0 1 | 0.04 | 0.05 | 0.06 | 0.05 | 0.05 | 0.05 | 0.06 a | 0.05 | 0.03 b | 0.05 | 0.04 | 0.06 | 0.023 | 0.026 |
C14:0 1 | 7.63 | 7.78 | 8.05 | 7.27 B | 7.70 A | 8.41 | 8.55 Aa | 7.65 b | 7.04 B | 7.84 | 7.77 | 7.84 | 0.873 | <0.001 |
C15:0 1 | 1.03 | 1.09 | 1.13 | 1.12 | 1.07 | 1.08 | 1.15 | 1.09 | 0.97 | 1.06 | 1.05 | 1.15 | 0.161 | 0.105 |
C16:0 1 | 21.81 | 21.60 | 22.22 | 21.63 | 21.78 | 22.22 | 22.49 | 21.77 | 21.19 | 21.61 | 21.80 | 22.22 | 1.188 | 0.190 |
C17:0 1 | 1.00 | 1.08 | 1.01 | 1.07 | 1.03 | 0.99 | 1.02 | 1.03 | 1.03 | 1.05 | 1.03 | 0.99 | 0.110 | 0.359 |
C18:0 1 | 10.97 | 12.47 | 12.38 | 11.81 | 12.11 | 11.54 | 11.97 | 11.95 | 11.58 | 12.27 | 12.22 | 11.01 | 1.474 | 0.032 |
C20:0 1 | 0.29 B | 0.32 A | 0.35 | 0.32 | 0.32 | 0.31 | 0.34 | 0.32 | 0.28 | 0.31 | 0.32 | 0.32 | 0.048 | 0.014 |
ƩSFA | 50.04 Bb | 52.69 a | 53.30 A | 51.11 | 51.64 | 52.86 | 54.59 A | 51.73 B | 48.31 C | 51.83 | 51.40 | 52.62 | 2.528 | <0.001 |
Parameter | SNP1 | SNP2 | SNP3 | SNP4 | SEM | p-Value | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
GG | GT | TT | CC | GC | GG | AA | AC | CC | AA | TA | TT | |||
C14:1 1 | 0.54 | 0.56 | 0.60 | 0.57 | 0.55 | 0.58 | 0.62 A | 0.56 | 0.49 B | 0.52 | 0.56 | 0.62 | 0.091 | <0.001 |
C16:1 1 | 5.66 | 5.40 | 5.83 | 5.38 | 5.68 | 5.78 | 5.37 | 5.69 | 5.92 | 5.39 | 5.87 | 5.51 | 0.676 | 0.157 |
C17:1 1 | 0.53 | 0.48 | 0.48 | 0.51 | 0.51 | 0.48 | 0.46 b | 0.51 | 0.54 a | 0.51 | 0.51 | 0.48 | 0.060 | 0.002 |
C18:1n9c 1 | 23.64 A | 22.45 | 21.21 B | 22.95 | 22.33 | 22.41 | 21.27 b | 22.45 | 24.34 a | 23.00 | 22.30 | 22.36 | 1.979 | <0.001 |
C18:1n9t 1 | 1.75 | 1.87 | 2.00 | 1.74 | 1.96 | 1.83 | 1.68 | 1.92 | 2.04 | 1.86 | 2.01 | 1.66 | 0.399 | 0.050 |
C18:1n7t 1 | 2.25 A | 2.16 | 1.92 B | 2.26 a | 2.14 | 1.96 b | 2.02 | 2.09 | 2.31 | 2.21 | 2.10 | 2.06 | 0.258 | <0.001 |
C18:2n6c 1 | 1.87 | 1.77 | 1.68 | 2.14 A | 1.77 Ba | 1.50 Bb | 1.66 | 1.85 | 1.82 | 1.78 | 1.76 | 1.80 | 0.261 | <0.001 |
CLA 1 | 1.46 A | 1.19 B | 1.00 B | 1.33 | 1.24 | 1.14 | 1.13 B | 1.20 b | 1.42 Aa | 1.26 | 1.22 | 1.22 | 0.215 | <0.001 |
C18:3n3 1 | 1.54 | 1.48 | 1.48 | 1.71 A | 1.50 | 1.35 B | 1.43 | 1.56 | 1.51 | 1.53 | 1.50 | 1.49 | 0.201 | 0.004 |
C20:1 1 | 0.08 | 0.07 | 0.07 | 0.08 | 0.07 | 0.07 | 0.07 | 0.08 | 0.06 | 0.08 | 0.07 | 0.07 | 0.028 | 0.816 |
C20:4n6 1 | 0.10 | 0.10 | 0.10 | 0.12 | 0.10 | 0.09 | 0.10 | 0.11 | 0.09 | 0.10 | 0.09 | 0.11 | 0.031 | 0.134 |
EPA 1 | 0.07 | 0.09 | 0.08 | 0.09 | 0.09 | 0.07 | 0.08 | 0.09 | 0.08 | 0.08 | 0.08 | 0.08 | 0.024 | 0.608 |
ƩUFA | 40.48 A | 38.42 | 37.22 B | 39.74 | 38.87 | 38.00 | 36.65 Bb | 38.90 Ba | 41.74 A | 39.07 | 38.89 | 38.49 | 2.294 | <0.001 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pecka-Kiełb, E.; Kowalewska-Łuczak, I.; Czerniawska-Piątkowska, E.; Zielak-Steciwko, A.E. Effects of Single Nucleotide Polymorphisms in the SLC27A3 Gene on the Nutritional Value of Sheep Milk. Animals 2020, 10, 562. https://doi.org/10.3390/ani10040562
Pecka-Kiełb E, Kowalewska-Łuczak I, Czerniawska-Piątkowska E, Zielak-Steciwko AE. Effects of Single Nucleotide Polymorphisms in the SLC27A3 Gene on the Nutritional Value of Sheep Milk. Animals. 2020; 10(4):562. https://doi.org/10.3390/ani10040562
Chicago/Turabian StylePecka-Kiełb, Ewa, Inga Kowalewska-Łuczak, Ewa Czerniawska-Piątkowska, and Anna E. Zielak-Steciwko. 2020. "Effects of Single Nucleotide Polymorphisms in the SLC27A3 Gene on the Nutritional Value of Sheep Milk" Animals 10, no. 4: 562. https://doi.org/10.3390/ani10040562