Next Article in Journal
Assessment of Multilocus Sequence Analysis (MLSA) for Identification of Candidatus Liberibacter Solanacearum from Different Host Plants in Spain
Previous Article in Journal
Plasmid DNA Production in Proteome-Reduced Escherichia coli
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of a High-Resolution Single-Nucleotide Polymorphism Strain-Typing Assay Using Whole Genome-Based Analyses for the Lactobacillus acidophilus Probiotic Strain

1
Bioresource Collection and Research Center, Food Industry Research and Development Institute, 331 Shih-Pin Rd, Hsinchu 30062, Taiwan
2
Institute of Medical Science and Technology, National Sun Yat-sen University, Kaohsiung 80424, Taiwan
3
Rapid Screening Research Center for Toxicology and Biomedicine, National Sun Yat-sen University, Kaohsiung 80424, Taiwan
4
Livestock Research Institute, Council of Agriculture, Executive Yuan, Tainan 71246, Taiwan
5
Culture Collection & Research Institute, Synbio Tech Inc., Kaohsiung 82151, Taiwan
6
Department of Animal Science and Technology, College of Bioresources and Agriculture, National Taiwan University, No. 50, Ln. 155, Sec. 3, Keelung Rd., Taipei 10673, Taiwan
*
Author to whom correspondence should be addressed.
These authors are equally contributed to this work.
Microorganisms 2020, 8(9), 1445; https://doi.org/10.3390/microorganisms8091445
Submission received: 11 August 2020 / Revised: 2 September 2020 / Accepted: 16 September 2020 / Published: 21 September 2020
(This article belongs to the Section Food Microbiology)

Abstract

Lactobacillus acidophilus is one of the most commonly used industrial products worldwide. Since its probiotic efficacy is strain-specific, the identification of probiotics at both the species and strain levels is necessary. However, neither phenotypic nor conventional genotypic methods have enabled the effective differentiation of L. acidophilus strains. In this study, a whole-genome sequence-based analysis was carried out to establish high-resolution strain typing of 41 L. acidophilus strains (including commercial isolates and reference strains) using the cano-wgMLST_BacCompare analytics platform; consequently, a strain-specific discrimination method for the probiotic strain LA1063 was developed. Using a core-genome multilocus sequence-typing (cgMLST) scheme based on 1390 highly conserved genes, 41 strains could be assigned to 34 sequence types. Subsequently, we screened a set of 92 loci with a discriminatory power equal to that of the 1390 loci cgMLST scheme. A strain-specific polymerase chain reaction combined with a multiplex minisequencing method was developed based on four (phoU, secY, tilS, and uvrA_1) out of 21 loci, which could be discriminated between LA1063 and other L. acidophilus strains using the cgMLST data. We confirmed that the strain-specific single-nucleotide polymorphisms method could be used to quickly and accurately identify the L. acidophilus probiotic strain LA1063 in commercial products.

1. Introduction

Lactobacillus acidophilus is a commonly recognized species of lactic acid bacteria (LAB) that can be isolated from animal and human microbiota, such as those of the feces, mouth, and vagina [1,2,3,4]. L. acidophilus strains have been widely used in commercial probiotic products, including cheese, acidophilus milk, and yogurt, as well as in dietary supplements, with reported functional effects [5]. L. acidophilus NCFM is a well-known probiotic strain that is generally recognized as safe by the United States Food and Drug Administration: it improves the human intestinal environment and adjusts the balance of enteric bacteria [6]. The health benefits attributed to probiotic microorganisms are strain-specific [7,8]. Huys et al. [9] indicated that, because of methods that limit taxonomic resolution, more than 28% of commercially available probiotics are incorrectly labeled at the species or genus level. The ability to accurately identify probiotic strains in products is critical for suppliers and manufacturers. Therefore, starter cultures must be identified not only at the species level, but also, at the strain level to manage and control the quality of probiotic products.
Conventional molecular methods for strain typing L. acidophilus, such as randomly amplified polymorphic DNA (RAPD), matrix-assisted laser desorption/ionization–time-of-flight mass spectrometry, and pulsed-field gel electrophoresis (PFGE), are based on DNA and protein fingerprinting [10,11,12]. Although PFGE is considered the gold standard for bacterial strain typing, the discriminatory power of these methods is insufficient [13]. Multilocus sequence typing (MLST) is based on partial nucleotide sequences of multiple housekeeping genes and has been used for Lactobacillus species, including L. delbrueckii, L. fermentum, L. plantarum, L. paracasei, and L. sakei [14,15,16,17,18]. MLST is a suitable alternative to PFGE [19]. Ramachandran et al. [11] reported that the MLST scheme using seven conserved housekeeping genes (fusA, gpmA, gyrA, gyrB, lepA, pyrG, and recA) could be used as an intraspecies subtyping technique for the Lactobacillus complex (L. acidophilus, L. amylovorus, L. crispatus, L. gallinarum, L. gasseri, and L. johnsonii); however, two allelic profiles from five L. acidophilus strains were observed only in the gyrA gene. L. acidophilus strains have been considered to have little genome sequence variation [20,21,22,23], and they are regarded as a monophyletic taxon [10]. Therefore, higher-resolution strain-level differentiation methods must be developed for L. acidophilus strains.
With the technological achievement of whole-genome sequencing (WGS), dry-lab in silico analyses now rely on comparative genome sequences instead of conventional taxonomic methods for deep-level phylogenies [24,25]. Chun et al. [26] proposed minimum standards for species identification on the basis of overall genome-related indices, such as digital DNA‒DNA hybridization (dDDH) values and average nucleotide identity (ANI). By contrast, WGS-based strain typing uses a gene-by-gene approach, such as whole-genome MLST (wgMLST) or core-genome MLST (cgMLST), which entails the use of numerous gene loci to compare genomes [27,28]. These approaches provide resolutions superior to those of current subtyping techniques (including PFGE and multilocus variable-number tandem-repeat analysis (MLVA)) because they can discriminate between closely related strains of clinically relevant foodborne pathogens [29,30,31].
In this study, we aimed to develop a high-resolution strain-typing method for L. acidophilus probiotic strains, including a differential cgMLST scheme and a strain-specific detection technique, using comparative genome analyses.

2. Materials and Methods

2.1. L. acidophilus Strains and Culture Conditions

The 11 reference strains and probiotic strain LA1063 used in this study were obtained from the Bioresource Collection and Research Center (BCRC, Hsinchu, Taiwan), and Synbio Tech Inc., Kaohsiung, Taiwan, respectively, and they were authenticated through 16S rRNA gene sequencing (Supplementary Table S1). Strain LA1063 was isolated from feces of healthy Taiwanese adults and was used as a manufacturing strain for the probiotic supplements. The Lactobacillus strains were incubated anaerobically on Lactobacilli MRS agar (Difco Laboratories, Detroit, MI, USA) at 37 °C for 36 h, and fresh cultures were used for further DNA analyses.

2.2. WGS and Phylogenomic Metric Calculation

Genomic DNA was extracted using the EasyPrep HY genomic DNA extraction kit (Biotools Co. Ltd., Taipei, Taiwan) following the manufacturer’s protocols. The draft genomes of nine reference strains (BCRC 12255, BCRC 14065, BCRC 14079, BCRC 16092, BCRC 16099, BCRC 17008, BCRC 17481, BCRC 17486, and BCRC 80064) and the probiotic strain LA1063 were sequenced from an Illumina paired-end library with an average insert size of 350 bp by using an Illumina HiSeq4000 platform with the PE 150 strategy at Beijing Novogene Bioinformatics Technology Co., Ltd. (Beijing, China). The resulting raw reads were assembled de novo using SOAPdenovo software [32]. A total of 31 public genome sequences of L. acidophilus strains were downloaded from the United States National Center for Biotechnology Information bacterial genome database. Whole-genome similarities among the L. acidophilus strains were estimated using orthologous ANI [33].

2.3. cgMLST Scheme for L. acidophilus Strains

The cano-wgMLST_BacCompare web-based tool [34] was applied to the cgMLST analysis. This platform is composed of two major processes: whole-genome scheme extraction and discriminatory loci refinement. In this pipeline, genes were annotated using Prokka [35], and comparative genomics was performed using Roary [36]. Allele calling was performed using the Basic Local Alignment Search Tool Type N [37], with a minimum identity of 90% and coverage greater than 90% for the locus assignment (presence/absence profile) and exact match for the allele assignment (allele profile). Genetic relatedness trees were constructed from the allelic profile by using a neighbor-joining clustering algorithm in the Phylogeny Inference Package program [38], FigTree software (v1.4.3) [39], and GrapeTree software (v1.5.0) [40]. Finally, the Environment for the Tree Exploration v3 toolkit [41] and feature importance [42] program from scikit-learn [43] were applied to determine the discriminatory loci.

2.4. Validation of the cgMLST through a Differential MLST Scheme in Reference Strains

The cgMLST analysis results were validated by using an MLST scheme based on the reference strains. In short, by comparing with the sequence of cgMLST loci, the degenerate primers of several differential target genes were designed and tested (Supplementary Table S2). The 11 reference strains were used for validation. Polymerase chain reactions (PCRs) were performed using 81 μL of sterile Milli-Q water, 10 μL of 10× PCR buffer, 1.5 μL of denucleoside triphosphates (10 mM), 2.5 μL of forward primer (10 mM), 2.5 μL of reverse primer (10 mM), 2.5 U of Taq DNA polymerase (DreamTaq, Thermo Scientific, Waltham, MA, USA), and 3 μL of template DNA (100 ng/μL). The thermal protocol consisted of the following conditions: initial strand denaturation at 94 °C for 5 min, followed by 30 cycles at 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min, with a final extension step at 72 °C for 7 min. The resulting amplicons were purified using a QIA quick PCR Purification Kit (Qiagen Inc., Valencia, CA, USA) and sequenced using a BigDye Terminator v3.1 cycle-sequencing kit on a 3730 DNA Analyzer (Applied Biosystems and Hitachi, Foster City, CA, USA). The gene sequences of all strains obtained from sequencing were aligned using the Clustal X program, version 1.8 [44]. The MLST allele profiles and sequence types were analyzed using DnaSP version 5.1 [45].

2.5. Strain-Specific Identification for Probiotic Strain LA1063

The PCR- and single-nucleotide polymorphism (SNP)-based discrimination analyses were integrated for the direct strain-specific identification of probiotic strain LA1063. Strain-specific primers were designed using the genes that were chosen based on the presence or absence analysis and the cgMLST allele profiles. The multiplex minisequencing protocol for the analysis of SNPs was performed by following the method described by Huang et al. [46] and Lomonaco et al. [47]. The various concentrations of multiplex PCR and multiplex SNP-specific primers are listed in Table 1 and Table 2, respectively. The thermal cycling conditions for the multiple PCR and multiplex minisequencing were as follows: one cycle of 94 °C for 5 min; 30 cycles of 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min; one cycle of 72 °C for 7 min; and 25 cycles at 96 °C for 10 s, 50 °C for 5 s, and 60 °C for 1 min.

2.6. Authentication of Probiotic Strains in Commercial Products by Strain-Specific Assay

Three powder samples from separate batches of LA1063-derived materials for the production of probiotic supplements were analyzed. The LA1063 strain was isolated using serial dilution and plating methods and was identified using a MALDI Microflex LT mass spectrometer (Bruker Daltonics, Bremen, Germany), as described previously [48], followed by an LA1063 strain-specific assay.

3. Results and Discussion

The genomic data of all L. acidophilus strains had sequences of good quality that were directly reflected in the relatively small number of contigs (median, 24 and interquartile range, 17–34) (Supplementary Table S1), and these data were used in further comparative genomic approaches. Strains had diverse biochemical and phenotypic characteristics. However, high genome similarities among L. acidophilus strains are reported when the sequenced genomes are aligned [10]. This finding was consistent with the high ANI values (≥ 99.3%) among the 41 L. acidophilus strains in our study. In particular, most commercial isolates shared an extremely high degree of genome similarity (approximately 99.9%, Supplementary Figure S1). Comparable genomic conservation levels were previously identified in Bifidobacterium animalis subsp. lactis, for which isolates from dissimilar commercial products had highly conserved genome sequences [49,50].
Comparative pan-genome analyses of LAB strains indicated that the health effects of those strains varied among species and strains [51,52,53,54,55]. This variation warrants the genome-level characterization of probiotic strains. A further analysis of genome sequences for high-resolution strain typing of 41 L. acidophilus strains was conducted using the cano-wgMLST_BacCompare analytics platform. For this dataset, the L. acidophilus pan-genome allele database (PGAdb) contained 2603 genes, of which 1390 (53.4%), 687 (26.4%), and 526 (20.2%) were core, accessory, and unique, respectively. Using the cgMLST analysis based on the allele profiles of the 1390 core genes, 38 out of 41 L. acidophilus strains were separated into two clusters, Cluster A (comprising 34 strains) and Cluster B (comprising four strains); moreover, Cluster A was further separated into three subclusters, namely Clusters A-1 (27 strains), A-2 (two strains), and A-3 (two strains), along with three disparate strains. Almost all strains (> 90%) in Cluster A-1 were the commercial strains (Figure 1). A total of 34 different sequence types (STs) were obtained from the 41 strains by using a minimum spanning tree based on the 1390 loci (Supplementary Table S3). Of these, 29 STs were assigned to single strains; four STs (ST5, ST19, ST27, and ST29) were assigned to two strains; and one ST (ST9) was assigned to four strains. A total of 22 out of the 26 STs comprising the commercial strains were grouped into a tight cluster. The differences between the strains within this tight cluster ranged from 0 to 53 alleles (Figure 2). Strain LA1063 showed 21 loci differences from strain BCRC 17481. This result demonstrates the extremely low diversity in commercial isolates and is consistent with the findings of a wgMLST study that used 1815 loci [10]. In addition, we screened a set of the 92 loci with a discriminatory power equal to that of the 1390 loci cgMLST scheme (Figure 3). Detailed information on these loci with high discriminatory powers is provided in Table 3. A differential MLST scheme based on the eight loci of oppA_1, tr, ybhL, frdA, hp, rr, uvrA_2, and phoU genes for 11 reference strains, and one probiotic strain (LA1063) was also used to validate the genome-based analytical data through direct Sanger sequencing. The partial sequences containing the informatic SNPs of the eight differential genes were successfully amplified and sequenced (data not shown) and could be distinguished into different STs, although their lengths were different from those of the WGS in the database (Table 4).
Compared with genome sequence–based typing, a rapid, precise, cost-efficient, and reproducible method for strain identification would be ideal for probiotic starter strains [56,57]. Strain-specific sequences for probiotic strains have been developed mainly by targeting the 16S–23S internal transcribed spacer region, phages, and protein-encoding genes [58,59,60], as well as by using DNA banding patterns [61,62,63,64,65,66,67,68]. However, because these methods have resolution limitations pertaining to monophyletic taxa, strain-specific marker identification can be replaced by a comparative genome analysis that targets unique insertions and deletions (INDELs) or SNPs in DNA sequences [47,69]. Gene presence/absence profiles among L. acidophilus strains were analyzed in a pan-genomic analysis by using 41 genomes, revealing that two strains (LA1063 and BCRC 17481) exhibited absences of the redox-sensing transcriptional repressor Rex 2 (Rex2) gene, whereas the other 39 strains had this gene (Figure 4). However, when we analyzed the specific primer pair targeted by Rex2, we found that strains LA1063 and BCRC 17481 had a 68-bp deletion in this gene (Supplementary Materials Figure S2a,b).
To date, no consensus has been reached on the definition of a strain based on the number of nucleotide differences. However, a single-base pair cutoff has been discussed and considered by expert panels [57]. The 21 loci from the cgMLST data of 1390 core genes could be used to discriminate LA1063 from the other 40 strains (Table 5); therefore, to distinguish between LA1063 and other L. acidophilus strains, four of the 21 discriminated loci from the cgMLST data were selected, and they were confirmed to have T→G, T→G, T→G, and A→C nucleotide variations at the phoU, secY, tilS, and uvrA_1 loci, respectively (Supplementary Figure S3).
Sharma et al. [70] successfully used RAPD, a repetitive element–based PCR method, and MLST for tracking intentionally inoculated LAB strains in yogurt and probiotic powder; their proposed polyphasic approach effectively tracked the starter strains. However, such an approach is time- and cost-intensive. By contrast, multiplex minisequencing can be used to identify the nucleotide located at a given site. This method is especially useful for simultaneously screening many SNPs within one reaction tube. Automated fluorescent capillary electrophoresis for minisequencing products can be performed in only 40 min, which is less than the 2.5 h required for direct sequencing. Multiplex minisequencing has been successfully developed for the identification and differentiation of probiotic bacteria at the strain, subspecies, and species levels [46,71,72,73].
Subsequently, multiplex minisequencing was performed to directly identify strain-specific SNP-based markers in the probiotic LA1063 strain. Primers specific to SNPs were used to achieve simultaneous annealing next to the nucleotide at strain-specific SNPs, and three of the primers included different-length 5′ nonhomologous poly(dGACT) tails to facilitate terminator-incorporated primer differentiation by size (Table 2). Subsequently, multiple PCR amplicons with four diagnostic sizes (165, 245, 255, and 457 bp) (Figure 5a) were purified and applied in multiplex minisequencing. Four peaks with expected colors and positions were observed for LA1063 (Figure 5b). Next, by using the strain-specific multiplex PCR and SNP primers, separate batches of LA1063-derived probiotics in powder products were analyzed, and the nucleotide bases were found to be identical to those of the original probiotic strain (Figure 5), which demonstrated the specificity and reproducibility of this method.

4. Conclusions

Conventionally, the strain-level typing and identification of monophyletic species such as L. acidophilus is challenging. Our study revealed that comparative genomic analysis could substantially increase discriminatory power to reach high-resolution typing on the basis of the allele profiles of the cgMLST scheme, and the 41 L. acidophilus strains were categorized into 34 STs. Consequently, the strain-specific identification method relying on INDEL-SNP markers was successfully developed and made available for the direct discrimination and tracking of probiotic strains in commercial products.

Supplementary Materials

The following are available online at https://www.mdpi.com/2076-2607/8/9/1445/s1, Figure S1: Unweighted pair group method with arithmetic mean (UPGMA) dendrogram based on OrthoANI values among the 41 Lactobacillus acidophilus strains. Figure S2: Alignment of Rex2 gene sequences among the 11 Lactobacillus acidophilus strains reference strains and LA1063, differs in a 68-bp insertion/deletion. Figure S3: Discriminated loci between Lactobacillus acidophilus LA1063 and BCRC 17481. Table S1: Genomic characteristics of Lactobacillus acidophilus strains. Table S2. Genes and primers used for validation of reference strains. Table S3. List of the 1390 cgMLST loci in 41 Lactobacillus acidophilus strains.

Author Contributions

Conceptualization, C.-H.H. and K.W.; formal analysis, C.-H.H., C.-C.C., S.-H.C., J.-S.L. (Jong-Shian Liou), and Y.-C.L.; funding acquisition, C.-H.H. and J.-S.L. (Jin-Seng Lin); methodology, C.-H.H. and C.-C.C.; project administration, C.-H.H.; supervision, L.H. and K.W.; visualization, C.-H.H. and C.-C.C.; writing—original draft, C.-H.H; and writing—review and editing, L.H. and K.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by Ministry of Science and Technology, Taiwan, ROC (project no. MOST 108-2320-B-080-001) and Ministry of Economic Affairs, Taiwan, ROC (project no. 109-EC-17-A-22-0525).

Acknowledgments

We would like to thank Chii-Cherng Liao and Wen-Shen Chu (Food Industry Research and Development Institute, Hsinchu, Taiwan) for their encouragement during the course of this research activity.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Fujisawa, T.; Benno, Y.; Yaeshima, T.; Mitsuoka, T. Taxonomic study of the Lactobacillus acidophilus group, with recognition of Lactobacillus gallinarum sp. nov. and Lactobacillus johnsonii sp. nov. and synonymy of Lactobacillus acidophilus group A3 (Johnson et al. 1980) with the type strain of Lactobacillus amylovorus (Nakamura 1981). Int. J. Syst. Bacteriol. 1992, 42, 487–491. [Google Scholar]
  2. Gilliland, S.E.; Speck, M.L.; Morgan, C.G. Detection of Lactobacillus acidophilus in feces of humans, pigs, and chickens. Appl. Microbiol. 1975, 30, 541–545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Martinez-Pena, M.D.; Castro-Escarpulli, G.; Aguilera-Arreola, M.G. Lactobacillus species isolated from vaginal secretions of healthy and bacterial vaginosis-intermediate Mexican women: A prospective study. BMC Infect. Dis. 2013, 13, 189. [Google Scholar] [CrossRef] [Scilit]
  4. Román-Méndez, C.; Badet, C.; Yáñez, A.; Dominguez, M.A.; Giono, S.; Richard, B.; Nancy, J.; Dorignac, G. Identification of oral strains of Lactobacillus species isolated from Mexican and French children. J. Dent. Oral Hyg. 2009, 1, 009–016. [Google Scholar]
  5. Bull, M.; Plummer, S.; Marchesi, J.; Mahenthiralingam, E. The life history of Lactobacillus acidophilus as a probiotic: A tale of revisionary taxonomy, misidentification and commercial success. FEMS Microbiol. Lett. 2013, 349, 77–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Sanders, M.E.; Klaenhammer, T.R. The scientific basis of Lactobacillus acidophilus NCFM functionality as a probiotic. J. Dairy Sci. 2001, 84, 319–331. [Google Scholar] [CrossRef] [Scilit]
  7. Morelli, L.; Capurso, L. FAO/WHO guidelines on probiotics: 10 years later. J. Clin. Gastroentero. 2012, 46, S1–S2. [Google Scholar] [CrossRef] [Scilit]
  8. Shewale, R.N.; Sawale, P.D.; Khedkar, C.D.; Singh, A. Selection criteria for probiotics: A review. Int. J. Probiotics Prebiotics 2014, 9, 17–22. [Google Scholar]
  9. Huys, G.; Vancanneyt, M.; D’Haene, K.; Vankerckhoven, V.; Goossens, H.; Swings, J. Accuracy of species identity of commercial bacterial cultures intended for probiotic or nutritional use. Res. Microbiol. 2006, 157, 803–810. [Google Scholar] [CrossRef] [Scilit]
  10. Bull, M.J.; Jolley, K.A.; Bray, J.E.; Aerts, M.; Vandamme, P.; Maiden, M.C.J.; Marchesi, J.R.; Mahenthiralingam, E. The domestication of the probiotic bacterium Lactobacillus acidophilus. Sci. Rep. 2014, 4, 7202. [Google Scholar] [CrossRef] [Scilit]
  11. Ramachandran, P.D.; Lacher, W.; Pfeiler, E.A.; Elkins, C.A. Development of a tiered multilocus sequence typing scheme for members of the Lactobacillus acidophilus complex. Appl. Environ. Microbiol. 2013, 79, 7220–7228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Šedo, O.; Vávrová, A.; Vad’urová, M.; Tvrzová, L.; Zdráhal, Z. The influence of growth conditions on strain differentiation within the Lactobacillus acidophilus group using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry profiling. Rapid Commun. Mass Spectrom. 2013, 27, 2729–2736. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Swaminathan, B.; Barrett, T.J.; Hunter, S.B.; Tauxe, R.V. PulseNet: The molecular subtyping network for foodborne bacterial disease surveillance, United States. Emerg. Infect. Dis. 2001, 7, 382–389. [Google Scholar] [CrossRef] [PubMed]
  14. Chaillou, S.; Lucquin, I.; Najjari, A.; Zagorec, M.; Cham-pomier-Verges, M.C. Population genetics of Lactobacillus sakei reveals three lineages with distinct evolutionary histories. PLoS ONE 2013, 8, e73253. [Google Scholar] [CrossRef] [Scilit]
  15. Dan, T.; Liu, W.; Song, Y.; Xu, H.; Menghe, B.; Zhang, H.; Sun, Z. The evolution and population structure of Lactobacillus fermentum from different naturally fermented products as determined by multilocus sequence typing (MLST). BMC Microbiol. 2015, 15, 107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Parolo, C.C.; Do, T.; Henssqe, U.; Alves, L.S.; de Santan Giongo, F.E.; Corcao, G.; Maltz, M.; Beighton, D. Genetic diversity of Lactobacillus paracasei isolated from in situ human oral biofilms. J. Appl. Microbiol. 2011, 111, 105–113. [Google Scholar] [CrossRef] [Scilit]
  17. Tanigawa, K.; Watanabe, K. Multilocus sequence typing reveals a novel subspeciation of Lactobacillus delbrueckii. Microbiology 2011, 157, 727–738. [Google Scholar] [CrossRef] [Scilit]
  18. Xu, H.; Liu, W.; Zhang, W.; Yu, J.; Song, Y.; Menhe, B.; Zhang, H.; Sun, X. Use of multilocus sequence typing to infer genetic diversity and population structure of Lactobacillus plantarum isolates from different sources. BMC Microbiol. 2015, 15, 241. [Google Scholar] [CrossRef] [Scilit]
  19. Foxman, B.; Zhang, L.; Koopman, J.S.; Manning, S.D.; Marrs, C.F. Choosing an appropriate bacterial typing technique for epidemiologic studies. Epidemiol. Perspect. Innov. 2005, 2, 10. [Google Scholar] [CrossRef] [Scilit]
  20. Dean, S.N.; Vora, G.J.; Walper, S.A. Complete genome sequence of Lactobacillus acidophilus strain ATCC 53544. Genome Announc. 2017, 5, e01138-17. [Google Scholar] [CrossRef] [Scilit]
  21. Iartchouk, O.; Kozyavkin, S.; Karamychev, V.; Slesarev, A. Complete genome sequence of Lactobacillus acidophilus FSI4, isolated from yogurt. Genome Announc. 2015, 3, e00166-15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Palomino, M.M.; Allievi, M.C.; Martin, J.F.; Waehner, P.M.; Acosta, M.P.; Rivas, C.S.; Ruzal, S.M. Draft genome sequence of the probiotic strain Lactobacillus acidophilus ATCC 4356. Genome Announc. 2015, 5, e01421-14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Stahl, B.; Barrangou, R. Complete genome sequence of probiotic strain Lactobacillus acidophilus La-14. Genome Announc. 2013, 1, e00376-13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Nouioui, I.; Carro, L.; García-López, M.; Meier-Kolthoff, J.; Woyke, T.; Kyrpides, N.; Klenk, H.P.; Goodfellow, M.; Göker, M. Genome-based taxonomic classification of the phylum Actinobacteria. Front. Microbiol. 2018, 9, 2007. [Google Scholar] [CrossRef] [Scilit]
  25. Zheng, J.; Wittouck, S.; Salvetti, E.; Franz, C.M.A.P.; Harri, H.M.B.; Mattarelli, P.; O’Toole, P.W.; Pot, B.; Vandamme, P.; Walter, J.; et al. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int. J. Syst. Evol. Microbiol. 2020, 70, 2782–2858. [Google Scholar] [CrossRef] [Scilit]
  26. Chun, J.; Oren, A.; Ventosa, A.; Christensen, H.; Arahal, D.R.; da Costa, M.S.; Rooney, A.P.; Yi, H.; Xu, X.W.; De Meyer, S.; et al. Proposed minimal standards for the use of genome data for the taxonomy of prokaryotes. Int. J. Syst. Evol. Microbiol. 2018, 68, 461–466. [Google Scholar] [CrossRef] [Scilit]
  27. Schürch, A.C.; Arredondo-Alonso, S.; Willems, R.J.L.; Goering, R.V. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches. Clin. Microbiol. Infect. 2018, 24, 350–354. [Google Scholar] [CrossRef] [Scilit]
  28. Uelze, L.; Grützke, J.; Borowiak, M.; Hammerl, J.A.; Juraschek, K.; Deneke, C.; Tausch, S.H.; Malorny, B. Typing methods based on whole genome sequencing data. One Health Outlook 2020, 2, 3. [Google Scholar] [CrossRef] [Scilit]
  29. Neumann, B.; Prior, K.; Bender, J.K.; Harmsen, D.; Klare, I.; Fuchs, S.; Bethe, A.; Zühlke, D.; Göhler, A.; Schwarz, S.; et al. A core genome multilocus sequence typing scheme for Enterococcus faecalis. J. Clin. Microbiol. 2019, 57, e01686-18. [Google Scholar] [CrossRef] [Scilit]
  30. Pearce, M.E.; Alikhan, N.F.; Dallman, T.J.; Zhou, Z.; Grant, K.; Maiden, M.C.J. Comparative analysis of core genome MLST and SNP typing within a European Salmonella serovar Enteritidis outbreak. Int. J. Food Microbiol. 2018, 274, 1–11. [Google Scholar] [CrossRef] [Scilit]
  31. Taylor, A.J.; Lappi, V.; Wolfgang, W.J.; Lapierre, P.; Palumbo, M.J.; Medus, C.; Boxrud, D. Characterization of foodborne outbreaks of Salmonella enterica serovar Enteritidis with whole-genome sequencing single nucleotide polymorphism-based analysis for surveillance and outbreak detection. J. Clin. Microbiol. 2015, 53, 3334–3340. [Google Scholar] [CrossRef] [Scilit]
  32. Li, R.; Li, Y.; Kristiansen, K.; Wang, J. SOAP: Short oligonucleotide alignment program. Bioinformatics 2008, 24, 713–714. [Google Scholar] [CrossRef] [Scilit]
  33. Lee, I.; Ouk Kim, Y.; Park, S.C.; Chun, J. OrthoANI: An improved algorithm and software for calculating average nucleotide identity. Int. J. Syst. Evol. Microbiol. 2016, 66, 1100–1103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Liu, Y.Y.; Lin, J.W.; Chen, C.C. cano-wgMLST_BacCompare: A bacterial genome analysis platform for epidemiological investigation and comparative genomic analysis. Front. Microbiol. 2019, 10, 1687. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Seemann, T. Prokka: Rapid prokaryotic genome annotation. Bioinformatics 2014, 30, 2068–2069. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Page, A.J.; Cummins, C.A.; Hunt, M.; Wong, V.K.; Reuter, S.; Holden, M.T.; Fookes, M.; Falush, D.; Keane, J.A.; Parkhill, J. Roary: Rapid large-scale prokaryote pan genome analysis. Bioinformatics 2015, 31, 3691–3693. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  38. Robinson, D.F.; Foulds, L.R. Comparison of phylogenetic trees. Math. Biosci. 1981, 53, 131–147. [Google Scholar] [CrossRef] [Scilit]
  39. Rambaut, A. FigTree. Available online: http://tree.bio.ed.ac.uk/software/figtree/ (accessed on 6 January 2016).
  40. Zhou, Z.; Alikhan, N.F.; Sergeant, M.J.; Luhmann, N.; Vaz, C.; Francisco, A.P.; Carrico, J.A.; Achtman, M. GrapeTree: Visualization of core genomic relationships among 100,000 bacterial pathogens. Genome Res. 2018, 28, 1395–1404. [Google Scholar] [CrossRef] [Scilit]
  41. Huerta-Cepas, J.; Serra, F.; Bork, P. ETE 3: Reconstruction, analysis, and visualization of phylogenomic data. Mol. Biol. Evol. 2016, 33, 1635–1638. [Google Scholar] [CrossRef] [Scilit]
  42. Geurts, P.; Ernst, D.; Wehenkel, L. Extremely randomized trees. Mach. Learn. 2006, 63, 3–42. [Google Scholar] [CrossRef] [Scilit]
  43. Pedregosa, F.; Varoquaux, G.; Gramfort, A.; Michel, V.; Thirion, B.; Grisel, O.; Blondel, M.; Prettenhofer, P.; Weiss, R.; Dubourg, V.; et al. Scikit-learn: Machine learning in python. J. Mach. Learn. Res. 2011, 12, 2825–2830. [Google Scholar]
  44. Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The CLUSTAL X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Librado, P.; Rozas, J. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 2009, 25, 1451–1452. [Google Scholar] [CrossRef] [Scilit]
  46. Huang, C.H.; Chang, M.T.; Huang, M.C.; Lee, F.L. Application of the SNaPshot minisequencing assay to species identification in the Lactobacillus casei group. Mol. Cell. Probes 2011, 25, 153–157. [Google Scholar] [CrossRef] [Scilit]
  47. Lomonaco, S.; Furumoto, E.; Loquasto, J.J.R.; Morra, P.; Grassi, A.; Roberts, R.F. Development of a rapid SNP-typing assay to differentiate Bifidobacterium animalis ssp. lactis strains used in probiotic-supplemented dairy products. J. Dairy Sci. 2015, 98, 804–812. [Google Scholar]
  48. Huang, C.H.; Huang, L. Rapid species- and subspecies-specific level classification and identification of Lactobacillus casei group members using MALDI Biotyper combined with ClinProTools. J. Dairy Sci. 2018, 101, 979–991. [Google Scholar] [CrossRef] [Scilit]
  49. Briczinski, E.P.; Loquasto, J.R.; Barrangou, R.; Didley, E.G.; Roberts, A.M.; Roberts, R.F. Strain-specific genotyping of Bifidobacterium animalis subsp. lactis by using single-nucleotide polymorphisms, insertions, and deletions. Appl. Environ. Microbiol. 2009, 75, 7501–7508. [Google Scholar]
  50. Milani, C.; Duranti, S.; Lugli, G.A.; Bottacini, F.; Strati, F.; Arioli, S.; Foroni, E.; Turroni, F.; van Sinderen, D.; Ventura, M. Comparative genomics of Bifidobacterium animalis subsp. lactis reveals a strict monophyletic bifidobacterial taxon. Appl. Environ. Microbiol. 2013, 79, 4304–4315. [Google Scholar]
  51. Ghattargi, V.C.; Gaikwad, M.A.; Meti, B.S.; Nimonkar, Y.S.; Dixit, K.; Prakash, O.; Shouche, Y.S.; Pawar, S.P.; Dhotre, D.P. Comparative genome analysis reveals key genetic factors associated with probiotic property in Enterococcus faecium strains. BMC Genom. 2018, 19, 652. [Google Scholar] [CrossRef] [Scilit]
  52. Feyereisen, M.; Mahony, J.; Kelleher, P.; Roberts, R.J.; O’Sullivan, T.; Geertman, J.A.; van Sinderen, D. Comparative genome analysis of the Lactobacillus brevis species. BMC Genom. 2019, 20, 416. [Google Scholar] [CrossRef] [Scilit]
  53. Fontana, A.; Falasconi, I.; Molinari, P.; Treu, L.; Basile, A.; Vezzi, A.; Campanaro, S.; Morelli, L. Genomic comparison of Lactobacillus helveticus strains highlights probiotic potential. Front. Microbiol. 2019, 10, 1380. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Nguyen, T.L.; Kim, D.H. Genome-wide comparison reveals a probiotic strain Lactococcus lactis WFLU12 isolated from the gastrointestinal tract of olive flounder (Paralichthys olivaceus) harboring genes supporting probiotic action. Mar. Drugs 2018, 16, 140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Zhang, W.; Wang, J.; Zhang, D.; Liu, H.; Wang, S.; Wang, Y.; Ji, H. Complete genome sequencing and comparative genome characterization of Lactobacillus johnsonii ZLJ010, a potential probiotic with health-promoting properties. Front. Genet. 2019, 10, 1–13. [Google Scholar] [CrossRef] [Scilit]
  56. Treven, P. 2015. Strategies to develop strain-specific PCR based assays for probiotics. Benef. Microbes 2015, 6, 887–898. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Jackson, S.A.; Schoeni, J.L.; Vegge, C.; Pane, M.; Stahl, B.; Bradley, M.; Goldman, V.S.; Burguière, P.; Atwater, J.B.; Sanders, M.E. Improving end-user trust in the quality of commercial probiotic products. Front. Microbiol. 2019, 10, 739. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Brigidi, P.; Vitali, B.; Swennen, E.; Altomare, L.; Rossi, M.; Matteuzzi, D. Specific detection of Bifidobacterium strains in a pharmaceutical probiotic product and in human feces by polymerase chain reaction. Syst. Appl. Microbiol. 2000, 23, 391–399. [Google Scholar] [CrossRef] [Scilit]
  59. Brandt, K.; Alatossava, T. Specific identification of certain probiotic Lactobacillus rhamnosus strains with PCR primers based on phage-related sequences. Int. J. Food Microbiol. 2003, 84, 189–196. [Google Scholar] [CrossRef] [Scilit]
  60. Karapetsas, A.; Vavoulidis, E.; Galanis, A.; Sandaltzopoulos, R.; Kourkoutas, Y. Rapid detection and identification of probiotic Lactobacillus casei ATCC 393 by multiplex PCR. J. Mol. Microbiol. Biotechnol. 2010, 18, 156–161. [Google Scholar] [CrossRef] [Scilit]
  61. Ahlroos, T.; Tynkkynen, S. Quantitative strain-specific detection of Lactobacillus rhamnosus GG in human faecal samples by real-time PCR. J. Appl. Microbiol. 2009, 106, 506–514. [Google Scholar] [CrossRef] [Scilit]
  62. Fujimoto, J.; Matsuki, T.; Sasamoto, M.; Tomii, Y.; Watanabe, K. Identification and quantification of Lactobacillus casei strain Shirota in human feces with strain-specific primers derived from randomly amplified polymorphic DNA. Int. J. Food Microbiol. 2008, 126, 210–215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Fujimoto, J.; Tanigawa, K.; Kudo, Y.; Makino, H.; Watanabe, K. Identification and quantification of viable Bifidobacterium breve strain Yakult in human faeces by using strain-specific primers and propidium monoazide. J. Appl. Microbiol. 2010, 110, 209–217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Fujimoto, J.; Watanabe, K. Quantitative detection of viable Bifidobacterium bifidum BF-1 cells in human feces by using propidium monoazide and strain-specific primers. Appl. Environ. Microbiol. 2013, 79, 2182–2188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Lin, C.H.; Shih, T.W.; Pan, T.M. A “Ct contrast”-based strain-specific real-time quantitative PCR system for Lactobacillus paracasei subsp. paracasei NTU 101. J. Microbiol. Immunol. Infect. 2018, 51, 535–544. [Google Scholar] [CrossRef] [Scilit]
  66. Marzotto, M.; Maffeis, C.; Paternoster, T.; Ferrario, R.; Rizzotti, L.; Pellegrino, M.; Dellaglio, F.; Torriani, S. Lactobacillus paracasei A survives gastrointestinal passage and affects the fecal microbiota of healthy infants. Res. Microbiol. 2006, 157, 857–866. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Sisto, A.; De Bellis, P.; Visconti, A.; Morelli, L.; Lavermicocca, P. Development of a PCR assay for the strain-specific identification of probiotic strain Lactobacillus paracasei IMPC2.1. Int. J. Food Microbiol. 2009, 136, 59–65. [Google Scholar] [CrossRef] [Scilit]
  68. Toshimitsu, T.; Nakamura, M.; Ikegami, S.; Terahara, M.; Itou, H. Strain-specific identification of Bifidobacterium bifidum OLB6378 by PCR. Biosci. Biotech. Bioch. 2013, 77, 572–576. [Google Scholar] [CrossRef] [Scilit]
  69. Hansen, S.J.Z.; Morovic, W.; Demeules, M.; Stahl, B.; Sindelar, C.W. Absolute enumeration of probiotic strains Lactobacillus acidophilus NCFM®® and Bifidobacterium animalis subsp. lactis Bl-04®® via chip-based digital PCR. Front. Microbiol. 2018, 9, 704. [Google Scholar]
  70. Sharma, A.; Kaur, J.; Lee, S.; Park, Y.C. Tracking of intentionally inoculated lactic acid bacteria strains in yogurt and probiotic powder. Microorganisms 2020, 8, 5. [Google Scholar] [CrossRef] [Scilit]
  71. Huang, C.H.; Chang, M.T.; Huang, M.C.; Lee, F.L. Rapid identification of Lactobacillus plantarum group using the SNaPshot minisequencing assay. Syst. Appl. Microbiol. 2011, 34, 586–589. [Google Scholar] [CrossRef] [Scilit]
  72. Huang, C.H.; Chang, M.T.; Huang, M.C.; Wang, L.T.; Huang, L.; Lee, F.L. Discrimination of the Lactobacillus acidophilus group using sequencing, species-specific PCR and SNaPshot mini-sequencing technology based on the recA gene. J. Sci. Food Agric. 2012, 92, 2703–2708. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  73. Huang, C.H.; Huang, L.; Chang, M.T.; Wu, C.P. Use of novel specific primers targeted to pheS and tuf gene for species and subspecies identification and differentiation of the Bacillus subtilis subsp. subtilis, Bacillus amyloliquefaciens and Bacillus licheniformis. Afr. J. Microbiol. Res. 2017, 11, 264–270. [Google Scholar]
Figure 1. The allele-based neighbor-joining tree constructed with core-genome multilocus sequence-typing (cgMLST) profiles for the 41 Lactobacillus acidophilus strains on the basis of a comparison of 1390 differentiated core genes. The bold letters indicate commercial isolates. Bar, allele numbers.
Figure 1. The allele-based neighbor-joining tree constructed with core-genome multilocus sequence-typing (cgMLST) profiles for the 41 Lactobacillus acidophilus strains on the basis of a comparison of 1390 differentiated core genes. The bold letters indicate commercial isolates. Bar, allele numbers.
Microorganisms 08 01445 g001
Figure 2. The allele-based minimum spanning tree constructed with cgMLST profiles for the 41 Lactobacillus acidophilus strains on the basis of a comparison of 1390 differentiated core genes. Each circle represents a different sequence type. Branch values indicate the number of loci that differ between nodes.
Figure 2. The allele-based minimum spanning tree constructed with cgMLST profiles for the 41 Lactobacillus acidophilus strains on the basis of a comparison of 1390 differentiated core genes. Each circle represents a different sequence type. Branch values indicate the number of loci that differ between nodes.
Microorganisms 08 01445 g002
Figure 3. The allele-based neighbor-joining tree and heatmap constructed with cgMLST profiles for the 41 Lactobacillus acidophilus strains on the basis of 92 differentiated core genes. The bold letters indicate commercial strains. Different alleles in the same column are indicated by different colors. Bar, allele numbers.
Figure 3. The allele-based neighbor-joining tree and heatmap constructed with cgMLST profiles for the 41 Lactobacillus acidophilus strains on the basis of 92 differentiated core genes. The bold letters indicate commercial strains. Different alleles in the same column are indicated by different colors. Bar, allele numbers.
Microorganisms 08 01445 g003
Figure 4. Development of the LA1063 strain-specific PCR-based identification method. Heatmap and neighbor-joining tree of the analyzed the 41 Lactobacillus acidophilus strains based on the presence or absence of genes. Arrows indicate strain-specific markers for Lactobacillus acidophilus LA1063 and BCRC 17481 strains.
Figure 4. Development of the LA1063 strain-specific PCR-based identification method. Heatmap and neighbor-joining tree of the analyzed the 41 Lactobacillus acidophilus strains based on the presence or absence of genes. Arrows indicate strain-specific markers for Lactobacillus acidophilus LA1063 and BCRC 17481 strains.
Microorganisms 08 01445 g004
Figure 5. Single nucleotide polymorphism (SNP) genotyping of four polymorphisms in the phoU, secY, tilS, and uvrA_1 distinguished genes on the Lactobacillus acidophilus LA1063 strain. (a) Electropherogram of a 2% agarose gel containing multiple PCR products derived from four DNA fragments. Lane M, 100-bp ladder DNA marker; lane 1, LA1063 probiotic strain; lanes 2‒4, LA1063 isolated from separate batches of its derived probiotic product; and lane N, negative control. (b) Electropherograms obtained from the LA1063 strains by four-plex SNaPshot minisequencing assay. The X-axis represents the size of the minisequencing products (nucleotides); the Y-axis represents relative fluorescence units (RFUs). STD: GS120 LIZ size standard.
Figure 5. Single nucleotide polymorphism (SNP) genotyping of four polymorphisms in the phoU, secY, tilS, and uvrA_1 distinguished genes on the Lactobacillus acidophilus LA1063 strain. (a) Electropherogram of a 2% agarose gel containing multiple PCR products derived from four DNA fragments. Lane M, 100-bp ladder DNA marker; lane 1, LA1063 probiotic strain; lanes 2‒4, LA1063 isolated from separate batches of its derived probiotic product; and lane N, negative control. (b) Electropherograms obtained from the LA1063 strains by four-plex SNaPshot minisequencing assay. The X-axis represents the size of the minisequencing products (nucleotides); the Y-axis represents relative fluorescence units (RFUs). STD: GS120 LIZ size standard.
Microorganisms 08 01445 g005
Table 1. Multiplex PCR primers designed to direct strain typing for Lactobacillus acidophilus LA1063.
Table 1. Multiplex PCR primers designed to direct strain typing for Lactobacillus acidophilus LA1063.
Gene #DirectionSequence (5′–3′)Conc. (μM) §Amplicon Size (bp)
phoUForwardCATGATTATGTTCGTGCTAGA0.03165
ReverseTTCACCCGTAGTTTTGTATACC
uvrA_1ForwardGATGACATTGCGGCTACT0.03245
ReverseGTCAAGAGTATGTCTCGCCT
secYForwardTCGACCTTGAAGAACGCCT0.1255
ReverseCGATCTGCGCCGTAATATA
tilSForwardTAGGACAAGCATATCGCATT0.04457
ReverseATTGGTTCTCGATCAGCATA
#phoU: Phosphate-specific transport system accessory protein, uvrA_1: UvrABC system protein A, secY: protein translocase, tilS: tRNA (Ile)-lysidine synthetase, and § final concentration in the reaction mixture.
Table 2. Single nucleotide polymorphism (SNP) primers designed to direct strain typing for Lactobacillus acidophilus LA1063.
Table 2. Single nucleotide polymorphism (SNP) primers designed to direct strain typing for Lactobacillus acidophilus LA1063.
Primer NameSequence (5′–3′) *SNPConc. (μM) §
SAL001390-r #GCTAAGTTAACAATGTGATCGCA0.2
SAL000532-fgactgactgactgactGGAAAGTTATACTGGTCAATATA0.3
SAL000528-fgactgactgacTTTTATTCTTTTAATATACAGT1
SAL000608-r #gactgactgactgactgactTAGCTTTCACTCTAGTTCCATA0.3
* Italic low-case letters indicate the nonspecific tails. # Reverse SNP primer. § Final concentration in the reaction mixture.
Table 3. List of the 92 highly discriminatory loci in 41 Lactobacillus acidophilus strains.
Table 3. List of the 92 highly discriminatory loci in 41 Lactobacillus acidophilus strains.
LocusGeneAnnotationAllele Profile
BCRC 12255BCRC 14065BCRC 14079BCRC 16092BCRC 16099BCRC 17008BCRC 17481BCRC 17486BCRC 80064LA1063LA-5ATCC 4796ATCC 53544CIRM-BIA-442CIRM-BIA-445DS10_1ADS11_1ADS13_1ADS13_1BDS1_1ADS20_1DS24_1DS2_1ADS5_1ADS8_1ADS9_1ADSM 20079TDSM 20242DSM 9126MGYG-HGUT-02379FSI4L-55LA1LMG P-21904La-14NCFMP2PNW3UBLA-34WG-LB-IVYT1
SAL0000004hphypothetical protein11121113111111111111111111211111111111114
SAL0000007oppA_1Oligopeptide-binding protein AppA precursor1124111310131611211171111111485212111111915
SAL0000024yvgN_2putative oxidoreductase/MSMEI_234711321111111111111111111141211111111111115
SAL0000063group_157DegV domain-containing protein11236157151416211111111111394212811111111
SAL0000204group_1709Membrane transport protein11121111111111111111111111211111111111111
SAL0000205pepDA_2Dipeptidase A11221222121211211111111111322212411111115
SAL0000388sdhBL-serine dehydratase, beta chain11611113111111111111111111125111111111114
SAL0000391group_1900D-aspartate ligase11111111111111111111111111111111111111112
SAL0000409penAPenicillin-binding protein 2B11111311111111111111111111111111111111112
SAL0000458group_1968Putative phosphatase11111121121111111111111111111111111111111
SAL0000459glyASerine hydroxymethyltransferase11111111111111111111111111111111111111112
SAL0000460hphypothetical protein11121112111111111111111111211111111111113
SAL0000466appA_2Oligopeptide-binding protein AppA precursor11511131131111211111111111111212111111416
SAL0000467group_1976Putative tRNA (cytidine(34)-2’-O)-methyltransferase11111111111111111111111111113111111111112
SAL0000470hslVATP-dependent protease subunit HslV11111112111311111111111111121111111111114
SAL0000476ydcVInner membrane ABC transporter permease protein YdcV11111111111311111111111111111111111111112
SAL0000478thrCThreonine synthase11141111111111111111111111111111211111113
SAL0000493citG2-(5’’-triphosphoribosyl)-3’-dephosphocoenzyme-A synthase11111112111111111111111111121111111111113
SAL0000494rps130S ribosomal protein S111111111111111111111111111112111111111111
SAL0000501addAATP-dependent helicase/nuclease subunit A41111112111311111111111111111111111111115
SAL0000512acpSHolo-[acyl-carrier-protein] synthase11111111111111111111111111111111111111123
SAL0000541trTranscriptional regulator11111111211111122221122222111111132132214
SAL0000545hphypothetical protein11111113111111111111111111111111111111112
SAL0000548iscS_1Cysteine desulfurase11111111111111111111111311111111111111112
SAL0000566group_2084putative hydrolase11111112111411111111131111111111111511116
SAL0000572bca_2C protein alpha-antigen precursor11211117111511211331116111111212111111114
SAL0000604oppF_2Oligopeptide transport ATP-binding protein OppF11111111111121111111111111111111111111111
SAL0000605hphypothetical protein11111111111111111111111111111111311111112
SAL0000619cdsAPhosphatidate cytidylyltransferase11111114111211111111111111111111311111111
SAL0000652dnaBReplication initiation and membrane attachment protein11111132131111111511111111121111111111114
SAL0000660hphypothetical protein11111113211121122221122222111111222122214
SAL0000669pstCPhosphate transport system permease protein PstC11111124121111111111111111131111111111111
SAL0000674lgtProlipoprotein diacylglyceryl transferase11111111111111113111111111121111111111114
SAL0000678ybhLInner membrane protein YbhL111521131111072111111111111181111111411196
SAL0000702pepO_1Neutral endopeptidase11211116111111111111111111131111111111514
SAL0000704aspTAspartate/alanine antiporter11111112111111111111111111141111111111113
SAL0000737corAMagnesium transport protein CorA11211111111311211111111111151212111111114
SAL0000746hphypothetical protein11111211111311111111111111111111111111111
SAL0000756dtpTDi-/tripeptide transporter11311114111111111111111111111111111111112
SAL0000783lacF_1Lactose transport system permease protein LacF11231112111111211151111111321212111111114
SAL0000796yjbMGTP pyrophosphokinase YjbM11111111111111111111111111121111111111113
SAL0000802manX_1PTS system mannose-specific EIIAB component11111112111111111111111111111111111111111
SAL0000816glgAGlycogen synthase11111111111111111111111111111111111111112
SAL0000831murABUDP-N-acetylglucosamine 1-carboxyvinyltransferase 211211111111111211111111111111212111111113
SAL0000882hphypothetical protein11211112111111211111111111121212111111111
SAL0000889group_2404putative transporter YfdV11211111111111211111111111111212111111111
SAL0000894tigTrigger factor11211111111111311111111111111212411111111
SAL0000931rncRibonuclease 311111113111111111111111111111111111111112
SAL0000933citC[Citrate [pro-3S]-lyase] ligase11111111211111122221122222111111112112213
SAL0000944group_2459Uracil DNA glycosylase superfamily protein11211111111111211111111111111212111111113
SAL0000947hphypothetical protein11111111111111111111111111111111111111112
SAL0000970hphypothetical protein11111111111111111111111111121111111111111
SAL0000985yycITwo-component system YycFG regulatory protein11111111211111122221122222113111112112214
SAL0000991nudFADP-ribose pyrophosphatase11311223121211311111111111132313111111112
SAL0000999group_2512NADH dehydrogenase-like protein11111111112111111112211111111121111111113
SAL0001061frdAFumarate reductase flavoprotein subunit31411121121111111111111111111111111111115
SAL0001093rpsK30S ribosomal protein S1111211222121311211111111111122212111111112
SAL0001098odcIOrnithine decarboxylase, inducible11211113111111111111111111111111111111114
SAL0001105yheI_3putative multidrug resistance ABC transporter ATP-binding/permease protein YheI11311115211111322221122222131313112112214
SAL0001111frrRibosome-recycling factor11111111111111111111111111111111112211111
SAL0001114trmDtRNA (guanine-N(1)-)-methyltransferase11111111111111111111111111111111114211113
SAL0001120bglA_26-phospho-beta-glucosidase BglA11111111111211111111111111111111111111113
SAL0001129tfdRHTH-type transcriptional regulator TdfR11121111111411111111111111211111111111113
SAL0001142arlS_1Signal transduction histidine-protein kinase ArlS11111112111411111111111111125111111111113
SAL0001144sacXNegative regulator of SacY activity33333333333343333333333333333333333133332
SAL0001150hphypothetical protein1151143111314112111111171111810212111111196
SAL0001155hphypothetical protein11511116111231111111111111117111111111114
SAL0001159rsmIRibosomal RNA small subunit methyltransferase I11121112111111111111111111211111111111113
SAL0001160rrResponse regulator11731812111411211111111111325212111111611
SAL0001163ybiRInner membrane protein YbiR11321146141211311111111111232313111111215
SAL0001169ltaS1Lipoteichoic acid synthase 111111513111411112111111111111111111111167
SAL0001174recXRegulatory protein RecX11211111111111111111111111111111111111113
SAL0001177hphypothetical protein11111111113121111111111111111111111111114
SAL0001181group_590Putative gluconeogenesis factor11131114111111211111111111111212111111115
SAL0001204fumCFumarate hydratase class II11111431132111111112211111111121111111115
SAL0001210hphypothetical protein11111111111311111111111111111111111211114
SAL0001216hphypothetical protein11111111111111111111111111111111111111112
SAL0001231group_644AMP nucleosidase11111211111111111111111111111111111111111
SAL0001251group_665Peptidase family M2311111111111111111112111111111111111111111
SAL0001254merAMercuric reductase11411111111211111111111111111111111111113
SAL0001261group_675Ion channel11111111111111111111111111111111111311112
SAL0001276licC_1Lichenan permease IIC component11111411111311111111111111112111111111111
SAL0001295thiNThiamine pyrophosphokinase11123112111113111111111111111111111511114
SAL0001311group_731Bacterial membrane protein YfhO11111125121111411111111111111111111111113
SAL0001329hphypothetical protein22111111112111111112211111111121111111123
SAL0001334hphypothetical protein11111112111111111111111111111111111111111
SAL0001343gmk_2Guanylate kinase11111411111311111111111111111111112211111
SAL0001359mutLDNA mismatch repair protein MutL11111121121111111111111111114111111111135
SAL0001361alaSAlanine--tRNA ligase11111111111111111111111111113111111111121
SAL0001371hphypothetical protein11111111111111111111111111111111111211113
SAL0001385uvrA_2UvrABC system protein A11121111111111111111111111213111111411115
SAL0001390phoUPhosphate-specific transport system accessory protein11111112151111111111111111141111111111113
Sequence type 123456789101112135149151617181920212223924252627192728293031299323334
The bold letters indicate the genes used for the validation of reference strains. BCRC: Bioresource Collection and Research Center.
Table 4. Strain typing of 11 reference Lactobacillus acidophilus strains and 1 commercial probiotic strain by multilocus sequence-typing (MLST).
Table 4. Strain typing of 11 reference Lactobacillus acidophilus strains and 1 commercial probiotic strain by multilocus sequence-typing (MLST).
StrainOther DesignationAllele ProfileSequence Type
frdAhpoppA_1rrtruvrA_2phoUybhL
BCRC 10695TDSM 20079T111111111
BCRC 12255NCIMB 701243111211212
BCRC 14065CSCC 2401111111213
BCRC 14079 311132214
BCRC 16092CCUG 12853113111115
BCRC 16099CIP 103600115112216
BCRC 17008ATCC 4357111123217
BCRC 17009ATCC 53544114111218
BCRC 17481JCM 1028211121219
BCRC 17486JCM 12294111212110
BCRC 80064 1211112111
LA1063 * 2111212212
* Commercial probiotic strain.
Table 5. Strain-specific loci for Lactobacillus acidophilus LA1063.
Table 5. Strain-specific loci for Lactobacillus acidophilus LA1063.
LocusGeneAnnotation
SAL0000203ribDRiboflavin biosynthesis protein ribD
SAL0000410purNPhosphoribosylglycinamide formyltransferase
SAL0000528secYpreprotein translocase subunit secY
SAL0000532uvrA_1UvrABC system protein A
SAL0000608tilStRNA(Ile)-lysidine synthase
SAL0000626group_2144acid-resistance membrane protein
SAL0000650ddlAD-alanine--D-alanine ligase A
SAL0000698murFUDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
SAL0000781purBAdenylosuccinate lyase
SAL0000810group_2329putative peptidase
SAL0000850rbgARibosome biogenesis GTPase A
SAL0000942hphypothetical protein
SAL0001079dnaIPrimosomal protein DnaI
SAL0001095ybaKCys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK
SAL0001189atpEATP synthase subunit c
SAL0001312yodBHTH-type transcriptional regulator YodB
SAL0001323lldDL-lactate dehydrogenase [cytochrome]
SAL0001344mepS_2Murein DD-endopeptidase MepS/Murein LD-carboxypeptidase precursor
SAL0001364group_812Cysteine-rich secretory protein family protein
SAL0001365yicI_1Alpha-xylosidase
SAL0001390phoUPhosphate-specific transport system accessory protein
The bold letters indicate the genes used for developing strains-specific SNP detection methods for strain LA1063.

Share and Cite

MDPI and ACS Style

Huang, C.-H.; Chen, C.-C.; Chiu, S.-H.; Liou, J.-S.; Lin, Y.-C.; Lin, J.-S.; Huang, L.; Watanabe, K. Development of a High-Resolution Single-Nucleotide Polymorphism Strain-Typing Assay Using Whole Genome-Based Analyses for the Lactobacillus acidophilus Probiotic Strain. Microorganisms 2020, 8, 1445. https://doi.org/10.3390/microorganisms8091445

AMA Style

Huang C-H, Chen C-C, Chiu S-H, Liou J-S, Lin Y-C, Lin J-S, Huang L, Watanabe K. Development of a High-Resolution Single-Nucleotide Polymorphism Strain-Typing Assay Using Whole Genome-Based Analyses for the Lactobacillus acidophilus Probiotic Strain. Microorganisms. 2020; 8(9):1445. https://doi.org/10.3390/microorganisms8091445

Chicago/Turabian Style

Huang, Chien-Hsun, Chih-Chieh Chen, Shih-Hau Chiu, Jong-Shian Liou, Yu-Chun Lin, Jin-Seng Lin, Lina Huang, and Koichi Watanabe. 2020. "Development of a High-Resolution Single-Nucleotide Polymorphism Strain-Typing Assay Using Whole Genome-Based Analyses for the Lactobacillus acidophilus Probiotic Strain" Microorganisms 8, no. 9: 1445. https://doi.org/10.3390/microorganisms8091445

APA Style

Huang, C.-H., Chen, C.-C., Chiu, S.-H., Liou, J.-S., Lin, Y.-C., Lin, J.-S., Huang, L., & Watanabe, K. (2020). Development of a High-Resolution Single-Nucleotide Polymorphism Strain-Typing Assay Using Whole Genome-Based Analyses for the Lactobacillus acidophilus Probiotic Strain. Microorganisms, 8(9), 1445. https://doi.org/10.3390/microorganisms8091445

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop