Nisin as a Novel Feed Additive: The Effects on Gut Microbial Modulation and Activity, Histological Parameters, and Growth Performance of Broiler Chickens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Birds and Housing
2.2. Diets and Feeding Program
2.3. Preparation of Nisin
2.4. Data and Sample Collection
2.5. Analysis of the Microbial Community and Its Activity
2.6. Histological Analyses
2.7. Statistical Analysis
3. Results
3.1. Experiment 1
3.2. Experiment 2
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Churklam, W.; Chaturongakul, S.; Ngamwongsatit, B.; Aunpad, R. The mechanisms of action of carvacrol and its synergism with nisin against Listeria monocytogenes on sliced bologna sausage. Food Control 2020, 108, 106864. [Google Scholar] [CrossRef]
- Saad, M.A.; Ombarak, R.A.; Abd Rabou, H.S. Effect of nisin and lysozyme on bacteriological and sensorial quality of pasteurized milk. J. Adv. Vet. Anim. Res. 2019, 6, 403–408. [Google Scholar] [CrossRef] [PubMed]
- Gokoglu, N. Novel natural food preservatives and applications in seafood preservation: A review. J. Sci. Food Agric. 2019, 99, 2068–2077. [Google Scholar] [CrossRef] [PubMed]
- Lopetuso, L.R.; Giorgio, M.E.; Saviano, A.; Scaldaferri, F.; Gasbarrini, A.; Cammarota, G. Bacteriocins and Bacteriophages: Therapeutic Weapons for Gastrointestinal Diseases? Int. J. Mol. Sci. 2019, 20, 183. [Google Scholar] [CrossRef] [Green Version]
- Chikindas, M.L.; Weeks, R.; Drider, D.; Chistyakov, V.A.; Dicks, L.M.T. Functions and emerging applications of bacteriocins. Curr. Opin. Biotechnol. 2018, 49, 23–28. [Google Scholar] [CrossRef]
- Bédard, F.; Hammami, R.; Zirah, S.; Rebuffat, S.; Fliss, I.; Biron, E. Synthesis, antimicrobial activity and conformational analysis of the class IIa bacteriocin pediocin PA-1 and analogs thereof. Sci. Rep. 2018, 8, 9029. [Google Scholar] [CrossRef] [Green Version]
- Juturu, V.; Wu, J.C. Microbial production of bacteriocins: Latest research development and applications. Biotechnol. Adv. 2018, 36, 2187–2200. [Google Scholar] [CrossRef]
- Field, D.; Blake, T.; Mathur, H.; O’Connor, P.M.; Cotter, P.D.; Paul Ross, R.; Hill, C. Bioengineering nisin to overcome the nisin resistance protein. Mol. Microbiol. 2019, 111, 717–731. [Google Scholar] [CrossRef]
- Józefiak, D.; Sip, A. Bacteriocins in poultry nutrition—A review. Ann. Anim. Sci. 2013, 13, 449–462. [Google Scholar] [CrossRef] [Green Version]
- Register, F. Nisin preparation: Affirmation of GRAS status as a direct human food ingredient. Fed. Regist. 1988, 53, 11247–11251. [Google Scholar]
- EEC. Commission Directive 83/463/EEC; E.E.C: Luxembourg, 1983. [Google Scholar]
- Aguilar, F.; Autrup, H.; Barlow, S.; Castle, L.; Crebelli, R.; Dekant, W.; Engel, K.-H.; Gontard, N.; Gott, D.; Grilli, S. Opinion of the Scientific Panel on Food Additives, Flavourings, Processing Aids and Materials in Contact with Food on the safety in use of nisin as a food additive in an additional category of liquid eggs and on the safety of nisin produced using a modifi. EFSA J. 2006, 4, 314. [Google Scholar]
- Chollet, E.; Sebti, I.; Martial-Gros, A.; Degraeve, P. Nisin preliminary study as a potential preservative for sliced ripened cheese: NaCl, fat and enzymes influence on nisin concentration and its antimicrobial activity. Food Control 2008, 19, 982–989. [Google Scholar] [CrossRef]
- Rameshkumar, N.; Govindarajan, R.K.; Krishnan, M.; Kayalvizhi, N. Scope of Bacteriocins as a Viable Alternative to the Traditional Antibiotics. Adv. Plants Agric. Res. 2016, 5, 1–3. [Google Scholar]
- Kierończyk, B.; Sassek, M.; Pruszyńska-Oszmałek, E.; Kolodziejski, P.; Rawski, M.; Światkiewicz, S.; Józefiak, D. The physiological response of broiler chickens to the dietary supplementation of the bacteriocin nisin and ionophore coccidiostats. Poult. Sci. 2017, 96, 4026–4037. [Google Scholar] [CrossRef]
- Kierończyk, B.; Pruszyńska-Oszmałek, E.; Świątkiewicz, S.; Rawski, M.; Długosz, J.; Engberg, E.M.; Józefiak, D. The nisin improves broiler chicken growth performance and interacts with salinomycin in terms of gastrointestinal tract microbiota composition. J. Anim. Feed Sci. 2016, 25, 309–316. [Google Scholar] [CrossRef]
- Bernbom, N.; Licht, T.R.; Brogren, C.-H.; Jelle, B.; Johansen, A.H.; Badiola, I.; Vogensen, F.K.; Nørrung, B. Effects of Lactococcus lactis on composition of intestinal microbiota: Role of nisin. Appl. Environ. Microbiol. 2006, 72, 239–244. [Google Scholar] [CrossRef] [Green Version]
- Santoso, B.; Mwenya, B.; Sar, C.; Takahashi, J. Ruminal fermentation and nitrogen metabolism in sheep fed a silage-based diet supplemented with Yucca schidigera or Y. schidigera and nisin. Anim. Feed Sci. Technol. 2006, 129, 187–195. [Google Scholar] [CrossRef]
- Van Staden, D.A.; Brand, A.M.; Endo, A.; Dicks, L.M.T. Nisin F, intraperitoneally injected, may have a stabilizing effect on the bacterial population in the gastro-intestinal tract, as determined in a preliminary study with mice as model. Lett. Appl. Microbiol. 2011, 53, 198–201. [Google Scholar] [CrossRef]
- Lauková, A.; Chrastinová, Ľ.; Plachá, I.; Kandričáková, A.; Szabóová, R.; Strompfová, V.; Chrenková, M.; Čobanová, K.; Žitňan, R. Beneficial Effect of Lantibiotic Nisin in Rabbit Husbandry. Probiotics Antimicrob. Proteins 2014, 6, 41–46. [Google Scholar] [CrossRef]
- Gough, R.; O’Connor, P.M.; Rea, M.C.; Gómez-Sala, B.; Miao, S.; Hill, C.; Brodkorb, A. Simulated gastrointestinal digestion of nisin and interaction between nisin and bile. LWT Food Sci. Technol. 2017, 86, 530–537. [Google Scholar] [CrossRef] [Green Version]
- Chan, W.C.; Leyland, M.; Clark, J.; Dodd, H.M.; Lian, L.-Y.; Gasson, M.J.; Bycroft, B.W.; Roberts, G.C.K. Structure-activity relationships in the peptide antibiotic nisin: Antibacterial activity of fragments of nisin. FEBS Lett. 1996, 390, 129–132. [Google Scholar] [CrossRef]
- Józefiak, D.; Kierończyk, B.; Juśkiewicz, J.; Zduńczyk, Z.; Rawski, M.; Długosz, J.; Sip, A.; Højberg, O. Dietary nisin modulates the gastrointestinal microbial ecology and enhances growth performance of the broiler chickens. PLoS ONE 2013, 8, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Onder Ustundag, A.; Ozdogan, M. Effects of bacteriocin and organic acid on growth performance, small intestine histomorphology, and microbiology in Japanese quails (Coturnix coturnix japonica). Trop. Anim. Health Prod. 2019, 51, 2187–2192. [Google Scholar] [CrossRef] [PubMed]
- Ozdogan, M.; Ustundag, A.O. Effects of bacteriocin and organic acids on growth performance of Japanese quails. Sci. Pap. Ser. D Anim. Sci. Int. Sess. Sci. Commun. Fac. Anim. Sci. 2015, 58, 164–169. [Google Scholar]
- Younes, M.; Aggett, P.; Aguilar, F.; Crebelli, R.; Dusemund, B.; Filipič, M.; Frutos, M.J.; Galtier, P.; Gundert-Remy, U.; Kuhnle, G.G.; et al. Safety of nisin (E 234) as a food additive in the light of new toxicological data and the proposed extension of use. EFSA J. 2017, 15, 5063. [Google Scholar]
- Council, N.R. Nutrient Requirements of Poultry: 1994; National Academies Press: Washington, DC, USA, 1994. [Google Scholar]
- Drew, M.D.; Syed, N.A.; Goldade, B.G.; Laarveld, B.; Van Kessel, A.G. Effects of dietary protein source and level on intestinal populations of Clostridium perfringens in broiler chickens. Poult. Sci. 2004, 83, 414–420. [Google Scholar] [CrossRef]
- Knarreborg, A.; Simon, M.A.; Engberg, R.M.; Jensen, B.B.; Tannock, G.W. Effects of dietary fat source and subtherapeutic levels of antibiotic on the bacterial community in the ileum of broiler chickens at various ages. Appl. Environ. Microbiol. 2002, 68, 5918–5924. [Google Scholar] [CrossRef] [Green Version]
- Kaldhusdal, M.; Hofshagen, M.; Løvland, A.; Langstrand, H.; Redhead, K. Necrotic enteritis challenge models with broiler chickens raised on litter: Evaluation of preconditions, Clostridium perfringens strains and outcome variables. FEMS Immunol. Med. Microbiol. 1999, 24, 337–343. [Google Scholar] [CrossRef] [Green Version]
- Rawski, M.; Kierończyk, B.; Długosz, J.; Świątkiewicz, S.; Jozefiak, D. Dietary probiotics affect gastrointestinal microbiota, histological structure and shell mineralization in turtles. PLoS ONE 2016, 11, e0147859. [Google Scholar] [CrossRef] [Green Version]
- Canibe, N.; Højberg, O.; Badsberg, J.H.; Jensen, B.B. Effect of feeding fermented liquid feed and fermented grain on gastrointestinal ecology and growth performance in piglets. J. Anim. Sci. 2007, 85, 2959–2971. [Google Scholar] [CrossRef] [Green Version]
- Sghir, A.; Gramet, G.; Suau, A.; Rochet, V.; Pochart, P.; Dore, J. Quantification of bacterial groups within human fecal flora by oligonucleotide probe hybridization. Appl. Environ. Microbiol. 2000, 66, 2263–2266. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Manz, W.; Amann, R.; Ludwig, W.; Vancanneyt, M.; Schleifer, K.-H. Application of a suite of 16S rRNA-specific oligonucleotide probes designed to investigate bacteria of the phylum cytophaga-flavobacter-bacteroides in the natural environment. Microbiology 1996, 142, 1097–1106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Franks, A.H.; Harmsen, H.J.M.; Raangs, G.C.; Jansen, G.J.; Schut, F.; Welling, G.W. Variations of bacterial populations in human feces measured by fluorescent in situ hybridization with group-specific 16S rRNA-targeted oligonucleotide probes. Appl. Environ. Microbiol. 1998, 64, 3336–3345. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fallani, M.; Rigottier-Gois, L.; Aguilera, M.; Bridonneau, C.; Collignon, A.; Edwards, C.A.; Corthier, G.; Doré, J. Clostridium difficile and Clostridium perfringens species detected in infant faecal microbiota using 16S rRNA targeted probes. J. Microbiol. Methods 2006, 67, 150–161. [Google Scholar] [CrossRef] [PubMed]
- Harmsen, H.J.M.; Elfferich, P.; Schut, F.; Welling, G.W. A 16S rRNA-targeted probe for detection of lactobacilli and enterococci in faecal samples by fluorescent in situ hybridization. Microb. Ecol. Health Dis. 1999, 11, 3–12. [Google Scholar]
- Peinado, M.J.; Ruiz, R.; Echávarri, A.; Rubio, L.A. Garlic derivative propyl propane thiosulfonate is effective against broiler enteropathogens in vivo. Poult. Sci. 2012, 91, 2148–2157. [Google Scholar] [CrossRef]
- Wu, J.; Hu, S.; Cao, L. Therapeutic effect of nisin Z on subclinical mastitis in lactating cows. Antimicrob. Agents Chemother. 2007, 51, 3131–3135. [Google Scholar] [CrossRef] [Green Version]
- Cao, L.T.; Wu, J.Q.; Xie, F.; Hu, S.H.; Mo, Y. Efficacy of nisin in treatment of clinical mastitis in lactating dairy cows. J. Dairy Sci. 2007, 90, 3980–3985. [Google Scholar] [CrossRef]
- Tong, Z.; Dong, L.; Zhou, L.; Tao, R.; Ni, L. Nisin inhibits dental caries-associated microorganism in vitro. Peptides 2010, 31, 2003–2008. [Google Scholar] [CrossRef]
- Ahmadi, S.; Ghollasi, M.; Hosseini, H.M. The apoptotic impact of nisin as a potent bacteriocin on the colon cancer cells. Microb. Pathog. 2017, 111, 193–197. [Google Scholar] [CrossRef]
- Heunis, T.D.J.; Smith, C.; Dicks, L.M.T. Evaluation of a nisin-eluting nanofiber scaffold to treat Staphylococcus aureus-induced skin infections in mice. Antimicrob. Agents Chemother. 2013, 57, 3928–3935. [Google Scholar] [CrossRef] [Green Version]
- Jarvis, B.; Mahoney, R.R. Inactivation of nisin by alpha-chymotrypsin. J. Dairy Sci. 1969, 52, 1448–1450. [Google Scholar] [CrossRef]
- Heinemann, B.; Williams, R. Inactivation of nisin by pancreatin. J. Dairy Sci. 1966, 49, 312–314. [Google Scholar] [CrossRef]
- Masuda, N. Deconjugation of bile salts by Bacteroides and Clostridium. Microbiol. Immunol. 1981, 25, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Klaver, F.A.; Van der Meer, R. The assumed assimilation of cholesterol by Lactobacilli and Bifidobacterium bifidum is due to their bile salt-deconjugating activity. Appl. Environ. Microbiol. 1993, 59, 1120–1124. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cotter, P.D.; Hill, C.; Ross, R.P. Bacteriocins: Developing innate immunity for food. Nat. Rev. Microbiol. 2005, 3, 777–788. [Google Scholar] [CrossRef]
- Kierończyk, B.; Rawski, M.; Długosz, J.; Świątkiewicz, S.; Józefiak, D. Avian crop function—A review. Ann. Anim. Sci. 2016, 16, 653–678. [Google Scholar] [CrossRef] [Green Version]
- Yeoman, C.J.; Chia, N.; Jeraldo, P.; Sipos, M.; Goldenfeld, N.D.; White, B.A. The microbiome of the chicken gastrointestinal tract. Anim. Health Res. Rev. 2012, 13, 89–99. [Google Scholar] [CrossRef] [Green Version]
- Oakley, B.B.; Lillehoj, H.S.; Kogut, M.H.; Kim, W.K.; Maurer, J.J.; Pedroso, A.; Lee, M.D.; Collett, S.R.; Johnson, T.J.; Cox, N.A. The chicken gastrointestinal microbiome. FEMS Microbiol. Lett. 2014, 360, 100–112. [Google Scholar] [CrossRef]
- Józefiak, D.; Rutkowski, A.; Martin, S.A. Carbohydrate fermentation in the avian ceca: A review. Anim. Feed Sci. Technol. 2004, 113, 1–15. [Google Scholar] [CrossRef]
- Terada, A.; Hara, H.; Sakamoto, J.; Sato, N.; Takagi, S.; Mitsuoka, T.; Mino, R.; Hara, K.; Fujimori, I.; Yamada, T. Effects of dietary supplementation with lactosucrose (4G-β-D-Galactosylsucrose) on cecal flora, cecal metabolites, and performance in broiler chickens. Poult. Sci. 1994, 73, 1663–1672. [Google Scholar] [CrossRef] [PubMed]
- Zduńczyk, Z.; Jankowski, J.; Rutkowski, A.; Sosnowska, E.; Drażbo, A.; Zduńczyk, P.; Juśkiewicz, J. The composition and enzymatic activity of gut microbiota in laying hens fed diets supplemented with blue lupine seeds. Anim. Feed Sci. Technol. 2014, 191, 57–66. [Google Scholar] [CrossRef]
- Corrier, D.E.; Hinton, A., Jr.; Ziprin, R.L.; Beier, R.C.; DeLoach, J.R. Effect of dietary lactose on cecal pH, bacteriostatic volatile fatty acids, and Salmonella typhimurium colonization of broiler chicks. Avian Dis. 1990, 617–625. [Google Scholar] [CrossRef]
- Leeson, S.; Namkung, H.; Antongiovanni, M.; Lee, E.H. Effect of butyric acid on the performance and carcass yield of broiler chickens. Poult. Sci. 2005, 84, 1418–1422. [Google Scholar] [CrossRef]
- Józefiak, D.; Sip, A.; Rawski, M.; Steiner, T.; Rutkowski, A. The dose response effects of liquid and lyophilized Carnobacterium divergens AS7 bacteriocin on the nutrient retention and performance of broiler chickens. Food Microbiol. 2011, 401–412. [Google Scholar] [CrossRef]
- Józefiak, D.; Sip, A.; Rawski, M.; Rutkowski, A.; Kaczmarek, S.; Højberg, O.; Jensen, B.B.; Engberg, R.M. Dietary divercin modifies gastrointestinal microbiota and improves growth performance in broiler chickens. Br. Poult. Sci. 2011, 52, 492–499. [Google Scholar] [CrossRef]
- Cole, K.; Farnell, M.B.; Donoghue, A.M.; Stern, N.J.; Svetoch, E.A.; Eruslanov, B.N.; Volodina, L.I.; Kovalev, Y.N.; Perelygin, V.V.; Mitsevich, E.V. Bacteriocins reduce Campylobacter colonization and alter gut morphology in turkey poults. Poult. Sci. 2006, 85, 1570–1575. [Google Scholar] [CrossRef]
- Wang, H.; Yu, C.; Hsieh, Y.; Chen, S.; Chen, B.; Chen, C. Effects of albusin B (a bacteriocin) of Ruminococcus albus 7 expressed by yeast on growth performance and intestinal absorption of broiler chickens—its potential role as an alternative to feed antibiotics. J. Sci. Food Agric. 2011, 91, 2338–2343. [Google Scholar] [CrossRef]
Ingredient, g·kg−1 | Diets | |
---|---|---|
1–14 d | 15–35 d | |
Wheat | 468.7 | 487.5 |
Rye | 100.0 | 100.0 |
Rapeseed meal 34.0% | 100.0 | 100.0 |
Soybean meal 46.8% | 222.2 | 186.8 |
Fish meal 64% | 20.0 | 20.0 |
Pig lard | 55.7 | 79.8 |
Vitamin-mineral premix 1 | 3.0 | 3.0 |
Dicalcium phosphate | 19.5 | 12.5 |
Limestone | 1.0 | 1.6 |
NaCl | 1.4 | 1.6 |
Na2CO3 | 1.5 | 1.0 |
L-Lysine | 2.4 | 2.1 |
DL-Methionine | 3.2 | 2.6 |
L-Threonine | 1.4 | 1.5 |
Calculated nutritive value, g·kg−1 | ||
AMEN (MJ/kg) 2 | 12.3 | 13.3 |
Crude protein | 215.0 | 200.0 |
Crude fat | 71.0 | 94.8 |
Crude fiber | 33.3 | 32.3 |
Calcium | 8.5 | 7.0 |
Lysine | 12.5 | 11.3 |
Methionine | 6.1 | 5.4 |
Methionine + cystine | 3.8 | 3.6 |
Threonine | 9.9 | 9.0 |
Target | Probe | Sequence (5′ to 3′) | References |
---|---|---|---|
Enterobacteriaceae | Enter1432 | CTT TTG CAA CCC ACT | [33] |
Bacteroides-Prevotella cluster | Bac303 | CCAATGTGGGGGACCTT | [34] |
Clostridium leptum subgroup | Clept1240 | GTTTTRTCAACGGCAGTC | [33] |
Clostridium coccoides-Eubacterium rectale cluster | Erec482 | GCTTCTTAGTCARGTACCG | [35] |
Clostridium perfringens | Cperf191 | GTAGTAAGTTGGTTTCCTCG | [36] |
Lactobacillus sp./Enterococcus sp. | Lab158 | GGTATTAGCAYCTGTTTCCA | [37] |
Item | Treatments | Main Effects | p-Value | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NA 1 | MON 2 | NIS 3 | MON + NIS 4 | RMSE 5 | MON | NIS | Effect of Treatments | Interaction | |||||
− | + | − | + | MON | NIS | MON × NIS | |||||||
Crop | 5.10 | 5.27 | 4.97 | 5.08 | 0.29 | 5.04 | 5.18 | 5.19 | 5.03 | 0.322 | 0.248 | 0.850 | |
Jejunum | 5.77 | 6.43 | 6.59 | 6.91 | 0.37 | 6.20 b | 6.67 a | 6.11 b | 6.75 a | 0.003 | <0.001 | 0.289 | |
Ceca | 6.45 | 6.25 | 6.39 | 5.79 | 0.22 | 6.41 a | 6.02 b | 6.35 a | 6.09 b | 0.002 | 0.039 | 0.105 |
Item | Treatments | RMSE 5 | Main Effects | p-Value | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
NA 1 | MON 2 | NIS 3 | MON + NIS 4 | MON | NIS | Effect of Treatments | Interaction | |||||
− | + | − | + | MON | NIS | MON × NIS | ||||||
DAPI | 9.65 a | 9.39 b | 9.28 c | 9.27 c | 0.16 | 9.46 a | 9.33 b | 9.52 a | 9.28 b | <0.001 | <0.001 | <0.001 |
Enterobacteriaceae | 8.78 a | 8.52 b | 8.29 c | 8.35 c | 0.16 | 8.53 a | 8.43 b | 8.65 a | 8.32 b | 0.007 | <0.001 | <0.001 |
Bacteroides-Prevotella cluster | 8.86 | 8.84 | 8.79 | 8.86 | 0.17 | 8.82 | 8.85 | 8.85 | 8.82 | 0.464 | 0.391 | 0.213 |
Clostridium perfringens | 8.87 a | 8.68 b | 8.46 c | 8.58 b | 0.18 | 8.66 | 8.63 | 8.77 a | 8.52 b | 0.405 | <0.001 | <0.001 |
Lactobacillus sp./Enterococcus sp. | 8.99 a | 8.77 b | 8.77 b | 8.97 a | 0.18 | 8.89 | 8.87 | 8.88 | 8.88 | 0.588 | 0.909 | <0.001 |
Clostridium leptum subgroup | 8.90 | 8.80 | 8.64 | 8.62 | 0.17 | 8.77 | 8.71 | 8.85 a | 8.63 b | 0.129 | <0.001 | 0.318 |
Clostridium coccoides-Eubacterium rectale cluster | 9.14 | 8.98 | 8.80 | 8.73 | 0.16 | 8.97 a | 8.85 b | 9.06 a | 8.77 b | 0.002 | <0.001 | 0.198 |
Item | Treatments | RMSE 5 | Main Effects | p-Value | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
NA 1 | MON 2 | NIS 3 | MON + NIS 4 | MON | NIS | Effect of Treatments | Interaction | |||||
− | + | − | + | MON | NIS | MON × NIS | ||||||
DAPI | 11.01 | 11.07 | 11.06 | 11.17 | 0.14 | 11.0 b | 11.11 a | 11.04 b | 11.12 a | 0.012 | 0.011 | 0.468 |
Enterobacteriaceae | 10.48 a | 9.52 c | 9.63 b,c | 9.73 b | 0.28 | 10.08 a | 9.61 b | 9.94 a | 9.68 b | <0.001 | <0.001 | <0.001 |
Bacteroides-Prevotella cluster | 10.44 a | 9.86 b | 9.78 b | 9.79 b | 0.23 | 10.14 a | 9.83 b | 10.11 a | 9.79 b | <0.001 | <0.001 | <0.001 |
Clostridium perfringens | 10.68 a | 9.68 c | 9.66 c | 9.82 b | 0.18 | 10.21 a | 9.75 b | 10.13 a | 9.75 b | <0.001 | <0.001 | <0.001 |
Lactobacillus sp./Enterococcus sp. | 10.73 a | 9.82 c | 9.88 c | 10.11 b | 0.13 | 10.34 a | 9.95 b | 10.22 a | 10.01 b | <0.001 | <0.001 | <0.001 |
Clostridium leptum subgroup | 10.46 a | 9.83 b,c | 9.71 b | 9.86 b | 0.23 | 10.11 a | 9.84 b | 10.11 a | 9.80 b | <0.001 | <0.001 | <0.001 |
Clostridium coccoides-Eubacterium rectale cluster | 10.57 a | 10.23 b | 10.05 c | 10.2 b | 0.18 | 10.33 a | 10.23 b | 10.38 a | 10.14 b | 0.010 | <0.001 | <0.001 |
Item | Treatments | RMSE 5 | Main Effects | p-Value | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
NA 1 | MON 2 | NIS 3 | MON + NIS 4 | MON | NIS | Effects of Treatments | Interaction | |||||
− | + | − | + | MON | NIS | MON × NIS | ||||||
Acetic acid | 2.13 | 1.86 | 1.62 | 1.71 | 0.43 | 1.86 | 1.79 | 1.99 a | 1.67 b | 0.537 | 0.024 | 0.211 |
Propionic acid | 0.12 | 0.05 | 0.02 | 0.03 | 0.11 | 0.07 | 0.04 | 0.09 | 0.03 | 0.358 | 0.097 | 0.339 |
Iso-butyric acid | 0.00 | 0.04 | 0.00 | <0.01 | 0.04 | 0.00 | 0.02 | 0.02 | <0.01 | 0.104 | 0.153 | 0.177 |
Butyric acid | 0.03 | 0.19 | 0.03 | 0.03 | 0.25 | 0.03 | 0.11 | 0.11 | 0.03 | 0.358 | 0.302 | 0.330 |
Iso-valeric acid | 0.54 | 0.09 | 0.08 | 0.09 | 0.69 | 0.30 | 0.09 | 0.30 | 0.08 | 0.333 | 0.326 | 0.296 |
Valeric acid | 0.01 | 0.01 | <0.01 | 0.02 | 0.03 | 0.01 | 0.02 | 0.01 | 0.01 | 0.332 | 0.912 | 0.422 |
Sum of VFA 6 | 2.83 | 2.24 | 1.76 | 1.87 | 0.78 | 2.27 | 2.06 | 2.52 a | 1.81 b | 0.363 | 0.007 | 0.164 |
Profile C2 7, % | 83.47 | 85.19 | 92.18 | 91.32 | 12.99 | 88.05 | 88.26 | 84.38 | 91.75 | 0.925 | 0.085 | 0.759 |
Profile C3 8, % | 4.96 | 2.71 | 1.41 | 1.44 | 4.62 | 3.09 | 1.97 | 3.77 | 1.34 | 0.435 | 0.108 | 0.479 |
Profile C4 9, % | 1.12 | 5.95 | 1.69 | 0.41 | 7.24 | 1.42 | 3.70 | 3.66 | 1.57 | 0.345 | 0.372 | 0.281 |
Item | Treatments | RMSE 5 | Main Effects | p-Value | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
NA 1 | MON 2 | NIS 3 | MON + NIS 4 | MON | NIS | Effects of Treatments | Interaction | |||||
− | + | − | + | MON | NIS | MON × NIS | ||||||
Acetic acid | 45.34 | 62.11 | 66.68 | 66.64 | 19.29 | 56.58 | 64.37 | 54.17 b | 66.66 a | 0.197 | 0.050 | 0.183 |
Propionic acid | 4.15 | 4.60 | 5.60 | 4.45 | 2.32 | 4.92 | 4.52 | 4.39 | 5.02 | 0.615 | 0.397 | 0.288 |
Iso-butyric acid | 0.46 | 0.54 | 0.95 | 0.37 | 0.55 | 0.72 | 0.46 | 0.50 | 0.66 | 0.155 | 0.373 | 0.065 |
Butyric acid | 10.05 | 15.49 | 14.72 | 18.09 | 6.023 | 12.51 b | 16.79 a | 12.91 | 16.40 | 0.030 | 0.079 | 0.595 |
Iso-valeric acid | 0.74 | 0.67 | 0.78 | 0.60 | 0.18 | 0.77 a | 0.64 b | 0.70 | 0.70 | 0.050 | 0.977 | 0.367 |
Valeric acid | 0.94 | 1.05 | 1.07 | 1.02 | 0.24 | 1.02 | 1.04 | 1.01 | 1.05 | 0.720 | 0.587 | 0.321 |
Sum of VFA 6 | 61.30 | 84.46 | 89.81 | 91.00 | 26.90 | 76.31 | 87.73 | 73.49 | 90.41 | 0.177 | 0.058 | 0.211 |
Profile C2 7, % | 57.67 | 73.93 | 74.21 | 66.16 | 19.73 | 66.38 | 70.05 | 66.23 | 70.18 | 0.554 | 0.536 | 0.063 |
Profile C3 8, % | 5.33 | 5.55 | 6.35 | 4.32 | 2.33 | 5.86 | 4.94 | 5.45 | 5.33 | 0.221 | 0.881 | 0.141 |
Profile C4 9, % | 12.54 | 17.80 | 16.33 | 17.69 | 5.25 | 14.54 | 17.74 | 15.31 | 17.01 | 0.061 | 0.317 | 0.254 |
Item | Treatments | RMSE 5 | Main Effects | p-Value | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
NA 1 | MON 2 | NIS 3 | MON + NIS 4 | MON | NIS | Effects of Treatments | Interaction | |||||
− | + | 2212 | + | MON | NIS | MON × NIS | ||||||
Villus high | 1084 | 1099 | 1045 | 1027 | 129.1 | 1064 | 1063 | 1092 | 1036 | 0.957 | 0.187 | 0.693 |
Crypt depth | 108 | 112 | 109 | 105 | 13.5 | 109 | 109 | 110 | 107 | 0.976 | 0.491 | 0.429 |
V:C ratio | 10.2 | 10.0 | 9.7 | 9.9 | 1.7 | 10.0 | 10.0 | 10.0 | 9.8 | 0.979 | 0.613 | 0.652 |
Mucosa thickness | 1198 | 1218 | 1161 | 1140 | 130.8 | 1179 | 1179 | 1208 | 1151 | 0.974 | 0.179 | 0.629 |
Muscular layer thickness | 164 | 165 | 162 | 159 | 26.1 | 1639 | 162 | 165 | 160 | 0.842 | 0.619 | 0.825 |
Item | Treatment | RMSE 6 | p-Value | ||||
---|---|---|---|---|---|---|---|
NA 1 | NIS100 2 | NIS200 3 | NIS400 4 | NIS800 5 | |||
BWG 7, g | |||||||
1–14 d | 366 | 368 | 366 | 369 | 379 | 2.4 | 0.382 |
14–35 d | 1640 | 1704 | 1745 | 1655 | 1690 | 12.4 | 0.056 |
1–35 d | 2006 | 2072 | 2111 | 2024 | 2069 | 13.5 | 0.097 |
FI 8, g | |||||||
1–14 d | 540 | 541 | 547 | 523 | 539 | 3.2 | 0.191 |
14–35 d | 2719 | 2729 | 2711 | 2695 | 2729 | 16.1 | 0.964 |
1–35 d | 3259 | 3269 | 3258 | 3218 | 3268 | 16.9 | 0.877 |
FCR 9, g:g | |||||||
1–14 d | 1.48 | 1.47 | 1.49 | 1.42 | 1.43 | 0.01 | 0.159 |
14–35 d | 1.66 a | 1.60 b | 1.55 c | 1.63 ab | 1.62 b | 0.01 | <0.001 |
1–35 d | 1.63 a | 1.58 c | 1.54 b | 1.59 b | 1.58 b | 0.01 | <0.001 |
Item | Treatment | RMSE 6 | p-Value | ||||
---|---|---|---|---|---|---|---|
NA 1 | NIS100 2 | NIS200 3 | NIS400 4 | NIS800 5 | |||
Bursa of Fabricius | 0.18 | 0.15 | 0.17 | 0.17 | 0.17 | 0.04 | 0.523 |
Spleen | 0.10 | 0.12 | 0.12 | 0.14 | 0.13 | 0.04 | 0.193 |
Pancreas | 0.28 | 0.27 | 0.25 | 0.25 | 0.27 | 0.04 | 0.214 |
Liver | 2.83 | 2.85 | 2.95 | 2.88 | 2.90 | 0.29 | 0.820 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kierończyk, B.; Rawski, M.; Mikołajczak, Z.; Świątkiewicz, S.; Józefiak, D. Nisin as a Novel Feed Additive: The Effects on Gut Microbial Modulation and Activity, Histological Parameters, and Growth Performance of Broiler Chickens. Animals 2020, 10, 101. https://doi.org/10.3390/ani10010101
Kierończyk B, Rawski M, Mikołajczak Z, Świątkiewicz S, Józefiak D. Nisin as a Novel Feed Additive: The Effects on Gut Microbial Modulation and Activity, Histological Parameters, and Growth Performance of Broiler Chickens. Animals. 2020; 10(1):101. https://doi.org/10.3390/ani10010101
Chicago/Turabian StyleKierończyk, Bartosz, Mateusz Rawski, Zuzanna Mikołajczak, Sylwester Świątkiewicz, and Damian Józefiak. 2020. "Nisin as a Novel Feed Additive: The Effects on Gut Microbial Modulation and Activity, Histological Parameters, and Growth Performance of Broiler Chickens" Animals 10, no. 1: 101. https://doi.org/10.3390/ani10010101
APA StyleKierończyk, B., Rawski, M., Mikołajczak, Z., Świątkiewicz, S., & Józefiak, D. (2020). Nisin as a Novel Feed Additive: The Effects on Gut Microbial Modulation and Activity, Histological Parameters, and Growth Performance of Broiler Chickens. Animals, 10(1), 101. https://doi.org/10.3390/ani10010101