Anti-Biofilm Activity of Cannabigerol against Streptococcus mutans
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Bacterial Growth and Biofilm Formation
2.3. Crystal Violet (CV) Staining of Biofilms
2.4. DNA Quantification in Biofilms
2.5. Tetrazolium Reduction Assay (MTT Metabolic Assay)
2.6. FilmTracer SYPRO Ruby Biofilm Matrix Stain
2.7. High-Resolution Scanning Electron Microscopy (HR-SEM)
2.8. RNA Extraction
2.9. Reverse Transcription (RT) and Quantitative Real-Time PCR
2.10. Optical Profilometry
2.11. Determination of Extracellular Polysaccharide (EPS) Production by Congo Red
2.12. ROS Production
2.13. Metabolic Activity/Biomass Index
2.14. Statistical Analysis
3. Results
3.1. CBG Reduces Biofilm Formation by S. mutans
3.2. CBG Altered the Roughness Profile Resulting in a Smoother Surface of S. mutans Biofilms
3.3. CBG Decreases EPS Production by S. mutans
3.4. CBG Increased the Intracellular Reactive Oxygen Species (ROS) Levels
3.5. CBG Reduces the Expression of Various Genes Involved in Essential Metabolic Pathways Related to the Cariogenic Properties of S. mutans
3.6. CBG Decreases the Metabolic Activity of Preformed Biofilms
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jamal, M.; Ahmad, W.; Andleeb, S.; Jalil, F.; Imran, M.; Nawaz, M.A.; Hussain, T.; Ali, M.; Rafiq, M.; Kamil, M.A. Bacterial biofilm and associated infections. J. Chin. Med. Assoc. 2018, 81, 7–11. [Google Scholar] [CrossRef]
- Hoyle, B.D.; Costerton, J.W. Bacterial resistance to antibiotics: The role of biofilms. Prog. Drug Res. 1991, 37, 91–105. [Google Scholar] [CrossRef]
- Li, Y.-H.; Tian, X. Quorum sensing and bacterial social interactions in biofilms. Sensors 2012, 12, 2519–2538. [Google Scholar] [CrossRef]
- Pitts, N.B.; Zero, D.T.; Marsh, P.D.; Ekstrand, K.; Weintraub, J.A.; Ramos-Gomez, F.; Tagami, J.; Twetman, S.; Tsakos, G.; Ismail, A. Dental caries. Nat. Rev. Dis. Primers 2017, 3, 1–16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Socransky, S.S. Dental biofilms. difficult therapeutic targets. Periodontology 2000 2002, 28, 12–55. [Google Scholar] [CrossRef] [PubMed]
- Bortolaia, C.; Sbordone, L. Biofilms of the oral cavity. Formation, development and involvement in the onset of diseases related to bacterial plaque increase. Minerva Stomatol. 2002, 51, 187–192. [Google Scholar] [PubMed]
- Dias, A.P.; Paschoal, M.A.B.; Diniz, R.S.; Lage, L.M.; Gonçalves, L.M. Antimicrobial action of chlorhexidine digluconate in self-ligating and conventional metal brackets infected with Streptococcus mutans biofilm. Clin. Cosmet. Investig. Dent. 2018, 10, 69. [Google Scholar] [CrossRef] [Green Version]
- Nedumgottil, B.M. Relative presence of Streptococcus mutans, Veillonella atypica, and Granulicatella adiacens in biofilm of complete dentures. J. Indian Prosthodont. Soc. 2018, 18, 24. [Google Scholar] [CrossRef]
- Peterson, S.N.; Snesrud, E.; Liu, J.; Ong, A.C.; Kilian, M.; Schork, N.J.; Bretz, W. The dental plaque microbiome in health and disease. PLoS ONE 2013, 8, e58487. [Google Scholar] [CrossRef] [Green Version]
- Valen, H.; Scheie, A.A. Biofilms and their properties. Eur. J. Oral Sci. 2018, 126, 13–18. [Google Scholar] [CrossRef]
- Mocanu, R.C.; Martu, M.-A.; Luchian, I.; Sufaru, I.G.; Maftei, G.A.; Ioanid, N.; Martu, S.; Tatarciuc, M. Microbiologic profiles of patients with dental prosthetic treatment and periodontitis before and after photoactivation therapy—Randomized clinical trial. Microorganisms 2021, 9, 713. [Google Scholar] [CrossRef] [PubMed]
- Mei, L.; Chieng, J.; Wong, C.; Benic, G.; Farella, M. Factors affecting dental biofilm in patients wearing fixed orthodontic appliances. Prog. Orthod. 2017, 18, 1–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Taraboanta, I.; Stoleriu, S.; Nica, I.; Georgescu, A.; Gamen, A.C.; Maftei, G.A.; Andrian, S. Roughness variation of a nonhybrid composite resin submitted to acid and abrasive challenges. Int. J. Med. Dent. 2020, 24, 182–187. [Google Scholar]
- Anhoury, P.; Nathanson, D.; Hughes, C.V.; Socransky, S.; Feres, M.; Chou, L.L. Microbial profile on metallic and ceramic bracket materials. Angle Orthod. 2002, 72, 338–343. [Google Scholar] [CrossRef] [PubMed]
- Mei, L.; Busscher, H.J.; Van Der Mei, H.C.; Chen, Y.; De Vries, J.; Ren, Y. Oral bacterial adhesion forces to biomaterial surfaces constituting the bracket–adhesive–enamel junction in orthodontic treatment. Eur. J. Oral Sci. 2009, 117, 419–426. [Google Scholar] [CrossRef] [PubMed]
- Petersen, P.E.; Bourgeois, D.; Ogawa, H.; Estupinan-Day, S.; Ndiaye, C. The global burden of oral diseases and risks to oral health. Bull. World Health Organ. 2005, 83, 661–669. [Google Scholar] [PubMed]
- Lins de Sousa, D.; Araújo Lima, R.; Zanin, I.C.; Klein, M.I.; Janal, M.N.; Duarte, S. Effect of twice-daily blue light treatment on matrix-rich biofilm development. PLoS ONE 2015, 10, e0131941. [Google Scholar] [CrossRef]
- Steinberg, D.; Friedman, M. Sustained-release drug delivery of antimicrobials in controlling of supragingival oral biofilms. Expert Opin. Drug Deliv. 2017, 14, 571–581. [Google Scholar] [CrossRef] [PubMed]
- Koo, H.; Xiao, J.; Klein, M.; Jeon, J. Exopolysaccharides produced by Streptococcus mutans glucosyltransferases modulate the establishment of microcolonies within multispecies biofilms. J. Bacteriol. 2010, 192, 3024–3032. [Google Scholar] [CrossRef] [Green Version]
- Matsumoto-Nakano, M. Role of Streptococcus mutans surface proteins for biofilm formation. Jpn. Dent. Sci. Rev. 2018, 54, 22–29. [Google Scholar] [CrossRef]
- Jakubovics, N.S.; Goodman, S.D.; Mashburn-Warren, L.; Stafford, G.P.; Cieplik, F. The dental plaque biofilm matrix. Periodontology 2000 2021, 86, 32–56. [Google Scholar] [CrossRef] [PubMed]
- Krzyściak, W.; Jurczak, A.; Kościelniak, D.; Bystrowska, B.; Skalniak, A. The virulence of Streptococcus mutans and the ability to form biofilms. Eur. J. Clin. Microbiol. Infect. Dis. 2014, 33, 499–515. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nobbs AH, Lamont RJ, Jenkinson HF: Streptococcus adherence and colonization. Microbiol. Mol. Biol. Rev. 2009, 73, 407–450. [CrossRef] [PubMed] [Green Version]
- Ito, T.; Maeda, T.; Senpuku, H. Roles of salivary components in Streptococcus mutans colonization in a new animal model using NOD/SCID.e2f1−/− mice. PLoS ONE 2012, 7, e32063. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nicolae, V.; Neamtu, B.; Picu, O.; Stefanache, M.A.M.; Cioranu, V.S.I. The comparative evaluation of salivary biomarkers (Calcium, Phosphate, Salivary pH) in cario-resistance versus cario-activity. Rev. Chim. 2016, 67, 821–824. [Google Scholar]
- Ekor, M. The growing use of herbal medicines. Issues relating to adverse reactions and challenges in monitoring safety. Front. Pharmacol. 2014, 4, 177. [Google Scholar] [CrossRef] [Green Version]
- Hill, A.J.; Williams, C.M.; Whalley, B.J.; Stephens, G.J. Phytocannabinoids as novel therapeutic agents in CNS disorders. Pharmacol. Ther. 2012, 133, 79–97. [Google Scholar] [CrossRef] [Green Version]
- Nachnani, R.; Raup-Konsavage, W.M.; Vrana, K.E. The pharmacological case for cannabigerol. J. Pharmacol. Exp. Ther. 2021, 376, 204–212. [Google Scholar] [CrossRef]
- Appendino, G.; Gibbons, S.; Giana, A.; Pagani, A.; Grassi, G.; Stavri, M.; Smith, E.; Rahman, M.M. Antibacterial cannabinoids from Cannabis sativa: A structure—Activity study. J. Nat. Prod. 2008, 71, 1427–1430. [Google Scholar] [CrossRef]
- Farha, M.A.; El-Halfawy, O.M.; Gale, R.T.; MacNair, C.R.; Carfrae, L.A.; Zhang, X.; Jentsch, N.G.; Magolan, J.; Brown, E.D. Uncovering the hidden antibiotic potential of Cannabis. ACS Infect. Dis. 2020, 6, 338–346. [Google Scholar] [CrossRef]
- Stahl, V.; Vasudevan, K. Comparison of efficacy of cannabinoids versus commercial oral care products in reducing bacterial content from dental plaque: A preliminary observation. Cureus 2020, 12, e6809. [Google Scholar] [CrossRef]
- Vasudevan, K.; Stahl, V. Cannabinoids infused mouthwash products are as effective as chlorhexidine on inhibition of total-culturable bacterial content in dental plaque samples. J. Cannabis Res. 2020, 2, 20. [Google Scholar] [CrossRef]
- Aqawi, M.; Gallily, R.; Sionov, R.V.; Zaks, B.; Friedman, M.; Steinberg, D. Cannabigerol prevents quorum sensing and biofilm formation of Vibrio harveyi. Front. Microbiol. 2020, 11, 858. [Google Scholar] [CrossRef]
- Aqawi, M.; Sionov, R.V.; Gallily, R.; Friedman, M.; Steinberg, D. Anti-Bacterial properties of cannabigerol toward Streptococcus mutans. Front. Microbiol. 2021, 12, 922. [Google Scholar] [CrossRef]
- Steinberg, D.; Moreinos, D.; Featherstone, J.; Shemesh, M.; Feuerstein, O. Genetic and physiological effects of noncoherent visible light combined with hydrogen peroxide on Streptococcus mutans in biofilm. Antimicrob. Agents Chemother. 2008, 52, 2626–2631. [Google Scholar] [CrossRef] [Green Version]
- Feldman, M.; Smoum, R.; Mechoulam, R.; Steinberg, D. Antimicrobial potential of endocannabinoid and endocannabinoid-like compounds against methicillin-resistant Staphylococcus aureus. Sci. Rep. 2018, 8, 17696. [Google Scholar] [CrossRef]
- Brandwein, M.; Al-Quntar, A.; Goldberg, H.; Mosheyev, G.; Goffer, M.; Marin-Iniesta, F.; López-Gómez, A.; Steinberg, D. Mitigation of biofilm formation on corrugated cardboard fresh produce packaging surfaces using a novel thiazolidinedione derivative integrated in acrylic emulsion polymers. Front. Microbiol. 2016, 7, 159. [Google Scholar] [CrossRef] [PubMed]
- Funk, B.; Kirmayer, D.; Sahar-Heft, S.; Gati, I.; Friedman, M.; Steinberg, D. Efficacy and potential use of novel sustained release fillers as intracanal medicaments against Enterococcus faecalis biofilm in vitro. BMC Oral Health 2019, 19, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Sionov, R.V.; Tsavdaridou, D.; Aqawi, M.; Zaks, B.; Steinberg, D.; Shalish, M. Tooth mousse containing casein phosphopeptide-amorphous calcium phosphate prevents biofilm formation of Streptococcus mutans. BMC Oral Health 2021, 21, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Feldman, M.; Al-Quntar, A.; Polacheck, I.; Friedman, M.; Steinberg, D. Therapeutic potential of thiazolidinedione-8 as an antibiofilm agent against Candida albicans. PLoS ONE 2014, 9, e93225. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Freeman, D.J.; Falkiner, F.R.; Keane, C.T. New method for detecting slime production by coagulase-negative staphylococci. J. Clin. Pathol. 1989, 42, 872–874. [Google Scholar] [CrossRef] [Green Version]
- Feldman, M.; Ginsburg, I.; Al-Quntar, A.; Steinberg, D. Thiazolidinedione-8 alters symbiotic relationship in C. albicans-S. mutans dual species biofilm. Front. Microbiol. 2016, 7, 140. [Google Scholar] [CrossRef] [Green Version]
- Fletcher, M. Attachment of Pseudomonas fluorescens to glass and influence of electrolytes on bacterium-substratum separation distance. J. Bacteriol. Res. 1988, 170, 2027–2030. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Furio, M.; Ahn, S.J.; Burne, R.A.; Hagen, S.J. Oxidative stressors modify the response of Streptococcus mutans to its competence signal peptides. Appl. Environ. Microbiol. 2017, 83, e01345-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lemos, J.A.; Abranches, J.; Burne, R.A. Responses of cariogenic streptococci to environmental stresses. Curr. Issues Mol. Biol. 2005, 7, 95–108. [Google Scholar] [PubMed]
- Jayaraman, G.C.; Penders, J.E.; Burne, R.A. Transcriptional analysis of the Streptococcus mutans hrcA, grpE and dnaK genes and regulation of expression in response to heat shock and environmental acidification. Mol. Microbiol. 1997, 25, 329–341. [Google Scholar] [CrossRef] [PubMed]
- Loesche, W.J. Role of Streptococcus mutans in human dental decay. Microbiol. Rev. 1986, 50, 353–380. [Google Scholar] [CrossRef] [PubMed]
- El Sherbiny, G.M. Control of growth Streptococcus mutans isolated from saliva and dental caries. Int. J. Curr. Microbiol. Appl. Sci. 2014, 3, 1–10. [Google Scholar]
- Lei, L.; Stipp, R.; Chen, T.; Wu, S.; Hu, T.; Duncan, M. Activity of Streptococcus mutans VicR is modulated by antisense RNA. J. Dent. Res. 2018, 97, 1477–1484. [Google Scholar] [CrossRef]
- Wen, Z.T.; Scott-Anne, K.; Liao, S.; De, A.; Luo, M.; Kovacs, C.; Narvaez, B.S.; Faustoferri, R.C.; Yu, Q.; Taylor, C.M. Deficiency of BrpA in Streptococcus mutans reduces virulence in rat caries model. Mol. Oral Microbiol. 2018, 33, 353–363. [Google Scholar] [CrossRef]
- Zhu, L.; Kreth, J.; Cross, S.E.; Gimzewski, J.K.; Shi, W.; Qi, F. Functional characterization of cell-wall-associated protein WapA in Streptococcus mutans. Microbiology 2006, 152, 2395–2404. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, J.; Deng, D.; Brandt, B.W.; Nazmi, K.; Wu, Y.; Crielaard, W.; Ligtenberg, A.J. Diversity of SpaP in genetic and salivary agglutinin mediated adherence among Streptococcus mutans strains. Sci. Rep. 2019, 9, 19943. [Google Scholar] [CrossRef] [PubMed]
- Costa, O.Y.; Raaijmakers, J.M.; Kuramae, E.E. Microbial extracellular polymeric substances: Ecological function and impact on soil aggregation. Front. Microbiol. 2018, 9, 1636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feldman, M.; Sionov, R.V.; Mechoulam, R.; Steinberg, D. Anti-biofilm activity of cannabidiol against Candida albicans. Microorganisms 2021, 9, 441. [Google Scholar] [CrossRef]
- Singer, E.; Judkins, J.; Salomonis, N.; Matlaf, L.; Soteropoulos, P.; McAllister, S.; Soroceanu, L. Reactive oxygen species-mediated therapeutic response and resistance in glioblastoma. Cell Death Dis. 2015, 6, e1601. [Google Scholar] [CrossRef] [Green Version]
- Zhao, X.; Drlica, K. Reactive oxygen species and the bacterial response to lethal stress. Curr. Opin. Microbiol. 2014, 21, 1–6. [Google Scholar] [CrossRef] [Green Version]
- Karas, J.A.; Wong, L.J.; Paulin, O.K.; Mazeh, A.C.; Hussein, M.H.; Li, J.; Velkov, T. The antimicrobial activity of cannabinoids. Antibiotics 2020, 9, 406. [Google Scholar] [CrossRef]
Gene | Forward Primer | Reverse Primer |
---|---|---|
16S rRNA | CCTACGGGAGGCAGCAGTAG | CAACAGAGCTTTACGATCCGAAA |
atpB | AGCCAACCTTGGCAACTGAAA | TGTCAGACGGCGTTCAAGGTT |
brpA | GGAGGAGCTGCATCAGGATTC | AACTCCAGCACATCCAGCAAG |
comD | TGAAAATAGCATAGGTGAGTCAAAG | ATTTAGGTTAGCTGATTAACACTATACAC |
comE | CACAACAACTTATTGACGCTATCCC | TGATTGGCTACTTCCAGTCCTTTC |
dnak | GCAGGTCAAGAGGGAGCTCA | CCGCCCTTGTCTGAGAATC |
gbpA | GGTGGTTCTGTGCCTGATGA | TTGCCAGCCTGATACACGTT |
gbpB | AGGGCAATGTACTTGGGGTG | TTTGGCCACCTTGAACACCT |
groEL | CCAGGAGCTTTGACTGCGAC | TTGCGGATGATGATGTAGATGGT |
gtfB | AGCAATGCAGCCAATCTACAAAT | ACGAACTTTGCCGTTATTGTCA |
gtfC | GGTTTAACGTCAAAATTAGCTGTATT | CTCAACCAACCGCCACTGTT |
gtfD | CAGGCAGCCAACGCATTAA | AGCCCTCGCTCATCATAAGC |
luxS | ACTGTTCCCCTTTTGGCTGTC | AACTTGCTTTGATGACTGTGGC |
nox | GGGTTGTGGAATGGCACTTTGG | CAATGGCTGTCACTGGCGATTC |
relA | ACAAAAAGGGTATCGTCCGTACAT | AATCACGCTTGGTATTGCTAATTG |
soda | GGCTCAGGTTGGGCTTGGTTAG | GCGTGTTCCCAGACATCAAGTGC |
spaP | GACTTTGGTAATGGTTATGCATCAA | TTGCCAGCCTGATACACGTT |
vicR | CGCAGTGGCTGAGGAAAATG | ACCTGTGTGTGTCGCTAAGTGATG |
wapA | GCACGCTTGCAGTACATTGC | CATAAGGTCGCGAGCAGCT |
Title 1 | Control | EtOH (0.05%) | 1.25 μg/mL CBG | 2.5 μg/mL CBG | 5 μg/mL CBG |
---|---|---|---|---|---|
Ra (nm) | 998.27 ± 63 | 988.20 ± 82 | 270.54 ± 59 | 100.32 ± 13 | 77.17 ± 13 |
Rt (µm) | 19.59 ± 3.2 | 21.97 ± 5.9 | 6.66 ± 1.2 | 4.96 ± 2.7 | 2.93 ± 0.7 |
Rv (µm) | −11.21 ± 4.3 | −12.22 ± 2.7 | −3.03 ± 1.8 | −2.35 ± 1.9 | −1.66 ± 0.55 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Aqawi, M.; Sionov, R.V.; Gallily, R.; Friedman, M.; Steinberg, D. Anti-Biofilm Activity of Cannabigerol against Streptococcus mutans. Microorganisms 2021, 9, 2031. https://doi.org/10.3390/microorganisms9102031
Aqawi M, Sionov RV, Gallily R, Friedman M, Steinberg D. Anti-Biofilm Activity of Cannabigerol against Streptococcus mutans. Microorganisms. 2021; 9(10):2031. https://doi.org/10.3390/microorganisms9102031
Chicago/Turabian StyleAqawi, Muna, Ronit Vogt Sionov, Ruth Gallily, Michael Friedman, and Doron Steinberg. 2021. "Anti-Biofilm Activity of Cannabigerol against Streptococcus mutans" Microorganisms 9, no. 10: 2031. https://doi.org/10.3390/microorganisms9102031
APA StyleAqawi, M., Sionov, R. V., Gallily, R., Friedman, M., & Steinberg, D. (2021). Anti-Biofilm Activity of Cannabigerol against Streptococcus mutans. Microorganisms, 9(10), 2031. https://doi.org/10.3390/microorganisms9102031