sxtA4+ and sxtA4- Genotypes Occur Together within Natural Pyrodinium bahamense Sub-Populations from the Western Atlantic
Abstract
1. Introduction
2. Materials and Methods
2.1. sxtA4 Genomic Characterization from P. bahamense Lab Isolate
2.2. sxtA4 Genotype Analysis from Single Cells
2.2.1. Sample Collection
2.2.2. Cell Isolation and Lysis
2.2.3. Multiplex PCR
3. Results and Discussion
3.1. SxtA4 Genomic Characterization
3.2. sxtA4+/sxtA4- Genotypes in Natural P. bahamense Sub-Populations
3.3. Gene Variants
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cusick, K.D.; Sayler, G.S. An overview on the marine neurotoxin saxitoxin: Genetics, molecular targets, methods of detection, and ecological functions. Mar. Drugs 2013, 11, 991–1018. [Google Scholar] [CrossRef] [Scilit]
- Landsberg, J.H.; Hall, S.; Johannessen, J.N.; White, K.D.; Conrad, S.M.; Abbott, J.P.; Flewelling, L.J.; Richardson, R.W.; Dickey, R.W.; Jester, E.L.E.; et al. Saxitoxin puffer fish poisoning in the United States, with the first report of Pyrodinium bahamense as the putative toxin source. Environ. Health Persp. 2006, 114, 1502–1507. [Google Scholar] [CrossRef] [Scilit]
- Anderson, D.M.; Kulis, D.M.; Sullivan, J.J.; Hall, S.; Lee, C. Dynamics and physiology of saxitoxin production by the dinoflagellates Alexandrium spp. Mar. Biol. 1990, 104, 511–524. [Google Scholar] [CrossRef] [Scilit]
- Hallegraeff, G.M.; Steffensen, D.A.; Wetherbee, R. Three estuarine Australian dinoflagellates that can produce paralytic shellfish toxins. J. Plankton Res. 1988, 10, 533–541. [Google Scholar] [CrossRef] [Scilit]
- Harada, T.; Oshima, Y.; Kamiya, H.; Yasumoto, T. Confirmation of paralytic shellfish toxins in the dinoflagellate pyrodinium-bahamense var. compressa and bivalves in Palau. Bull. Jpn. Soc. Sci. Fish. 1982, 48, 821–825. [Google Scholar] [CrossRef] [Scilit]
- Oshima, Y.; Hasegawa, M.; Yasumoto, T.; Hallegraeff, G.; Blackburn, S. Dinoflagellate Gymnodinium catenatum as the source of paralytic shellfish toxins in tasmanian shellfish. Toxicon 1987, 25, 1105–1111. [Google Scholar] [CrossRef] [Scilit]
- Carmichael, W.W.; Evans, W.R.; Yin, Q.Q.; Bell, P.; Moczydlowski, E. Evidence for paralytic shellfish poisons in the freshwater cyanobacterium Lyngbya wollei (Farlow ex Gomont) comb. Nov. Appl. Environ. Microbiol. 1997, 63, 3104–3110. [Google Scholar] [CrossRef] [Scilit]
- Negri, A.P.; Jones, G.J. Bioaccumulation of paralytic shellfish poisoning (PSP) toxins from the cyanobacterium Anabaena circinalis by the freshwater mussel Alathyria condola. Toxicon 1995, 33, 667–678. [Google Scholar] [CrossRef] [Scilit]
- Shimizu, Y. Microalgal metabolites. Chem. Rev. 1993, 93, 1685–1698. [Google Scholar] [CrossRef] [Scilit]
- Shimizu, Y. Microalgal metabolites: A new perspective. Annu. Rev. Microbiol. 1996, 50, 431–465. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kellmann, R.; Mihali, T.K.; Jeon, Y.J.; Pickford, R.; Pomati, F.; Neilan, B.A. Biosynthetic intermediate analysis and functional homology reveal a saxitoxin gene cluster in cyanobacteria. Appl. Environ. Microbiol. 2008, 74, 4044–4053. [Google Scholar] [CrossRef] [Scilit]
- Mihali, T.K.; Kellmann, R.; Neilan, B.A. Characterisation of the paralytic shellfish toxin biosynthesis gene clusters in Anabaena circinalis AWQC131C and Aphanizomenon sp. NH-5. BMC Biochem. 2009, 10, 8. [Google Scholar] [CrossRef] [Scilit]
- Mihali, T.K.; Carmichael, W.W.; Neilan, B.A. A putative gene cluster from a Lyngbya wollei bloom that encodes paralytic shellfish toxin biosynthesis. PLoS ONE 2011, 6, e14657. [Google Scholar] [CrossRef] [Scilit]
- Stuken, A.; Orr, R.J.S.; Kellmann, R.; Murray, S.A.; Neilan, B.A.; Jakobsen, K.S. Discovery of nuclear-encoded genes for the neurotoxin saxitoxin in dinoflagellates. PLoS ONE 2011, 6, e20096. [Google Scholar] [CrossRef] [Scilit]
- Hackett, J.D.; Wisecarver, J.H.; Brosnahan, M.L.; Kulis, D.M.; Anderson, D.M.; Bhattacharya, D.; Plumley, F.G.; Erdner, D.L. Evolution of saxitoxin synthesis in cyanobacteria and dinoflagellates. Mol. Biol. Evol. 2013, 30, 70–78. [Google Scholar] [CrossRef] [Scilit]
- Kellmann, R.; Michali, T.K.; Neilan, B.A. Identification of a saxitoxin biosynthesis gene with a history of frequent horizontal gene transfers. J. Mol. Evol. 2008, 67, 526–538. [Google Scholar] [CrossRef] [Scilit]
- Murray, S.A.; Diwan, R.; Orr, R.J.S.; Kohli, G.S.; John, U. Gene duplication, loss, and selection in the evolution of saxitoxin biosynthesis in alveolates. Mol. Phylogenetics Evol. 2015, 92, 165–180. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Kim, H.; Ki, J.-S. Transcriptome survey and toxin measurements reveal evolutionary modification and loss of saxitoxin biosynthesis genes in the dinoflagellates Amphidinium carterae and Prorocentrum micans. Ecotoxicol. Environ. Saf. 2020, 195, 110474. [Google Scholar] [CrossRef] [Scilit]
- Murray, S.A.; Wiese, M.; Stuken, A.; Brett, S.; Kellmann, R.; Hallegraeff, G.; Neilan, B.A. SxtA-based quantitative molecular assay to identify saxitoxin-producing harmful algal blooms in marine waters. Appl. Environ. Microbiol. 2011, 77, 7050–7057. [Google Scholar] [CrossRef] [Scilit]
- Orr, R.J.S.; Stuken, A.; Murray, S.A.; Jakobsen, K.S. Evolutionary acquisition and loss of saxitoxin biosynthesis in dinoflagellates: The second "core" gene, sxtG. Appl. Environ. Microbiol. 2013, 79, 2128–2136. [Google Scholar] [CrossRef] [Scilit]
- Murray, S.A.; Hoppenrath, M.; Orr, R.J.S.; Bolch, C.; John, U.; Diwan, R.; Yauwenas, R.; Harwood, T.; de Salas, M.; Neilan, B.; et al. Alexandrium diversaporum sp. nov., a new non-saxitoxin producing species: Phylogeny, morphology and sxtA genes. Harmful Algae 2014, 31, 54–65. [Google Scholar] [CrossRef] [Scilit]
- Touzet, N.; Franco, J.M.; Raine, R. Characterization of nontoxic and toxin-producing strains of Alexandrium minutum (Dinophyceae) in Irish coastal waters. Appl. Environ. Microbiol. 2007, 73, 3333–3342. [Google Scholar] [CrossRef] [Scilit]
- Alpermann, T.J.; Tillmann, U.; Beszteri, B.; Cembella, A.D.; John, U. Phenotypic variation and genotypic diversity in a planktonic population of the toxigenic marine dinoflagellate Alexandrium tamarense (Dinophyceae). J. Phycol. 2010, 46, 18–32. [Google Scholar] [CrossRef] [Scilit]
- Menden-Deuer, S.; Montalbano, A.L. Bloom formation potential in the harmful dinoflagellate Akashiwo sanguinea: Clues from movement behaviors and growth characteristics. Harmful Algae 2015, 47, 75–85. [Google Scholar] [CrossRef] [Scilit]
- Anderson, D.M.; Alpermann, T.J.; Cembella, A.D.; Collos, Y. Masseret E, Montresor M. The globally distributed genus Alexandrium: Multifaceted roles in marine ecosystems and impacts on human health. Harmful Algae 2012, 14, 10–35. [Google Scholar] [CrossRef] [Scilit]
- Whittaker, K.A.; Rignanese, D.R.; Olson, R.J.; Rynearson, T.A. Molecular subdivision of the marine diatom Thalassiosira rotulain relation to geographic distribution, genome size, and physiology. BMC Evol. Biol. 2012, 12, 209. [Google Scholar] [CrossRef] [Scilit]
- Saravanan, V.; Godhe, A. Genetic heterogeneity and physiological variation among seasonally separated clones of Skeletonema marinoi (Bacillariophyceae) in the Gullmar Fjord, Sweden. Eur. J. Phycol. 2010, 45, 177–190. [Google Scholar] [CrossRef] [Scilit]
- Rynearson, T.A.; Armbrust, E.V. Genetic differentiation among populations of the planktonic marine diatim Ditylum brightwellii (Bacillariophyceae). J. Phycol. 2004, 40, 34–43. [Google Scholar] [CrossRef] [Scilit]
- Richlen, M.L.; Erdner, D.L.; McCauley, L.A.R.; Libera, K.; Anderson, D.M. Extensive genetic diversity and rapid population differentiation during blooms of Alexandrium fundyense (Dinophyceae) in an isolated salt pond on Cape Cod, MA, USA. Ecol. Evol. 2012, 2, 2588–2599. [Google Scholar] [CrossRef] [Scilit]
- Hallegraeff, G.M.; Blackburn, S.I.; Doblin, M.A.; Bolch, C.J.S. Global toxicology, ecophysiology and population relationships of the chainforming PST dinoflagellate Gymnodinium catenatum. Harmful Algae 2012, 14, 130–143. [Google Scholar] [CrossRef] [Scilit]
- Morquecho, L. Pyrodinium bahamense, one the most significant harmful dinoflagellates in Mexico. Front. Mar. Sci. 2019, 6, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Phlips, E.J.; Badylak, S.; Christman, M.; Wolny, J.; Brame, J.; Garland, J.; Hall, L.; Hart, J.; Landsberg, J.; Lasi, M.; et al. Scales of temporal and spatial variability in the distribution of harmful algae species in the Indian River Lagoon, Florida, USA. Harmful Algae 2011, 10, 277–290. [Google Scholar] [CrossRef] [Scilit]
- Usup, G.; Ahmada, A.; Matsuoka, K.; Lim, P.T.; Leaw, C.P. Biology, ecology and bloom dynamics of the toxic marine dinoflagellate Pyrodinium bahamense. Harmful Algae 2012, 14, 301–312. [Google Scholar] [CrossRef] [Scilit]
- Montojo, U.M.; Sakamoto, S.; Cayme, M.F.; Gatdula, N.C.; Furio, E.F.; Relox, J.J.R.; Shigeru, S.; Fukuyo, Y.; Kodama, M. Remarkable difference in accumulation of paralytic shellfish poisoning toxins among bivalve species exposed to Pyrodinium bahamense var. compressum bloom in Masinloc bay, Philippines. Toxicon 2006, 48, 85–92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Llewellyn, L.; Negri, A.; Robertson, A. Paralytic shellfish toxins in tropical oceans. Toxin Rev. 2006, 25, 159–196. [Google Scholar] [CrossRef] [Scilit]
- Azanza, R.V.; Miranda, L.N. Phytoplankton composition and Pyrodinium bahamense toxic blooms in Manila Bay, Philippines. J. Shellfish Res. 2001, 20, 1251–1255. [Google Scholar]
- Azanza, R.V.; Taylor, F.J.R. Are Pyrodinium blooms in the Southeast Asian region recurring and spreading? A view at the end of the millennium. AMBIO 2001, 30, 356–364. [Google Scholar] [CrossRef]
- Gacutan, R.Q.; Tabbu, M.Y.; Aujero, E.J.; Icatlo, F. Paralytic shellfish poisoning due to pyrodinium-bahamense var compressa in Mati, Davao-Oriental, Philippines. Mar. Biol. 1985, 87, 223–227. [Google Scholar] [CrossRef] [Scilit]
- Bodager, D. Outbreak of saxitoxin illness following consumption of Florida pufferfish. Fl J. Environ. Health 2002, 179, 9–13. [Google Scholar]
- Brandenburg, K.M.; Wohlrab, S.; John, U.; Kremp, A.; Jerney, J.; Krock, B.; Van de Waal, D.B. Intraspecific trait variation and trade-offs within and across populations of a toxic dinoflagellate. Ecol. Lett. 2018, 21, 1561–1571. [Google Scholar] [CrossRef] [Scilit]
- Murray, S.A.; Mihali, T.K.; Neilan, B.A. Extraordinary conservation, gene loss, and positive selection in the evolution of an ancient neurotoxin. Mol. Biol. Evol. 2011, 28, 1173–1182. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Zhang, S.F.; Lin, L.; Wang, D.Z. Comparative transcriptome analysis of a toxin-producing dinoflagellate Alexandrium catenella and its non-toxic mutant. Mar. Drugs 2014, 12, 5698–5718. [Google Scholar] [CrossRef] [Scilit]
- John, U.; Beszteri, B.; Derelle, E.; Van de Peer, Y.; Read, B.; Moreau, H.; Cembella, A.D. Novel insights into evolution of protistan polyketide synthases through phylogenomic analysis. Protist 2008, 158, 21–30. [Google Scholar] [CrossRef] [Scilit]
- Eichholz, K.; Beszteri, B.; John, U. Putative monofunctional type I polyketide synthase units: A dinoflagellate-specific feature? PLoS ONE 2012, 7, e48624. [Google Scholar] [CrossRef] [Scilit]
- Nosenko, T.; Bhattacharya, D. Horizontal gene transfer in chromalveolates. BMC Evol. Biol. 2007, 7, 173. [Google Scholar] [CrossRef] [Scilit]
- Wisecaver, J.H.; Brosnahan, M.L.; Hackett, J.D. Horizontal gene transfer is a significant driver of gene innovation in dinoflagellates. Genome Biol. Evol. 2013, 5, 2368–2381. [Google Scholar] [CrossRef] [Scilit]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local aligment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Cusick, K.D.; Wilhelm, S.W.; Hargraves, P.E.; Sayler, G.S. Single-cell PCR of the luciferase conserved catalytic domain reveals a unique cluster in the toxic bioluminescent dinoflagellate Pyrodinium bahamense. Aquat. Biol. 2016, 25, 139–150. [Google Scholar] [CrossRef] [Scilit]
- Tomas, C.R. (Ed.) Identifying Marine Phytoplankton; Academic Press: San Diego, CA, USA, 1997; p. 858. [Google Scholar]
- Zhang, Z.; Schwartz, S.; Wagner, L.; Miller, W. A greedy algorithm for aligning DNA sequences. J. Comput. Biol. 2000, 7, 203–214. [Google Scholar] [CrossRef] [Scilit]
- Phlips, E.J.; Badylak, S.; Grosskopf, T. Factors affecting the abundance of phytoplankton in a restricted subtropical lagoon, the Indian River Lagoon, Florida, USA. Estuar. Coast. Shelf Sci. 2002, 55, 385–402. [Google Scholar] [CrossRef] [Scilit]
- Badylak, S.; Phlips, E.J. Spatial and temporal patterns of phytoplankton composition in a subtropical coastal lagoon, the Indian River Lagoon, Florida, USA. J. Plankton Res. 2004, 26, 1229–1247. [Google Scholar] [CrossRef] [Scilit]
- Phlips, E.J.; Badylak, S.; Christman, M.C.; Lasi, M.A. Climatic trends and temporal patterns of phytoplankton composition, abundance and succession in the Indian River Lagoon, Florida, USA. Estuar. Coast. 2010, 33, 498–512. [Google Scholar] [CrossRef] [Scilit]
- Phlips, E.J.; Badylak, S.; Bledsoe, E.; Cichra, M. Factors affecting the distribution of Pyrodinium bahamense var. bahamense in coastal waters of Florida. Mar. Ecol. Prog. Ser. 2006, 322, 99–115. [Google Scholar] [CrossRef] [Scilit]
- Grasso, S.; Albrecht, M.; Bras, M.M. Seasonal abundance of Pyrodinium bahamense (order Peridiniales, family Gonyaulacaceae) in Mosquito Bay, Vieques, Puerto Rico. J. Coast Life Med. 2016, 4, 277–283. [Google Scholar] [CrossRef] [Scilit]
- Steidinger, K.A.; Tester, L.S.; Taylor, F.J.R. A redescription of Pyrodinium bahamense var. compressa (Bohm) stat. nov. from Pacific red tides. Phycologia 1980, 19, 329–337. [Google Scholar] [CrossRef] [Scilit]
- Mertens, K.N.; Wolny, J.; Carbonell-Moore, C.; Bogus, K.; Ellegaard, M.; Limoges, A.; de Vernal, A.; Gurdebeke, P.; Omura, T.; Al-Muftah, A.; et al. Taxonomic re-examination of the toxic armored dinoflagellate Pyrodinium bahamense Plate 1906: Can morphology or LSU sequencing separate P. bahamense var. compressum from var. bahamense? Harmful Algae 2015, 41, 1–24. [Google Scholar] [CrossRef] [Scilit]
- Liu, L.; Wilson, T.; Hastings, J.W. Molecular evolution of dinoflagellate luciferases, enzymes with three catalytic domains in a single polypeptide. Proc. Natl. Acad. Sci. USA 2004, 101, 16555–16560. [Google Scholar] [CrossRef] [Scilit]
- Okamoto, O.K.; Liu, L.; Robertson, D.L.; Hastings, J.W. Members of a dinoflagellate luciferase gene family differ in synonymous substitution rates. Biochemistry 2001, 40, 15862–15868. [Google Scholar] [CrossRef] [Scilit]





| Primer | Sequence | Source |
|---|---|---|
| PyrosxtA4F1 | AACGACATGAAGCAGCTCGA | this study |
| PyrosxtA4R680 | CTAGATGGGGTACCACATAG | this study |
| SxtA4166F | CATGGCTGCGGCGTTCTTG | this study |
| Pcomp370F | AAATTACCCAATCCTGACACT | 48 |
| Pcomp1530R | CTGATGACTCAGGCTTACT | 48 |
| sxt007 | ATGCTCAACATGGGAGTCATCC | 14 |
| sxt008 | GGGTCCAGTAGATGTTGACGATG | 14 |
| Species | No. cDNA Sequences | % Similarity | No. DNA Sequences | % Similarity |
|---|---|---|---|---|
| P. bahamense IRL | 8 | 99.1–100 | 14 | 96.0–100 |
| A. fundyense 1 CCMP1719 | 12 | 96.2–99.4 | 10 | 91.7–100 |
| A. fundyense A8 1 | 7 | 93.5–100 | 19 | 77.5–100 |
| A. fundyense E4 1 | 19 | 97.0–100 | 40 | 76.8–100 |
| A. pacificum ACCC01 1 | 4 | 96.0–100 | 5 | 91.0–100 |
| Sampling Site | Date | 18S 1 | sxtA4 2 | sxtA4+ Frequency |
|---|---|---|---|---|
| Diamond Bay (IRL) | 7/15/2019 | 10 | 8 | 80% |
| TBM (IRL) | 6/15/2020 | 64 | 54 | 84% |
| TBM (IRL) | 7/20/2020 | 44 | 36 | 82% |
| Lee Wenner (IRL) | 7/20/2020 | 30 | 30 | 100% |
| 520 Bridge (IRL) | 7/20/2020 | 37 | 37 | 100% |
| Mosquito Bay (PR) | 7/8/2020 | 9 | 6 | 67% |
| Mosquito Bay (PR) | 9/15/2020 | 7 | 3 | 43% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cusick, K.; Duran, G. sxtA4+ and sxtA4- Genotypes Occur Together within Natural Pyrodinium bahamense Sub-Populations from the Western Atlantic. Microorganisms 2021, 9, 1128. https://doi.org/10.3390/microorganisms9061128
Cusick K, Duran G. sxtA4+ and sxtA4- Genotypes Occur Together within Natural Pyrodinium bahamense Sub-Populations from the Western Atlantic. Microorganisms. 2021; 9(6):1128. https://doi.org/10.3390/microorganisms9061128
Chicago/Turabian StyleCusick, Kathleen, and Gabriel Duran. 2021. "sxtA4+ and sxtA4- Genotypes Occur Together within Natural Pyrodinium bahamense Sub-Populations from the Western Atlantic" Microorganisms 9, no. 6: 1128. https://doi.org/10.3390/microorganisms9061128
APA StyleCusick, K., & Duran, G. (2021). sxtA4+ and sxtA4- Genotypes Occur Together within Natural Pyrodinium bahamense Sub-Populations from the Western Atlantic. Microorganisms, 9(6), 1128. https://doi.org/10.3390/microorganisms9061128

